ID: 1149614444

View in Genome Browser
Species Human (GRCh38)
Location 17:57987282-57987304
Sequence CAGCCGGGCCGGCCCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 886
Summary {0: 1, 1: 1, 2: 8, 3: 100, 4: 776}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149614444_1149614462 8 Left 1149614444 17:57987282-57987304 CCTGCCCCGGGCCGGCCCGGCTG 0: 1
1: 1
2: 8
3: 100
4: 776
Right 1149614462 17:57987313-57987335 CCCAGGCTGAATGGGACGGCGGG 0: 1
1: 0
2: 1
3: 22
4: 167
1149614444_1149614457 0 Left 1149614444 17:57987282-57987304 CCTGCCCCGGGCCGGCCCGGCTG 0: 1
1: 1
2: 8
3: 100
4: 776
Right 1149614457 17:57987305-57987327 GGGGATTCCCCAGGCTGAATGGG 0: 1
1: 0
2: 0
3: 10
4: 152
1149614444_1149614467 30 Left 1149614444 17:57987282-57987304 CCTGCCCCGGGCCGGCCCGGCTG 0: 1
1: 1
2: 8
3: 100
4: 776
Right 1149614467 17:57987335-57987357 GAGAGCTGGACAGAGGGAGAAGG 0: 1
1: 0
2: 14
3: 240
4: 1878
1149614444_1149614465 23 Left 1149614444 17:57987282-57987304 CCTGCCCCGGGCCGGCCCGGCTG 0: 1
1: 1
2: 8
3: 100
4: 776
Right 1149614465 17:57987328-57987350 ACGGCGGGAGAGCTGGACAGAGG 0: 1
1: 0
2: 1
3: 17
4: 267
1149614444_1149614464 16 Left 1149614444 17:57987282-57987304 CCTGCCCCGGGCCGGCCCGGCTG 0: 1
1: 1
2: 8
3: 100
4: 776
Right 1149614464 17:57987321-57987343 GAATGGGACGGCGGGAGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 277
1149614444_1149614460 7 Left 1149614444 17:57987282-57987304 CCTGCCCCGGGCCGGCCCGGCTG 0: 1
1: 1
2: 8
3: 100
4: 776
Right 1149614460 17:57987312-57987334 CCCCAGGCTGAATGGGACGGCGG 0: 1
1: 0
2: 1
3: 22
4: 169
1149614444_1149614458 4 Left 1149614444 17:57987282-57987304 CCTGCCCCGGGCCGGCCCGGCTG 0: 1
1: 1
2: 8
3: 100
4: 776
Right 1149614458 17:57987309-57987331 ATTCCCCAGGCTGAATGGGACGG 0: 1
1: 0
2: 0
3: 27
4: 231
1149614444_1149614453 -9 Left 1149614444 17:57987282-57987304 CCTGCCCCGGGCCGGCCCGGCTG 0: 1
1: 1
2: 8
3: 100
4: 776
Right 1149614453 17:57987296-57987318 GCCCGGCTGGGGGATTCCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 191
1149614444_1149614466 24 Left 1149614444 17:57987282-57987304 CCTGCCCCGGGCCGGCCCGGCTG 0: 1
1: 1
2: 8
3: 100
4: 776
Right 1149614466 17:57987329-57987351 CGGCGGGAGAGCTGGACAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 293
1149614444_1149614456 -1 Left 1149614444 17:57987282-57987304 CCTGCCCCGGGCCGGCCCGGCTG 0: 1
1: 1
2: 8
3: 100
4: 776
Right 1149614456 17:57987304-57987326 GGGGGATTCCCCAGGCTGAATGG 0: 1
1: 0
2: 0
3: 8
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149614444 Original CRISPR CAGCCGGGCCGGCCCGGGGC AGG (reversed) Intronic
900077260 1:827588-827610 GGGCCGGGCCGGGCCGGGGCGGG + Intergenic
900143957 1:1150079-1150101 CAGCCAGGCCGCTCCGGGTCTGG + Intergenic
900245158 1:1633134-1633156 GCGCAGGGCCGGGCCGGGGCGGG - Intronic
900256389 1:1700293-1700315 GCGCAGGGCCGGGCCGGGGCGGG - Intronic
900310095 1:2029392-2029414 CAGCCGGGCCAGGCCAGGTCAGG + Intronic
900349554 1:2228169-2228191 CGGGCGGGCGGGCCGGGGGCCGG + Intergenic
900374660 1:2347981-2348003 CAGCACAGCCGTCCCGGGGCAGG + Intronic
900393485 1:2443793-2443815 CAGCTCGGGCGGCCCGCGGCGGG - Intronic
900409148 1:2505012-2505034 CAGCCGGGCCCGCCAGGCCCAGG + Exonic
900471141 1:2855561-2855583 GAGGAGGGCTGGCCCGGGGCCGG - Intergenic
900480047 1:2893867-2893889 CAACAGGGCCGGCCTGGGTCAGG - Intergenic
900579011 1:3398954-3398976 CTGCCCTGCCGTCCCGGGGCTGG + Intronic
900623516 1:3598052-3598074 CTGCAGGGCAGGCCCGGGGCGGG - Intronic
900630647 1:3633424-3633446 CCGCCGCCCCGGGCCGGGGCCGG - Exonic
900658593 1:3772261-3772283 CAGCCGGGTCCCCGCGGGGCTGG + Intergenic
900671319 1:3856851-3856873 CTGCGGCGCCGGCCCAGGGCCGG - Intronic
900674837 1:3878690-3878712 CAGCGAGGCCGGCCCGGGAGAGG - Intronic
901018011 1:6242625-6242647 GATCCGGGCCGACCCGGGCCTGG - Intergenic
901088423 1:6625747-6625769 GGGCCGGGCCGGGCCGGGCCGGG - Intronic
901183671 1:7358553-7358575 CAGCCGGGGCTGCCCGGGGCAGG - Intronic
901525978 1:9823728-9823750 CAGCATCGCCAGCCCGGGGCGGG + Exonic
901627285 1:10631454-10631476 GAGCGGGGGCGGCCCGGGCCTGG - Intergenic
901702868 1:11054774-11054796 CAGGAGGTCCGGCCCGGGGCTGG + Exonic
902399593 1:16150712-16150734 CAGCCGGCCCAGGCCAGGGCTGG - Intronic
902600874 1:17539657-17539679 CAGCCGCGGCGCCCCGGGACCGG + Intergenic
902896948 1:19485590-19485612 GGCCCGGGCCGGGCCGGGGCGGG - Intergenic
903184338 1:21620711-21620733 CGGCTGGCCCGGCTCGGGGCTGG + Intronic
903295261 1:22339503-22339525 CAGCAGGGCAGGGCGGGGGCGGG + Intergenic
903738237 1:25543803-25543825 CAGCCGGGCCGGGCCGGGATCGG + Intronic
904251849 1:29230775-29230797 CCGCCGAGCCTGCCCGGGTCCGG - Exonic
904641914 1:31937851-31937873 GGGCCGGGCCGGGCCGGGGCGGG - Intronic
904642007 1:31938131-31938153 CACCCGGCCCGGCCCGGCGGCGG + Exonic
904744512 1:32702765-32702787 GATCCCGGCCGGCCCCGGGCCGG + Exonic
905151449 1:35931085-35931107 CTTCCGGGGCGGCCCCGGGCAGG + Exonic
905179250 1:36156307-36156329 TTGCCGGGCCGGGCCGGGCCGGG + Exonic
906109175 1:43312059-43312081 CAGCTGAGCCGGCCAGGGGAAGG + Exonic
906198884 1:43946927-43946949 CAGGCCGGCCGGGACGGGGCAGG - Exonic
906225601 1:44119001-44119023 CCGCCCGGCCTGCCAGGGGCTGG - Intronic
906615842 1:47232259-47232281 GGGCCGGGCGGGCGCGGGGCGGG - Intergenic
906627043 1:47333886-47333908 CGGCCGGCGCGGCGCGGGGCGGG - Exonic
906720025 1:47997493-47997515 GCGCCGGGCCGGGCCGGGACGGG + Intergenic
907261326 1:53220662-53220684 CAGTAGGGCGGGGCCGGGGCCGG + Intergenic
907486399 1:54781186-54781208 CAGCTGGGCGGGGCCTGGGCGGG + Exonic
908131871 1:61082466-61082488 CGGCCGGGCCGGCGCGGGAGCGG + Intronic
909512968 1:76475855-76475877 CAGCGGGGCCTGTCGGGGGCTGG - Intronic
910237164 1:85048147-85048169 CTGCCGGGCCTGCCCGGGGCTGG - Intronic
911219704 1:95234098-95234120 CAACCGGGCGGGACGGGGGCGGG - Intronic
911449443 1:98045540-98045562 CAGCGCGGCCGGCCGGGGGTGGG + Intergenic
912851764 1:113132412-113132434 CTGCAGGGGCGGCCAGGGGCAGG - Intergenic
913144505 1:115976469-115976491 GGGGCGGGCCGGGCCGGGGCGGG - Intergenic
913695199 1:121318044-121318066 CAGACGGGCAGGCAGGGGGCGGG - Intronic
914142365 1:144962016-144962038 CAGACGGGCAGGCAGGGGGCGGG + Intronic
914350398 1:146835192-146835214 CCGCCGTGCCGGGCCGGTGCTGG - Intergenic
914758450 1:150579753-150579775 CTGCCCGGCCGGGCCGGGGCGGG + Intergenic
914758454 1:150579758-150579780 CGGCCGGGCCGGGGCGGGGCCGG + Intergenic
915161381 1:153922863-153922885 GGGGCGGGCCGGACCGGGGCGGG + Exonic
915332941 1:155124971-155124993 CACCCGGGCAGGCTGGGGGCTGG + Intergenic
915367363 1:155323645-155323667 CAGCAGTGCCAGCTCGGGGCTGG - Intronic
915490594 1:156248064-156248086 CAGGCGGGCCAGGCCTGGGCGGG + Intronic
915541906 1:156572656-156572678 GAGCCGGGCCGCCCAGGTGCTGG + Intergenic
917291567 1:173477159-173477181 GGGCCGGGCCGGGCTGGGGCCGG - Intergenic
918043530 1:180927528-180927550 CAGCCAGGCTGGCCGAGGGCAGG - Intronic
918177261 1:182057283-182057305 CAGGCGGGCCGGCGCGAGGGCGG - Exonic
919753839 1:201054369-201054391 CAGCAGGGCCTGCCCTGGGGAGG + Intronic
920194046 1:204214144-204214166 CTGCCGCGCCTGCCCGGGGAAGG + Intergenic
920215903 1:204361487-204361509 CAGCCTGGCCTGCCCTGGGGTGG - Intronic
920401610 1:205680035-205680057 GGGCCGGGCCGGACCGGGCCGGG - Intronic
920482530 1:206336423-206336445 CAGACGGGCAGGCAGGGGGCGGG - Intronic
921132134 1:212228941-212228963 CAGCAGGGGCGGACCGGGGAGGG + Intergenic
922476950 1:225912903-225912925 CAGCCGGGAGGCCCCTGGGCAGG - Intronic
922602970 1:226870869-226870891 CGGCTGGGCCGGCCCGGAACTGG + Intronic
922674497 1:227542340-227542362 CGGCCGGGCCGGCCAGAGGGCGG + Intergenic
922753756 1:228082915-228082937 CAGACGGGCCGGGCTGAGGCTGG + Intronic
922765994 1:228157070-228157092 CAGCGGGACCAGCCGGGGGCTGG + Intronic
923056072 1:230426428-230426450 GAGCTGGGCGGGCCCGGCGCGGG + Intergenic
923087208 1:230710757-230710779 CAGCCAGGCCAGCCCAGGCCAGG + Exonic
923126751 1:231040223-231040245 CAGCGGGGCAGGCGCGTGGCCGG - Exonic
923293844 1:232573685-232573707 CAGCCTGCTCTGCCCGGGGCTGG - Intergenic
923698898 1:236281747-236281769 CCGCCGGGCAGGCGCTGGGCAGG - Exonic
924560552 1:245154356-245154378 CCCCCCGGCCGGCCCGGGGTCGG + Intergenic
1063484116 10:6403136-6403158 CAGCAGGGCCGGCCAGTGCCCGG - Intergenic
1064384544 10:14878806-14878828 CGCGCGGGCCGGCCAGGGGCGGG + Intronic
1064423955 10:15213772-15213794 CAGCCGGGACGACGAGGGGCTGG + Exonic
1065099568 10:22320740-22320762 CCGCGGGGCCGGCCGGGGGGCGG + Intronic
1066022567 10:31318827-31318849 CCGCCGCGGCTGCCCGGGGCAGG - Intronic
1066429453 10:35337261-35337283 CAGCCGGGCCGCCCCGACGTTGG - Intronic
1067091169 10:43266544-43266566 GGGCCGGGCCGGGCCGGGCCGGG - Intronic
1067091171 10:43266549-43266571 CTGGCGGGCCGGGCCGGGCCGGG - Intronic
1067321379 10:45224258-45224280 CTGCGTGGCCGGACCGGGGCTGG - Intergenic
1067493568 10:46740036-46740058 AAGCCAGGCCGCCCCGGGGTGGG + Intergenic
1067601092 10:47600368-47600390 AAGCCAGGCCGCCCCGGGGTGGG - Intergenic
1067943377 10:50675087-50675109 CAGCGGGGCCTTCCCAGGGCGGG - Intergenic
1070112055 10:73495871-73495893 CAGCATGGCCGCCCCGGAGCCGG - Exonic
1070314219 10:75295182-75295204 CAGGCGGCACGGCGCGGGGCGGG + Intergenic
1071579685 10:86757245-86757267 CAGCCTCGCCGCTCCGGGGCGGG - Intronic
1071652636 10:87408240-87408262 AAGCCAGGCCGCCCCGGGGTGGG - Intergenic
1072679848 10:97498811-97498833 GAGAGGGGCCGGCCTGGGGCGGG + Intergenic
1072727842 10:97825522-97825544 CAGTGGGGCCGGCCAGGGGCAGG + Intergenic
1073196202 10:101694332-101694354 ACGCGGGGCCGGCTCGGGGCGGG + Intronic
1073287162 10:102395994-102396016 CAGCCGGCCGGGTCAGGGGCAGG - Intronic
1073290099 10:102409207-102409229 GAGCCGGGCCGGCTCGGGCCGGG - Intronic
1073322147 10:102621931-102621953 CAGCCTGGCTTGCCCAGGGCAGG + Intronic
1073327102 10:102649477-102649499 CAGCCTGCTCGGCCCGGGGCAGG - Intronic
1074130390 10:110568164-110568186 CCGCCGGGGCGGCCGCGGGCGGG + Intronic
1074182610 10:111077402-111077424 GGCCCGGCCCGGCCCGGGGCTGG - Exonic
1074585916 10:114767962-114767984 CAGCCGCGCCGGCCCCAGCCCGG - Intergenic
1074618697 10:115094217-115094239 CTCCCGGGGCGCCCCGGGGCTGG - Intronic
1076372294 10:129963580-129963602 GGGCCGGGCCGGGCCGGGGCCGG + Intronic
1076670402 10:132117796-132117818 CAGTCAGGCCCGCACGGGGCAGG + Intronic
1076683663 10:132187322-132187344 GGGCCGGGCCGGGCCGGGCCTGG - Intronic
1076722058 10:132397072-132397094 CAGCCGAGCCGAGCCGGGCCGGG - Intergenic
1076722210 10:132397572-132397594 GGGCCGGGGCGGGCCGGGGCGGG + Intronic
1076746739 10:132518300-132518322 GAGCAGGGCCGGCCCAGGGGAGG - Intergenic
1076793381 10:132787839-132787861 CGGCCGGGCAGACCCTGGGCGGG + Intergenic
1076796358 10:132800152-132800174 CAGCCTGGCTGGCCCTGTGCTGG - Intergenic
1076836319 10:133022862-133022884 CAGCCGCGGCGGCTCTGGGCCGG + Intergenic
1076895284 10:133308594-133308616 CAGCCGGGGCGGGGCGGAGCGGG - Exonic
1077043770 11:535585-535607 CAGACGGACGGGCGCGGGGCGGG - Intronic
1077060330 11:615065-615087 CACCCGGGGCGGGGCGGGGCTGG + Intronic
1077076906 11:706153-706175 GGGCCGGGCCGGGGCGGGGCCGG - Exonic
1077076908 11:706158-706180 CGGCGGGGCCGGGCCGGGGCGGG - Exonic
1077093950 11:791577-791599 CAGCCTGCCCGGCCCAGGCCCGG + Exonic
1077144054 11:1036980-1037002 CAGCGGGGAGGGCCCGGGCCAGG - Intergenic
1077439470 11:2561310-2561332 CAGCTGGGCCAGCACGGGACGGG + Intronic
1077491330 11:2862327-2862349 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1077495418 11:2884626-2884648 AAGCGGGGCCGGGCCGGGCCGGG + Intronic
1077495421 11:2884631-2884653 GGGCCGGGCCGGGCCGGGGCGGG + Intronic
1077635870 11:3841000-3841022 GAGGCGGGGCGGGCCGGGGCGGG + Intergenic
1077637838 11:3855626-3855648 GCGCGGGGCGGGCCCGGGGCGGG - Intronic
1077891124 11:6418950-6418972 CACCGGGGCTGGGCCGGGGCAGG + Intronic
1077922998 11:6655533-6655555 CAGACGGGCCGGGCGGGCGCGGG + Intronic
1078317776 11:10306542-10306564 GACCCGGGCCGGCCTCGGGCAGG - Exonic
1078460841 11:11514274-11514296 CTGCAGGGCCAGCCTGGGGCAGG - Intronic
1078594324 11:12674133-12674155 GAGCCGGGGCGGGGCGGGGCGGG - Intergenic
1079296907 11:19241954-19241976 CAGGTGAGCCGGCCTGGGGCTGG - Intergenic
1080836258 11:35943951-35943973 TAGCGGAGCCGGGCCGGGGCCGG + Intergenic
1081726678 11:45334651-45334673 CAGCCGGGCCTGCTCCTGGCAGG + Intergenic
1081863442 11:46347251-46347273 CAGGCGGGCCGGGCCGGGCTGGG + Intronic
1083332520 11:61905519-61905541 CAGCGGGGCCAGCCCGGGCTGGG + Intronic
1083389543 11:62337744-62337766 CAGCAGGTCCGGGCCGGGGGCGG + Intronic
1083614244 11:64018536-64018558 CAGCCCGCCCAGCCCAGGGCAGG + Intronic
1083648217 11:64185460-64185482 CAGGAGGGCCGGGCCGAGGCCGG + Exonic
1083672244 11:64305928-64305950 CTGGTGGGCCGGCCTGGGGCAGG + Intronic
1083748109 11:64746143-64746165 CAGCCTCGCTGGCCGGGGGCGGG - Intergenic
1083753670 11:64777992-64778014 CAGCCGGGCCCGGCCGGCGGCGG - Exonic
1083769403 11:64857975-64857997 CAGCCAGGCCGGAGCGTGGCTGG - Intronic
1084031061 11:66480718-66480740 CAGCCGGGACGGGGCGTGGCGGG + Intronic
1084084614 11:66849292-66849314 GAACCGGGCCGGCCAGAGGCAGG - Exonic
1084153815 11:67303266-67303288 CCGCTGGGCCGGCCCGGGCCGGG + Intergenic
1084212495 11:67630449-67630471 CGGCAGGGCCGGGCCGTGGCCGG + Intergenic
1084262821 11:67990390-67990412 CACCCCAGCAGGCCCGGGGCTGG - Intergenic
1084295759 11:68212945-68212967 CGGCCGGGCCGGTGCGGGGCCGG - Intronic
1084646862 11:70463918-70463940 CAGCCGCGCCGGCCGGGCCCAGG - Intergenic
1084810572 11:71608715-71608737 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
1084972996 11:72781600-72781622 ACGCCGGGCGGGCGCGGGGCGGG + Intronic
1085519524 11:77129960-77129982 TAGCGGGGCGGGCCCGGGCCCGG + Intronic
1085622261 11:78046344-78046366 CTGCCGGGCAGGCCCAGGCCTGG - Intronic
1086337157 11:85811250-85811272 AGGCCGGGGCGGGCCGGGGCGGG - Intergenic
1086948358 11:92866656-92866678 CCCCCGGGCCGGCCAGGAGCAGG + Intronic
1088645518 11:111913493-111913515 CAGCTGGGGCGGCCCGAGGCCGG - Exonic
1089529436 11:119116802-119116824 GAGCAGGGCCGGCCCGGGATGGG + Exonic
1089533855 11:119149219-119149241 CCGGCGGCCCGGGCCGGGGCGGG - Exonic
1089533899 11:119149332-119149354 CCCCCGGGCCGGTGCGGGGCCGG - Exonic
1089622275 11:119728874-119728896 CAGCCGGGCGCGCCGGGGGTGGG - Exonic
1089665146 11:120013562-120013584 CAGCCGGCACAGCCCCGGGCAGG - Intergenic
1089800613 11:121024158-121024180 AAGCGGCGCCGGGCCGGGGCTGG + Exonic
1090709949 11:129375434-129375456 GAGCCGGGCCGGCGGGTGGCAGG + Intergenic
1091122019 11:133064746-133064768 CACACGGCCCGGCGCGGGGCGGG + Intronic
1091740755 12:2959240-2959262 GGGCCGGGCCGGGCCGGGGCGGG - Intergenic
1091740764 12:2959256-2959278 CCGCCGGGGCGGGGCGGGGCCGG - Intergenic
1091795341 12:3294693-3294715 CAGCCGGGCCCCCCTGGAGCAGG - Intergenic
1091857728 12:3752965-3752987 CGGCCGGGGCGGCCGGGGGGCGG - Intronic
1092155301 12:6278533-6278555 AATCCGGGCCGAGCCGGGGCCGG + Intergenic
1092833368 12:12465780-12465802 CTGCCCGGCCTGCCTGGGGCTGG + Exonic
1093464857 12:19439405-19439427 CAGCGGGGCGGGCGCCGGGCGGG + Intronic
1093958723 12:25250675-25250697 CCGCCGGCCCCGCCCGGCGCCGG + Intronic
1094025736 12:25958635-25958657 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1094025739 12:25958640-25958662 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1094526646 12:31235469-31235491 CAGCCTGTCCCGCCCGAGGCAGG - Intergenic
1095038382 12:37418891-37418913 CATCCGTGCAGGCCTGGGGCTGG + Intergenic
1095559883 12:43552051-43552073 CAGCAGCGCGGGCCCTGGGCCGG + Intergenic
1095938000 12:47705836-47705858 GAGGCGGGGCGGGCCGGGGCTGG - Intronic
1096116950 12:49060398-49060420 GAGCCGGCCAGGCCGGGGGCGGG - Intergenic
1096699347 12:53371834-53371856 GAGCTGGGCCGGGCCGGGCCGGG + Intergenic
1096716266 12:53493243-53493265 CACCTGGGCCGGCCCAGGTCAGG - Intronic
1096796730 12:54082554-54082576 GCGGCGGGCCGGTCCGGGGCCGG + Intergenic
1098105969 12:67069329-67069351 CGGCCGGGCCGGGCCGGGCCGGG + Intergenic
1098106002 12:67069405-67069427 AGGCCGGGCCGGGCCGGGGGCGG + Intergenic
1099202008 12:79689687-79689709 CAGCCGGACCGGGCCGGGGCGGG - Intronic
1100565447 12:95790329-95790351 CAGCCGGGCCGGGCGGGTGCCGG + Exonic
1100797673 12:98199318-98199340 CACCAGGGCCTGCCAGGGGCTGG - Intergenic
1101391387 12:104303657-104303679 TGGCTGGGCCGGGCCGGGGCGGG + Intronic
1101910546 12:108857599-108857621 CGGCCGGGCCGAGCCGGGCCGGG + Intergenic
1102053698 12:109880648-109880670 CCGGGGGGCCGGCCGGGGGCGGG + Intergenic
1102238624 12:111310152-111310174 CAGCAGGGGCTGCCCGGGGCTGG - Exonic
1102679984 12:114684734-114684756 CCGCCCGGCTCGCCCGGGGCGGG - Intergenic
1103595449 12:122022275-122022297 CGGCGGGGCTGGGCCGGGGCAGG - Intronic
1103614059 12:122141180-122141202 CAGCCAGGTGGGGCCGGGGCAGG + Intronic
1103949414 12:124542945-124542967 CAGGAGGGCTGGCACGGGGCAGG - Intronic
1104020559 12:124989210-124989232 GAGCCGGGCCGGGCAGGGGGCGG + Intergenic
1104602311 12:130162214-130162236 CAGGCGGGCTGTCCCGGGGCTGG + Intergenic
1104697093 12:130872005-130872027 GGGCGGGGCCGGCGCGGGGCGGG - Exonic
1104697182 12:130872264-130872286 GGGCCCGGCCGGGCCGGGGCAGG + Intronic
1104745062 12:131205263-131205285 GGGCCGGGCTGGGCCGGGGCTGG + Intergenic
1104789336 12:131472136-131472158 GAGCCGGGCTGGGCCGGGGCTGG - Intergenic
1104913534 12:132251947-132251969 CAGCCTGGCAGGCGGGGGGCAGG - Intronic
1105405319 13:20128176-20128198 CAGCGGGGCCGGCCAGGGCCCGG + Intergenic
1105413970 13:20193221-20193243 CACCCGGGCCGCCAAGGGGCTGG - Intergenic
1105502937 13:20988522-20988544 CAGGCGGACCGGGCCGCGGCTGG + Exonic
1106109045 13:26760833-26760855 CGGCCGGGCGCGCGCGGGGCGGG - Intergenic
1106132477 13:26951743-26951765 CCGCTGGGCTGGCACGGGGCTGG - Intergenic
1107133595 13:36920558-36920580 CTGCCGGGGTGGCCCGGGGGTGG + Intronic
1108313886 13:49220098-49220120 GAGCAGGGCCGGGCCGGGGCGGG + Intergenic
1108541507 13:51451747-51451769 CTGCCGGGCCGGGCCGGGAGGGG + Intronic
1110690921 13:78429087-78429109 GAGCCGGGCTGGGCCGGGGTAGG - Intergenic
1113254858 13:108495765-108495787 CAGCCAGGCCGGCTGGAGGCTGG - Intergenic
1113484600 13:110645105-110645127 CAGCCAGGCCGGGCTGGGGCAGG - Intronic
1113541652 13:111114639-111114661 GGGCCGGGCCGGGCCGGGCCGGG - Intronic
1113795025 13:113051818-113051840 CAGCGGGGGCAGCCCTGGGCTGG - Intronic
1113805853 13:113109770-113109792 CAGCACGGCCGCCCCGGGGCGGG + Intronic
1114485164 14:23057647-23057669 CAGCCGGGCCCGCGCGGCGGGGG + Intergenic
1116905196 14:50396973-50396995 CGGCCGGGCTGGGCCGGGCCGGG - Intronic
1117722104 14:58638148-58638170 CAGCCGGGCCGCCCAGGCGGAGG - Intronic
1119046301 14:71321033-71321055 CGGCGAGGCCGGCCCGAGGCGGG - Intronic
1119438170 14:74611521-74611543 GAGCCGGCGCGGCCCGGGTCCGG + Exonic
1119731894 14:76956483-76956505 CAGCCGGGCCAGGCAGGGGAGGG - Intergenic
1119786914 14:77320903-77320925 AGGGCCGGCCGGCCCGGGGCGGG + Exonic
1120167915 14:81220416-81220438 CGGCCGGACCGGGCGGGGGCGGG - Intronic
1121074950 14:91060292-91060314 CTGCCGGCCGGGCCCGGCGCGGG - Intronic
1122037050 14:98956481-98956503 GAGTCGGGACAGCCCGGGGCTGG + Intergenic
1122116736 14:99531362-99531384 CAGCCGGGCTGGGCTGGGGGCGG - Intronic
1122131273 14:99605368-99605390 CAGGCGGGGCGGGGCGGGGCGGG + Intergenic
1122204594 14:100142283-100142305 CAGCCTGCCTGGCCCTGGGCTGG + Intronic
1122275218 14:100587455-100587477 CAGCCGCGGCTGCGCGGGGCCGG - Intergenic
1122558231 14:102592788-102592810 GCGCGGGGCCGGCGCGGGGCCGG - Exonic
1122917326 14:104865194-104865216 CGGCCGGGCGGGGGCGGGGCGGG + Intergenic
1122922601 14:104886155-104886177 GAGTCGGGCCAGGCCGGGGCGGG + Intronic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1122953495 14:105059135-105059157 CAGCCGGGCCGGCCCTGCCCTGG - Intronic
1123030613 14:105449519-105449541 CAGCCGGGCCGGCCGGGCGCAGG - Intronic
1123043193 14:105498977-105498999 CAGCCAGGCTGGGCCAGGGCAGG - Exonic
1124652357 15:31483419-31483441 CGGCCGTGGCGGCCCGGGGCCGG - Exonic
1124952654 15:34337879-34337901 CACCCCGTCGGGCCCGGGGCTGG - Intronic
1125403866 15:39332884-39332906 CAGCTGGGCCAGCCGTGGGCAGG - Intergenic
1125557045 15:40594533-40594555 CAGTGTGCCCGGCCCGGGGCAGG - Intronic
1125833530 15:42732223-42732245 CAGCCTGGCAGGTCCTGGGCTGG - Intronic
1125937514 15:43649312-43649334 GGGCCGGGCTGGGCCGGGGCCGG + Intronic
1126392784 15:48177879-48177901 CAGGCGGCCAGGCCTGGGGCGGG + Intronic
1127293665 15:57591858-57591880 GGGCCGGGCCGGGCCGGGGCGGG - Intergenic
1129461416 15:75701828-75701850 CAGTCGGGCCTTCACGGGGCTGG - Intronic
1129661269 15:77554368-77554390 CAGCAGGGCGGGCCAGGGCCAGG - Intergenic
1129723417 15:77889979-77890001 CAGTCGGGCCTTCACGGGGCTGG + Intergenic
1129780133 15:78264584-78264606 AAGTCGGTCCGGCGCGGGGCGGG + Intronic
1130086025 15:80779189-80779211 TGCCCGGGCCGGACCGGGGCGGG - Intergenic
1130347961 15:83066699-83066721 GGGCCGGGCCGGGCCGGGCCGGG - Intronic
1130347964 15:83066704-83066726 GGGCCGGGCCGGGCCGGGCCGGG - Intronic
1130347967 15:83066709-83066731 GGGCCGGGCCGGGCCGGGCCGGG - Intronic
1130347970 15:83066714-83066736 GGGCCGGGCCGGGCCGGGCCGGG - Intronic
1130648397 15:85748209-85748231 CAGCCAGGCAGGCCCTGGGAGGG + Intronic
1130651621 15:85765147-85765169 CAGCCCGGCTGGCCTGGGGTGGG + Intronic
1131094991 15:89649168-89649190 CAGCTGGCCCGGGGCGGGGCGGG + Exonic
1131144284 15:90001553-90001575 GGGCCGGGCCGGGCCGGGCCGGG - Exonic
1131238470 15:90717493-90717515 CTGGCGGCCCGGCCCGGAGCTGG + Intronic
1131263503 15:90902585-90902607 CAGCCGCACCAGCCCGGGCCGGG - Intronic
1132079287 15:98851241-98851263 CAGGCGGGCAGGGCCGGGGTGGG + Intronic
1132099874 15:99015433-99015455 CAGCCGAGGCGTCCCGGCGCAGG - Intergenic
1132480675 16:164893-164915 GGGGCGGGCCGGGCCGGGGCGGG + Intronic
1132570573 16:642266-642288 AAGCCGGGCCGGGCCGGGCCGGG - Intronic
1132591138 16:726983-727005 GATCCGGGCCGGGCGGGGGCGGG + Intronic
1132606350 16:795386-795408 CAGGGGGGCGGGCACGGGGCCGG - Intronic
1132606425 16:795570-795592 CAGGGGGGCGGGCACGGGGCCGG - Intronic
1132618838 16:854980-855002 CAGAGGGACCGGCCCGGGGAAGG + Intronic
1132683458 16:1153034-1153056 CAGCGTGGCCGGGGCGGGGCCGG - Intergenic
1132724657 16:1333571-1333593 GGGCCGGGCCTGACCGGGGCGGG - Intergenic
1132744582 16:1431397-1431419 CAGCTGGGCAGGCCAGGGTCGGG + Intergenic
1132885450 16:2180248-2180270 CACCCGGCCCGGCTCTGGGCTGG + Exonic
1132987819 16:2777192-2777214 CGGCCGGGCCGGGCCGGGGGCGG - Intronic
1133042059 16:3066067-3066089 CAGCCCGGAAAGCCCGGGGCAGG + Intronic
1133099692 16:3471643-3471665 CAGCCGGTACAGCCCGGGTCTGG - Intronic
1133103187 16:3491419-3491441 CAGCCGGTGCAGCCCGGGTCAGG - Intergenic
1133156393 16:3879952-3879974 CGGCCGGGCCGGCGAGGGCCCGG + Exonic
1133338592 16:5022324-5022346 CTGACGGGCTGACCCGGGGCAGG + Intergenic
1134441546 16:14302164-14302186 GGGCTGGGCCGGCCCGGGGTTGG - Intergenic
1135135828 16:19884928-19884950 GGGCGGGGCCGGCCGGGGGCGGG - Intronic
1136279499 16:29199685-29199707 CGGCGGGGCCGGGCTGGGGCAGG - Intergenic
1136356132 16:29745744-29745766 CTGCCGGGCCGGGCCGGGCCAGG + Intronic
1136544872 16:30949210-30949232 CAGCCGGGCCGGCCCAAGCCCGG - Exonic
1137267926 16:46884200-46884222 GCGCCGGGCCGGACCGGGACCGG - Intergenic
1137645056 16:50066401-50066423 CAGCCGGGCCAGCCCTGCGCAGG - Exonic
1138360755 16:56425447-56425469 CCGCCGCGCCGGGCCGGGCCGGG + Exonic
1138472054 16:57245497-57245519 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1138619158 16:58197927-58197949 CGGCCGAGCCGGCCCGGCCCTGG + Intergenic
1139545650 16:67648403-67648425 CAGCGCGGCCGGCGCGGCGCGGG - Exonic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1139593239 16:67944530-67944552 CAGCCGGCCCGGCCCAGCCCAGG - Exonic
1139983640 16:70880344-70880366 CCGCCGTGCCGGGCCGGTGCTGG + Intronic
1140480709 16:75261465-75261487 CAGTCGGGCCAGCACGGGGCAGG - Intronic
1141054561 16:80803841-80803863 AAGCCGGGCGGAGCCGGGGCGGG - Intronic
1141507125 16:84485211-84485233 CTGCAGGGCCGGCCCTGGGCTGG + Intronic
1141526449 16:84614878-84614900 CAGGCAGGCTGGCTCGGGGCAGG - Intronic
1141531320 16:84648694-84648716 AAGCCGCGCCCGGCCGGGGCGGG + Intronic
1141531394 16:84648898-84648920 GAGTCGGGACGGCCCGGGGCGGG - Intronic
1141727565 16:85799780-85799802 CCGCCAGGCCGGGCCGGGTCGGG + Exonic
1141959130 16:87392653-87392675 GAGCCGGGAGGGCCAGGGGCTGG + Intronic
1141989887 16:87603540-87603562 GGGCCGGGCCGGGCCGGGGCGGG + Intronic
1142009298 16:87705775-87705797 GAGCCGGGCAGGGCCTGGGCGGG + Intronic
1142083890 16:88165786-88165808 CGGCGGGGCCGGGCTGGGGCAGG - Intergenic
1142177224 16:88650833-88650855 CAGGCGGGCCAGGCCGGGCCGGG - Intronic
1142188545 16:88706362-88706384 CTAGCGGGCCGGCCCGGGCCAGG - Exonic
1142201873 16:88765000-88765022 CAGCCGGGTCTGCCAGGGCCAGG - Intronic
1142226754 16:88881323-88881345 CTGCGGGGCCGGGCCGCGGCGGG + Exonic
1142291789 16:89196448-89196470 CAGAGGGGCCGGCCTGGGCCTGG - Intronic
1142509798 17:386159-386181 AAGCGGGGCCGCCCCGGGTCCGG - Intronic
1142799787 17:2337836-2337858 CACCCGGGCCGAACCTGGGCCGG + Intronic
1143026267 17:3943663-3943685 CAGCCTGGCCGCCCTGGGGTCGG + Intronic
1143369011 17:6426810-6426832 CACCCTGGCCGGCACTGGGCAGG + Intronic
1143479464 17:7220151-7220173 CCGCCGGGCAGGGCCGGGCCGGG - Exonic
1143577635 17:7803913-7803935 CAGGTGGGCTGGCCCAGGGCAGG - Intronic
1143676417 17:8436150-8436172 CCGCCGGGGCGGGCCGGGCCGGG + Intronic
1144586834 17:16492221-16492243 GAGCCGGGCCGGGGCGGGGCCGG - Intergenic
1144586837 17:16492226-16492248 GGGCCGAGCCGGGCCGGGGCGGG - Intergenic
1144951741 17:18998152-18998174 CAGCCTGGCAGGCCCTGGCCTGG - Intronic
1144968075 17:19090192-19090214 CTGCAGGGCCCACCCGGGGCAGG + Intergenic
1144979842 17:19161871-19161893 CTGCAGGGCCCACCCGGGGCAGG - Intergenic
1144988380 17:19216361-19216383 CTGCAGGGCCCACCCGGGGCAGG + Intronic
1145941216 17:28744278-28744300 CAGCGGGGGCGGGGCGGGGCGGG + Intronic
1146057642 17:29589272-29589294 CAGCCAGGCCGCCGCCGGGCGGG - Intronic
1146283525 17:31559775-31559797 GAGCCGAGGCGGCCCGGGGGTGG + Intergenic
1146433620 17:32822537-32822559 CTGCCGGGGCGGCTCGGGACGGG + Intronic
1146904173 17:36607679-36607701 CAGCAGGGCTGGCTCGTGGCCGG + Exonic
1147044466 17:37743075-37743097 CGGCCAGCCCGGCGCGGGGCTGG + Intronic
1147636313 17:41966723-41966745 CACCCGGGCGGGCTGGGGGCGGG - Exonic
1147653010 17:42072678-42072700 CCGTCGGGCCGCCCGGGGGCGGG - Intergenic
1147743772 17:42683069-42683091 CTGCCGCGCGCGCCCGGGGCTGG + Intronic
1147896654 17:43755809-43755831 GAGACGGGCCGGTCCAGGGCAGG - Intronic
1147900353 17:43779362-43779384 CAGCAGGGCTGGGCTGGGGCGGG - Intergenic
1148206768 17:45784360-45784382 GAGCCGGGCCGGGCCGGGCCGGG + Intronic
1148334463 17:46832276-46832298 CAGCTCAGCCGGCCCGGGGTGGG - Intronic
1148878607 17:50707821-50707843 CAGCAGGGGCGGCCCGCGGGAGG - Exonic
1149614444 17:57987282-57987304 CAGCCGGGCCGGCCCGGGGCAGG - Intronic
1149685397 17:58531924-58531946 CAGGCGGGCGGGCGCGGGGCAGG - Intronic
1149772382 17:59331924-59331946 CGGCCGGGCCTGCGCGGGGTTGG + Intronic
1150489015 17:65561705-65561727 CGGCGGGGGCGGGCCGGGGCGGG - Intronic
1150641480 17:66952787-66952809 CAGCCGGGCAGGGCCTGGGATGG - Intergenic
1150643745 17:66965628-66965650 GGGCGGGGCCGGCCGGGGGCGGG + Intronic
1150830308 17:68512672-68512694 CCGCCGGGCCGGGGAGGGGCAGG - Intronic
1151670390 17:75568916-75568938 CAGCCGGGATGCCCAGGGGCTGG - Intronic
1151783831 17:76265630-76265652 GAGCCTGGCCGCCGCGGGGCCGG + Intronic
1151816066 17:76472040-76472062 CGGCCGGGCCCACCTGGGGCGGG + Exonic
1152049265 17:77959339-77959361 CGGCCGAGCCGAGCCGGGGCGGG + Intergenic
1152068975 17:78125894-78125916 CAGCTGGGCAGGGCCGGGCCGGG + Intronic
1152368615 17:79871406-79871428 CTGCTGGGCCAGCCCGGGGGAGG + Intergenic
1152388812 17:79991183-79991205 CAGCTGGGCTGTCCCGGGGGCGG + Intronic
1152467985 17:80476467-80476489 CAGCCGAGCCGAGCCGGGCCCGG - Exonic
1152551187 17:81031163-81031185 CAGCTGGGCCTGGCCGGGGTCGG - Intergenic
1152648561 17:81481582-81481604 GCGGCGGGCCGGCCCGGGGGAGG + Intergenic
1152744274 17:82031863-82031885 CAGCCGGGGCGGGGCGGGGGTGG + Intronic
1152924093 17:83079727-83079749 GAGCCGGGCGGGGGCGGGGCGGG - Exonic
1152924468 17:83080814-83080836 TGGCCGGGCTGGCCCGGGCCTGG + Intronic
1153265154 18:3262328-3262350 CCGCCTGGCCGCCCTGGGGCGGG - Intronic
1153550409 18:6256822-6256844 CAGCCTGGCCTGCCCACGGCGGG - Intronic
1153636561 18:7117882-7117904 AAGCCGGGGCGGGACGGGGCGGG - Intergenic
1155570326 18:27185317-27185339 CAGCCGGGCCGGACGCGGGAGGG - Exonic
1157294497 18:46433098-46433120 CACCCGGGGCAGCCTGGGGCTGG - Intronic
1157464198 18:47930524-47930546 CCGCCGGCCGGGCCCGGGCCTGG - Exonic
1157496656 18:48161692-48161714 CGCCCGGGCCGGGCCGGGCCGGG - Intronic
1160242311 18:77132640-77132662 CAGCCTGCCCGGGCCTGGGCAGG - Exonic
1160404812 18:78638133-78638155 CGCCCCGGCCGGCCTGGGGCTGG + Intergenic
1160583264 18:79899683-79899705 CTGCAGGGCCGGCTCGGGGCTGG - Exonic
1160795724 19:944572-944594 CAGTCGGGCCCTCCCAGGGCCGG - Intronic
1160813856 19:1026587-1026609 CCGCCGGGCTGGCGCGGGGTTGG - Exonic
1160913099 19:1483812-1483834 CGGCGGGGCCGGGCGGGGGCGGG - Intronic
1160930677 19:1568223-1568245 GGGCCGGGCCGGGCCGGGCCGGG + Intergenic
1160944365 19:1634389-1634411 CAGCCAGGCTGGCCCAGGGCAGG - Intronic
1161057814 19:2199488-2199510 CAGCAGGGGCGCCCCGAGGCAGG - Intronic
1161072791 19:2270867-2270889 CAACCGGGAGGGCCCGGGCCTGG + Intronic
1161257995 19:3320405-3320427 CGGCCGGGCGGGCGCGGGCCAGG - Intergenic
1161405580 19:4089592-4089614 CAGCAGGCCCAGCCCAGGGCGGG - Intergenic
1161702956 19:5805027-5805049 CGGCTCGGCCGGCGCGGGGCCGG - Intergenic
1161802655 19:6424589-6424611 CCGCCGGGCCCGCCAGGCGCGGG - Exonic
1162017213 19:7852184-7852206 CAGGCAGGCCGGGCTGGGGCGGG - Intronic
1162113353 19:8413340-8413362 CCGACGGGCCGGGCCGGGCCGGG + Intronic
1162113354 19:8413345-8413367 GGGCCGGGCCGGGCCGGGACCGG + Intronic
1162398680 19:10432108-10432130 CAGGAGGGCGGGCCCGGAGCCGG + Intronic
1162535862 19:11262510-11262532 CAGCCGGGGCGGGGCGGGGCCGG + Intergenic
1162730351 19:12715002-12715024 CAGGCGGGCAGGCAGGGGGCCGG - Intronic
1162900968 19:13795478-13795500 CTGCCGGCCCGGCGCGGGTCGGG + Exonic
1162901026 19:13795629-13795651 CATCCGGCCCGGCCGGGGCCAGG - Exonic
1163158051 19:15449694-15449716 CAGGCGGGACCCCCCGGGGCGGG - Intronic
1163365092 19:16871401-16871423 GAGCCGGGCCGGGGTGGGGCCGG + Intronic
1163636379 19:18438779-18438801 CAGGCGGGCAGGGCCGAGGCAGG + Intergenic
1163637284 19:18443189-18443211 GGGCCGGGCCGGGCCGGGGAAGG - Exonic
1163666675 19:18606849-18606871 GGGCCGGGCCGGGCCGGGGGCGG - Exonic
1163679316 19:18671522-18671544 CAGGGGCGCCGGCCCAGGGCGGG + Exonic
1163702998 19:18795831-18795853 CAGCCCGGCCCGCCCAGGGCAGG - Intergenic
1163790973 19:19305978-19306000 CAGGCGGACAGGCCTGGGGCTGG - Exonic
1163830137 19:19543677-19543699 CAGGCTGGCTGGCCTGGGGCTGG - Exonic
1164594879 19:29526246-29526268 CCGGCGGGCCGGGCAGGGGCTGG - Intergenic
1164634284 19:29781229-29781251 CAGCCAGGACGGGCTGGGGCTGG - Intergenic
1164648106 19:29873629-29873651 CGGCCGGGAGGGCGCGGGGCCGG - Intergenic
1164713431 19:30375258-30375280 CAGCCGGCCCTGCCCGCGCCCGG + Intronic
1165063766 19:33217676-33217698 CTGCCGGGCCCGCAGGGGGCTGG + Intronic
1165080232 19:33302537-33302559 AAGCTGGGCCGGCGCGGGCCGGG - Exonic
1165080753 19:33304657-33304679 CACCCGGGCCTGCCCTGTGCAGG + Intergenic
1165227477 19:34365134-34365156 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1165445763 19:35856225-35856247 CGGCGGTGCCGGGCCGGGGCAGG - Intronic
1165448226 19:35868484-35868506 AGGCGGGGCCGGCGCGGGGCGGG + Exonic
1165600985 19:37055847-37055869 CATCCGGGCAGGCCTCGGGCTGG - Intronic
1165740670 19:38203475-38203497 CGGCCAGGCAGGCCCAGGGCTGG + Intronic
1165741251 19:38206505-38206527 CAGCGGGGCAGGCCCGGGAGCGG - Exonic
1165746013 19:38229724-38229746 GAGCGGGGCGGGCCGGGGGCGGG + Intergenic
1165939146 19:39406711-39406733 CAGCCTGGCTGGCCCTGGACTGG - Intergenic
1165992846 19:39826052-39826074 CAGCCGCTGCGGCCCTGGGCAGG - Exonic
1166084722 19:40467198-40467220 GAGCCGGGCTGGGCCGGGCCGGG + Intronic
1166084727 19:40467208-40467230 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1166215333 19:41331021-41331043 CTGCCGGGGCGGGGCGGGGCGGG + Exonic
1166330686 19:42076439-42076461 CAGCCGGGCGGGGGCCGGGCTGG + Intronic
1166347792 19:42177109-42177131 CAGCCGGGCGGGCGGGCGGCGGG - Intronic
1166546866 19:43639429-43639451 CAGCGGGACCGGCCTGGGGAGGG + Intronic
1166852700 19:45768063-45768085 CAGCGCGACCGGACCGGGGCCGG - Exonic
1166918761 19:46213948-46213970 CCGTGGGGCCGTCCCGGGGCGGG - Intergenic
1166994555 19:46714071-46714093 CAGCCGGCCCTGCCCTGGGAGGG - Intronic
1167001063 19:46746094-46746116 AGGCCGGGCCGGGCCGGGCCGGG + Intronic
1167040618 19:47020828-47020850 CACCCTAGCCGGCCCGGGGCTGG - Intronic
1167072985 19:47231248-47231270 CCGCCGGGCGGGGGCGGGGCGGG - Intronic
1167134461 19:47608755-47608777 CGGCCTGGCGGGGCCGGGGCTGG + Intronic
1167299696 19:48671621-48671643 CAGCCTGGCAGGCCCTGGGGAGG + Intronic
1167357654 19:49014135-49014157 CAGCGGGGCCAGCCCAGGGCTGG - Intronic
1167454641 19:49591789-49591811 CAGCCGGGCCGGGCCGGGCCGGG + Intronic
1167454644 19:49591794-49591816 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1168401091 19:56086787-56086809 CAGACGAGCCAGCCAGGGGCTGG - Intergenic
1168642251 19:58038224-58038246 CCCCTGGCCCGGCCCGGGGCAGG - Intronic
1168645914 19:58059346-58059368 AGGCCGGGCCGGGCCGGGCCGGG + Intronic
1168654695 19:58118473-58118495 GGCCGGGGCCGGCCCGGGGCGGG + Intergenic
925059492 2:880226-880248 GAGCCGAGCCTGCCCGGGACAGG - Intergenic
925133773 2:1512525-1512547 CAGCAGGGGCGGAGCGGGGCAGG - Intronic
925299318 2:2799333-2799355 CAGCCTGGCCTGGCCGGTGCTGG - Intergenic
926101644 2:10122236-10122258 CAGCCGGGCCGCCGCCGGGCAGG - Intergenic
926122944 2:10254740-10254762 CAGCAGGCCTGGCCCAGGGCCGG + Intergenic
926162360 2:10498008-10498030 CACACGGGCCGTGCCGGGGCCGG + Intergenic
927503253 2:23596163-23596185 CGGACGGGCAGGCCGGGGGCGGG + Intronic
927679772 2:25131917-25131939 GCGCGGGGCCGGGCCGGGGCGGG + Intronic
927679775 2:25131922-25131944 GGGCCGGGCCGGGGCGGGGCGGG + Intronic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
927980344 2:27370826-27370848 GAGCCGGGCCGGGCAGGGGCGGG + Intronic
928002874 2:27539755-27539777 CAGCCGCCCCGTCCGGGGGCGGG - Intronic
928022522 2:27715770-27715792 AGGCCGGGGCGGCCCGGGGCGGG + Intergenic
929452911 2:42048423-42048445 CGGCCGGCCCGCCCCGGGCCCGG - Exonic
930044251 2:47155139-47155161 GAGCCAGGCCGGCAAGGGGCAGG + Intronic
930651798 2:53970995-53971017 CAGCAGAGCCGGTGCGGGGCGGG - Intronic
931241751 2:60460708-60460730 GAGCTGGGCCTGCCCGGGCCCGG + Exonic
931649332 2:64454275-64454297 CAGCCCCGTCGGCCCGGGTCCGG + Exonic
931671764 2:64653995-64654017 GAGGCGGGCCGGGGCGGGGCCGG - Intronic
932568545 2:72924576-72924598 CAGCAGGGCTGGGCTGGGGCGGG - Intronic
932606487 2:73169196-73169218 CAGGTGGGCCAGCCCGGGGTCGG + Intergenic
932779044 2:74548857-74548879 TGCCCGGGCCGCCCCGGGGCGGG - Intronic
932790200 2:74648338-74648360 CAGCCGCGCCGGCCTGAGGGGGG - Intronic
933885926 2:86719640-86719662 AAGCCAGGCCGCCCGGGGGCTGG - Intronic
933924254 2:87077065-87077087 AAGCCAGGCCGCCCGGGGGCTGG + Intergenic
933925941 2:87091235-87091257 CAGGTGGGCCAGCCCGGGGTCGG - Intergenic
934079196 2:88452743-88452765 CTCCTGGGCCGGCCCGGAGCGGG + Intergenic
934753096 2:96806921-96806943 CAGCCTGGCCGGGGCGGGTCAGG - Intronic
934763819 2:96869642-96869664 CAGCCCCGCAGCCCCGGGGCCGG - Intronic
935112267 2:100104622-100104644 CAGCCCGGCCGGCCCGGAGTCGG - Intronic
935595337 2:104873440-104873462 GGGTCGGGCCGGCCCAGGGCTGG - Intergenic
935746482 2:106194013-106194035 GCGCCGGCCCCGCCCGGGGCGGG + Intronic
935971589 2:108534654-108534676 GGGCCGGGCCGGGCCGGGCCTGG + Intronic
936122715 2:109760537-109760559 CAGCCCGGCCGGCCCGGAGTCGG + Intergenic
936221978 2:110610936-110610958 CAGCCCGGCCGGCCCGGAGTCGG - Intergenic
937044739 2:118845269-118845291 CACCCGGTCCGGCAGGGGGCCGG - Intronic
937276278 2:120686058-120686080 CAGCCTTGCCGGCACGGAGCAGG + Intergenic
937283505 2:120736134-120736156 CAGCCGGGGCGGGGCGGGCCAGG - Intronic
937332908 2:121043250-121043272 CAGAGGGGCCGGCCCTGGGCAGG + Intergenic
937917789 2:127107331-127107353 CAGCTGCACCGCCCCGGGGCGGG + Exonic
937974830 2:127576408-127576430 CAGCCGCGGAGGCCCGGGACAGG + Intronic
937991423 2:127664374-127664396 CAGCCGGGCCGCCATGGCGCGGG + Exonic
938796009 2:134718828-134718850 CAGCGGGGCCGGGCCGGGGGCGG + Exonic
938934508 2:136116855-136116877 CAGCCGCGGCGGCCCGGGGCTGG - Intronic
942151060 2:173076151-173076173 CCGCCGGGCGGGCCCTGGGTCGG - Intronic
942454804 2:176130336-176130358 CAGCGGCGGCGGCCCCGGGCGGG - Exonic
942799736 2:179861435-179861457 CGGCGGGGCCGGGCCGGGCCGGG - Exonic
945080771 2:206085254-206085276 CGGCCAGGCCGGGGCGGGGCGGG - Intronic
945386616 2:209209332-209209354 CAGCTGGGGCAGCCCGGGCCGGG + Intergenic
946404056 2:219483520-219483542 CCCGCGGCCCGGCCCGGGGCAGG - Exonic
946418665 2:219552878-219552900 CAGGCGGACCGGTCCGGCGCGGG + Exonic
946422025 2:219570673-219570695 CAGCCGGGCCGCGCCGAGGACGG - Exonic
947623354 2:231604676-231604698 GGGCCGGGCCGGGCTGGGGCTGG - Intergenic
947713730 2:232329872-232329894 CAGCAGGGCCTGCTCGGGGAAGG - Exonic
948005367 2:234603811-234603833 AAGCAGGGCTGGCCCAGGGCTGG + Intergenic
948115997 2:235494565-235494587 GAGCCGGGCCCGCCGGCGGCGGG - Exonic
948159375 2:235811728-235811750 GAGCTGGGCCGGGCCGGGGGCGG - Intronic
948436142 2:237955848-237955870 AAGCCGGGTCCTCCCGGGGCAGG - Intergenic
948473741 2:238203463-238203485 CCGCCGGGCCGGCCAGGGAAGGG - Intronic
948566469 2:238890320-238890342 CAGCCCGGCCTGCGCGGGGCAGG + Intronic
948603345 2:239119870-239119892 CAGCAGGGCCGGGCAGAGGCTGG + Intronic
948826358 2:240575153-240575175 CAGCAGGGCCGTCCCGGGCAGGG - Intronic
949004325 2:241636892-241636914 CCGCAGGGCCGGGTCGGGGCGGG + Intronic
1169483544 20:6006571-6006593 GCGGCGGGCCGGCCCTGGGCTGG + Intronic
1170524759 20:17226842-17226864 CGGCCGGGCCGGGCCGGGCCGGG + Intronic
1170524763 20:17226847-17226869 GGGCCGGGCCGGGCCGGGGGTGG + Intronic
1170688221 20:18588118-18588140 CAGTCGGGCGGGGCCGGGCCCGG + Intronic
1171847210 20:30284426-30284448 CATCCGGGCAGGCCTGAGGCTGG - Intergenic
1172118171 20:32583824-32583846 CCCCCGGGCCGGCCCGGTCCGGG - Intronic
1172118310 20:32584170-32584192 CCGCCCAGCCGGCCCGGGGGCGG + Intronic
1172118709 20:32585483-32585505 GGGCCGGGCCGGGCGGGGGCTGG - Intronic
1172284706 20:33732302-33732324 CAGCCTGGGCGGCCTTGGGCGGG + Intronic
1172389857 20:34559149-34559171 CAGGCGGGGCGGACCTGGGCCGG + Intronic
1172696876 20:36829013-36829035 CAGCAGGGCCAGCCTAGGGCAGG - Intronic
1172882966 20:38213551-38213573 GAGCCGGGCAGGCCTGGGCCAGG - Exonic
1173279692 20:41617897-41617919 CAGCCGCGCTGGGGCGGGGCGGG - Intronic
1173322390 20:41999416-41999438 GGGCCGGGCCGGGACGGGGCGGG + Intergenic
1174246830 20:49188087-49188109 CGGCCGGGCCGGGCCGGGCCTGG - Intronic
1174287816 20:49484380-49484402 CTGCCGGGGAGGCCGGGGGCGGG + Intergenic
1174342412 20:49906210-49906232 CAGCAGGGCCGGGCCGTTGCTGG + Exonic
1174481090 20:50832027-50832049 CAGCTGGGCCAGCCCAGGCCAGG - Intronic
1174485033 20:50855643-50855665 CAGCCTGGCCGGCCCAGGCTGGG + Intronic
1175399495 20:58692639-58692661 CGGCAGGGCCTGCTCGGGGCCGG + Exonic
1175399500 20:58692658-58692680 CGGCCGGGCAGGCCCGAAGCCGG - Exonic
1175466243 20:59192623-59192645 CAGGCGGGCTGGGCCGGGCCTGG - Exonic
1175859580 20:62143179-62143201 CGGCGGGGCCTGCGCGGGGCCGG - Intronic
1175992050 20:62794507-62794529 CCGCGGGGCGGGGCCGGGGCCGG - Intergenic
1176113478 20:63421193-63421215 CGGCAGGGCCGGCCCGGGAGGGG - Intronic
1176207235 20:63895540-63895562 GAGCCGGGCCGGGCCGGGCCGGG + Intronic
1176221142 20:63969835-63969857 CGGCCGGGCCGGGCCGGGCCGGG + Intronic
1176221146 20:63969840-63969862 GGGCCGGGCCGGGCCGGGGCGGG + Intronic
1176238105 20:64063552-64063574 CGGCAGGGCTGGCCCGGGGCAGG - Intronic
1176243002 20:64083740-64083762 CGGCCGGGGCGGGGCGGGGCGGG - Intronic
1176380721 21:6111068-6111090 GGGCCGGGGCGGGCCGGGGCGGG + Intergenic
1176382003 21:6118344-6118366 CTGCCTGGCAGGCCCGGGGCGGG - Exonic
1176418099 21:6491267-6491289 TAGACGGGTCGGCACGGGGCTGG + Intergenic
1176418924 21:6499024-6499046 CAGGCGGGCCGGCGCGGCGGTGG - Intergenic
1176419040 21:6499447-6499469 CAGCAGGGCCAGCGCCGGGCGGG - Intergenic
1176656479 21:9592602-9592624 CATCCGGGCAGGCCTGAGGCTGG + Intergenic
1178992770 21:37368099-37368121 CGGCGGGGCCGGGCCGGGCCGGG + Intronic
1179511956 21:41879199-41879221 CAGCGGGTGCGGCCCGGGGCCGG + Intronic
1179675040 21:42975109-42975131 CGGCGGGGCGGGGCCGGGGCGGG + Intronic
1179678806 21:43003254-43003276 CAGCCGGGCTGGACCACGGCCGG - Intronic
1179693593 21:43099597-43099619 TAGACGGGTCGGCACGGGGCTGG + Intronic
1179694417 21:43107346-43107368 CAGGCGGGCCGGCGCGGCGGTGG - Intronic
1179694533 21:43107769-43107791 CAGCAGGGCCAGCGCCGGGCGGG - Intergenic
1179741469 21:43419895-43419917 CTGCCTGGCAGGCCCGGGGCGGG + Exonic
1179742751 21:43427172-43427194 GGGCCGGGGCGGGCCGGGGCGGG - Intergenic
1179891671 21:44338764-44338786 GAGCCGGGGCGGGGCGGGGCGGG - Intronic
1180098710 21:45574385-45574407 GAGCCGGGCCGGGGTGGGGCAGG - Intergenic
1180162078 21:46002611-46002633 AGGCCGGGCCGGCCCTGGGATGG - Exonic
1180304000 22:11058381-11058403 CAGCGGCGACTGCCCGGGGCTGG - Intergenic
1180699690 22:17774513-17774535 GGGCCGGGGCGGGCCGGGGCGGG - Intronic
1180841002 22:18958815-18958837 CAGCATGGACGGCCCAGGGCTGG + Intergenic
1180843669 22:18970516-18970538 CTGCCGGGCCGGGGCTGGGCCGG + Intergenic
1181060492 22:20279978-20280000 CAGCATGGACGGCCCAGGGCTGG - Intronic
1181082928 22:20426065-20426087 AGGCCCGGCCGGCCCGGGCCCGG - Exonic
1181085492 22:20437710-20437732 GGGCCGGGCCGGCGCGGCGCCGG - Exonic
1181499325 22:23306843-23306865 CAGCCGGGCGGGCCGGAGCCGGG + Intronic
1181979627 22:26756907-26756929 CAGCCGCGCGGGCGCGGGCCAGG - Intergenic
1182294938 22:29307085-29307107 GAGCCGGGCCGGGCCGCCGCAGG - Exonic
1182423149 22:30258097-30258119 GAGCCGGGCCGGCCTTGGGAGGG + Intergenic
1183437614 22:37804722-37804744 CAGCCGGGCCGAGCCGGGACAGG - Intergenic
1183439624 22:37815845-37815867 CAGCAGGGCAGGCTCGGGGGCGG + Intronic
1183650824 22:39152454-39152476 CGGGCGAGCGGGCCCGGGGCCGG + Exonic
1183650834 22:39152470-39152492 GGGCCGGGCCGGGCCGGGGGCGG + Exonic
1184164820 22:42720896-42720918 CCGCCCCTCCGGCCCGGGGCGGG + Intronic
1184184697 22:42856956-42856978 CAGCCTGGCCGGGCCGGGGCGGG - Intronic
1184229571 22:43151469-43151491 CAGGCGGGGCGGGGCGGGGCCGG + Intergenic
1184372473 22:44091225-44091247 CAGCCAGGCTGGCTCGCGGCTGG + Intronic
1184439087 22:44497929-44497951 CCCCCGGGCGGGCGCGGGGCGGG - Intronic
1184461274 22:44639551-44639573 CAGCTGGGACAGCCCGGGGAAGG + Intergenic
1184557440 22:45240932-45240954 GGGCCGGGCCGGGCCGGGGCGGG - Intergenic
1184557450 22:45240948-45240970 GGGCGGGGCCGGACCGGGGCCGG - Intergenic
1184640056 22:45865921-45865943 CAGCCGAGCCGGGCCAGGCCGGG - Intergenic
1184679168 22:46061321-46061343 CGGCCGGGCGGGCCCGGGAGAGG - Intronic
1184679324 22:46061803-46061825 CAGAGGGTCCGGGCCGGGGCCGG - Intronic
1184739289 22:46417863-46417885 CAGCTGGGCGGGCCCAAGGCCGG + Intronic
1184759715 22:46537514-46537536 AAGCGGGGCGGGCCCGGCGCGGG + Intergenic
1184836149 22:47022312-47022334 CAGCCGGGCCATCCCTGGGAGGG + Intronic
1185037905 22:48489382-48489404 CTGGCGGGCCGGCGCGGGGTCGG + Intergenic
1185270532 22:49927644-49927666 CAGCAGGTCCGGTCCTGGGCTGG + Intergenic
1185310654 22:50152548-50152570 CAGCCAGGCCCGCCCAGGGCTGG + Intronic
1185313622 22:50169869-50169891 CAGCGGGGCGCGGCCGGGGCAGG + Intergenic
1185338879 22:50282927-50282949 CAGCCTGGTCGGGCTGGGGCTGG - Intronic
950153823 3:10707980-10708002 CAGCGGGGCCGGGCCGGGCCGGG - Intronic
950365425 3:12480242-12480264 GAGCTGGGCCTGGCCGGGGCAGG - Intergenic
950650219 3:14402551-14402573 CAGCTCGGCCGGGCCGGGGGCGG - Intergenic
950683678 3:14602270-14602292 CAGCCCGGGCGGCCCCGCGCAGG + Intergenic
951803587 3:26623209-26623231 CAGCCACCCCGGCCCGGGACTGG + Exonic
952970827 3:38649395-38649417 CGGCTGGGCGGACCCGGGGCAGG + Intronic
953925349 3:46979836-46979858 CAGCAGGGCCGGAGCCGGGCCGG + Exonic
953989946 3:47476083-47476105 CGGCCGGGCCGGGCCGGGCCGGG + Exonic
954121819 3:48504186-48504208 CAGCCGGGCCGGGGCGGGGCGGG - Exonic
954632824 3:52056370-52056392 GAGCGCGGGCGGCCCGGGGCCGG + Exonic
955916370 3:63912254-63912276 GAGCCGGGCCGCTCCGGCGCTGG + Intronic
957900909 3:86488729-86488751 CACCAGGGCCGGACAGGGGCTGG - Intergenic
959054224 3:101551935-101551957 CAGCCGGGGCGGCCGGGCACAGG - Intergenic
961236896 3:125375069-125375091 CGGCCTGGCAGGCCCGGGCCCGG - Intronic
961665862 3:128492834-128492856 CAGGCGGGCCGGGCCGGGGGCGG + Intronic
961754858 3:129121679-129121701 GGGCCGAGCCGGGCCGGGGCGGG - Exonic
962575398 3:136751758-136751780 CAGCGGGGCCGGGCCGACGCGGG - Intronic
963081842 3:141402236-141402258 CAGCCCCGCGGGCCCGGGGCTGG - Intronic
963133093 3:141876474-141876496 CTGCGGGGCGGGGCCGGGGCGGG + Intronic
963814287 3:149812770-149812792 CTGCCGGGCTGCCCCCGGGCGGG - Exonic
964437911 3:156674071-156674093 CAGCCTGTCCGGCTCGGGGCAGG + Intronic
964482801 3:157159637-157159659 CGGCCGGGGCGTGCCGGGGCGGG - Intronic
964482845 3:157159760-157159782 GCGCCCGGCCGGCCCGGGGCCGG + Intronic
964720418 3:159763957-159763979 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
964720422 3:159763962-159763984 GGGCCGGGCCGGGCCGGGGCGGG + Intronic
964801607 3:160564955-160564977 CGGCGGAGCCGGCCCGGCGCGGG - Intronic
966874560 3:184314843-184314865 CAGCCAGGCCCGGCCGGGCCAGG - Intronic
966911402 3:184562191-184562213 GAGCCGGGCCGCGCCGGGCCGGG - Exonic
967316215 3:188154107-188154129 GGGCCGGGCCTGTCCGGGGCTGG + Intronic
967924245 3:194633569-194633591 CATCCTGGCCGGAGCGGGGCGGG + Intronic
968133868 3:196208184-196208206 CCACCGCGCCGGCCCGGGGGAGG + Intronic
968519645 4:1029695-1029717 CAGGAGGGCCGGGCGGGGGCGGG - Intergenic
968541651 4:1171236-1171258 GCGCGGGGCCGGCCGGGGGCGGG - Intronic
968659487 4:1793222-1793244 GAGCGGGGCGGGGCCGGGGCGGG + Intergenic
968850588 4:3075041-3075063 CAGCCGGGCCGGGTGGCGGCGGG - Exonic
968908247 4:3464204-3464226 GAGCCGGCCAGGCCCGGGTCTGG + Intronic
969116090 4:4871656-4871678 CGGCTGTGCCAGCCCGGGGCGGG + Intergenic
969116092 4:4871664-4871686 CAGCTGGCCCCGCCCCGGGCTGG - Intergenic
969226078 4:5799167-5799189 CAGCAGAGGCGGCCAGGGGCAGG - Intronic
969360111 4:6658024-6658046 GTGCCCGGCTGGCCCGGGGCGGG + Intergenic
969638221 4:8381789-8381811 CAGCCAGGGGGGCCCTGGGCAGG - Intronic
969710415 4:8840173-8840195 GAGTCGAGCCTGCCCGGGGCGGG + Intergenic
969732534 4:8965111-8965133 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
969792113 4:9499194-9499216 CACCCCAGCAGGCCCGGGGCTGG + Intergenic
970651110 4:18179080-18179102 CACCGGGGCCTGTCCGGGGCTGG + Intergenic
971351912 4:25862915-25862937 CGGCCGGCCCGGCCGGGGGCGGG - Exonic
971372418 4:26029307-26029329 CAGCAGGGCCAGCCTGGGGAGGG - Intergenic
974988333 4:69056976-69056998 AAGCCAGGCAGGCCCAGGGCTGG - Intronic
976092419 4:81471968-81471990 CTGCCGGGGCGGGGCGGGGCTGG - Intronic
976765524 4:88593316-88593338 GAGCTGGGACGGCCGGGGGCAGG + Intronic
977231010 4:94451798-94451820 CAGCCGCGCCGCGCAGGGGCGGG - Intergenic
979523797 4:121697008-121697030 AAGCCGGGCAGGGCCGGGGTGGG - Exonic
983176699 4:164596710-164596732 CAACCAGACCGGCCCGGCGCGGG - Intergenic
985014899 4:185623705-185623727 CAGCCTCGCCGGCCCCGAGCGGG + Exonic
985062418 4:186092489-186092511 CAGCCGGGCACCCACGGGGCGGG - Intergenic
985064149 4:186104996-186105018 CGGCCGAGGCGGCCCGGGCCGGG - Intronic
987258296 5:16179589-16179611 CAGCCGGGCCGGCAGGAGGGCGG - Exonic
988577797 5:32444089-32444111 CCGCCGGGCTGGGCCGGGCCAGG + Intronic
992086371 5:73281504-73281526 CTGCCCTGCCGGCCAGGGGCTGG - Intergenic
992473187 5:77077512-77077534 CAGCGGGGCCGGGCGGCGGCGGG + Exonic
997201289 5:132011568-132011590 AGGCCGGGCCGGGCCGGGCCGGG - Exonic
997469193 5:134107340-134107362 CAGCCCGGCCGGGCCATGGCTGG + Intergenic
997568111 5:134905018-134905040 CTGCGGGGCTGGCCCGGAGCGGG - Intronic
997965495 5:138352933-138352955 CTGGCGGGCCGGCACGGTGCGGG + Exonic
998166793 5:139848731-139848753 AGGCCGGGCCGGCGCGGGGGAGG + Intronic
998208436 5:140175702-140175724 GAGCTGGGCCAGCCGGGGGCAGG + Intronic
998295627 5:140966723-140966745 CAGCCGGGCAGGGCCGGAGGCGG - Exonic
998339904 5:141408226-141408248 GCGCCGGGCCGGCCCGCGGCAGG + Exonic
998340989 5:141417883-141417905 GCGCCGGGCCGGCCCGCGGCAGG + Exonic
998367457 5:141640307-141640329 CAGCCGGGACTGCACTGGGCTGG + Exonic
998406417 5:141876968-141876990 CAGCCGGTTCGGCCCGGGAGTGG + Intronic
998415298 5:141941592-141941614 CAGCAGGGCCAGCCTGGGTCAGG + Exonic
998463272 5:142324649-142324671 CGGCCCGGCCGGCACGGCGCCGG - Intronic
998836064 5:146203831-146203853 GAGCCGGGCTGGGCCGGGGCCGG + Intronic
999113669 5:149142634-149142656 CAGCCCGGTGGGCCCAGGGCTGG + Intronic
999246543 5:150158005-150158027 CAGCCAGGCCAGCCTGGGGGAGG + Intergenic
999727220 5:154446579-154446601 CAGAGGGACCGGCCCGGGGCGGG + Exonic
1001395780 5:171419111-171419133 CAGTGGAGCCGCCCCGGGGCTGG + Intergenic
1001617750 5:173056588-173056610 GGGCCGGGCCGGCGCGGGGCGGG + Intronic
1002027025 5:176402628-176402650 CAGCCAGGCCCTCCCGGTGCTGG - Intronic
1002091857 5:176810715-176810737 CAGGCGGGCGGGCCGGGCGCGGG - Exonic
1002170326 5:177371060-177371082 GGGCGGGGCCGGGCCGGGGCCGG + Intronic
1002187215 5:177459934-177459956 CAGCAGGGACGGCCTGTGGCGGG + Intronic
1002497052 5:179622924-179622946 GGGCCGGGCCGGGCCGGGCCGGG - Intronic
1002497067 5:179622954-179622976 CGGCCGGGCTGGGGCGGGGCGGG - Intronic
1002524313 5:179806883-179806905 CGGCAGGGCCGGGCCGGGCCGGG + Intronic
1002535370 5:179872859-179872881 CAGCAGGGCTGGGCAGGGGCTGG - Intronic
1002941301 6:1718572-1718594 CTGCCGGGACAGCCCGGGGTGGG - Intronic
1002961093 6:1915436-1915458 CAGCAGGGGCAGCCCAGGGCCGG + Intronic
1006083592 6:31581252-31581274 GAGCCGAGCCGGGCCGGGGGAGG + Intronic
1006369229 6:33633844-33633866 GGGCCGGGCCGGGCCGGGGCGGG + Intronic
1006637201 6:35469148-35469170 CAGCCGCGCCTGCCCGGAGCAGG - Intronic
1006837989 6:37010815-37010837 CATCTGGGCCGGCCCTGGGGTGG - Intronic
1007589820 6:43014326-43014348 CTGCCAGGCCGAGCCGGGGCGGG - Exonic
1007633491 6:43285223-43285245 CCGGCGGGACGCCCCGGGGCGGG - Exonic
1007702032 6:43771213-43771235 GAGCCGCGCCGGCCCCGGTCGGG + Exonic
1007967501 6:46015913-46015935 CAGCCGGGCGGGGACGCGGCGGG + Intronic
1008760473 6:54846928-54846950 CCGCCGCGCCGGCCAGGGGCGGG - Intronic
1011640374 6:89412002-89412024 CCGGCCGGCCGGCCCGGGGACGG + Exonic
1013292726 6:108732766-108732788 CATCTGGGCGGGCCTGGGGCTGG + Intergenic
1013512547 6:110858174-110858196 CGGCCTGGCAGGCGCGGGGCTGG - Intronic
1015904985 6:138107539-138107561 CTGCCCTGCCGGGCCGGGGCGGG + Intergenic
1017672538 6:156779678-156779700 TCGCCGGGCCGGGCCGGGCCGGG + Intronic
1018393028 6:163355157-163355179 CAGCCTGGCCGGCCCCTGGCAGG + Intergenic
1018876598 6:167827091-167827113 CAGCCGCGCGGGGCCGGGGCCGG - Exonic
1018947388 6:168357015-168357037 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947404 6:168357070-168357092 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947420 6:168357125-168357147 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947438 6:168357180-168357202 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947455 6:168357235-168357257 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947520 6:168357455-168357477 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947652 6:168357894-168357916 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947669 6:168357949-168357971 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947689 6:168358004-168358026 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947707 6:168358059-168358081 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947727 6:168358114-168358136 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947843 6:168358498-168358520 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947858 6:168358553-168358575 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947878 6:168358608-168358630 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947896 6:168358663-168358685 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947916 6:168358718-168358740 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1019279606 7:193174-193196 CGCGCGGGCCGGCCCGGGCCTGG - Exonic
1019373541 7:676587-676609 CAGCCGGGCCTTCCCAGAGCAGG + Intronic
1019461332 7:1160433-1160455 CAGCCGGGCGGGCGAGGAGCGGG + Intronic
1019496969 7:1345323-1345345 CAGCCTGGCGGGCCAGGGCCGGG + Intergenic
1019509874 7:1412492-1412514 CAGCCAGGCAGGCCCGAGGCAGG - Intergenic
1019562599 7:1665973-1665995 CAGCCGGGCGGGCTCCGGGAGGG + Intergenic
1019731523 7:2631999-2632021 CAGCCGAGCCGGGCCGAGCCGGG + Exonic
1019731526 7:2632004-2632026 GAGCCGGGCCGAGCCGGGCCGGG + Exonic
1019826114 7:3285744-3285766 CAGCCAGGCCGGCTCAGTGCTGG + Intergenic
1020106132 7:5423198-5423220 CAGGAGGGCCGGAGCGGGGCTGG + Intronic
1020109354 7:5439576-5439598 CAGCCAGGCGGGGGCGGGGCAGG - Intronic
1020125559 7:5530920-5530942 GAGACGGGCAGGCCGGGGGCAGG - Intronic
1020252976 7:6484084-6484106 CAGCGCGGCGGCCCCGGGGCTGG + Exonic
1020262136 7:6536507-6536529 CAGGCGGGCTGGCCCGGGAGGGG + Intronic
1020308751 7:6854334-6854356 CACCCCAGCAGGCCCGGGGCCGG - Intergenic
1021668623 7:23013521-23013543 CTGCCGGGTGGGCCTGGGGCGGG - Intronic
1022088138 7:27088404-27088426 CAGCCTAGCCGGCCGGGGGCAGG + Intergenic
1022375384 7:29806909-29806931 CGGCCGGGCCGGGCCGGGCCGGG + Intronic
1022410337 7:30135011-30135033 CAGCCGGCCCAGCCCGGCCCCGG + Exonic
1022427890 7:30285329-30285351 GCGCGGGCCCGGCCCGGGGCAGG + Exonic
1023881806 7:44325168-44325190 CAGGCAGCCAGGCCCGGGGCCGG + Intronic
1024472205 7:49775588-49775610 CTCTCGGGACGGCCCGGGGCGGG + Exonic
1024639381 7:51316931-51316953 CAGGCGGGGCGGGGCGGGGCGGG - Intergenic
1024919743 7:54544837-54544859 CAGGGTGTCCGGCCCGGGGCTGG + Intronic
1025697880 7:63789610-63789632 CAGGCGGGCCAGCGCGGGGAGGG - Intergenic
1026470913 7:70693924-70693946 CCGCTGGGCCGACCCGGCGCCGG + Intronic
1026805015 7:73424066-73424088 CTCCCGGCCCGGCCCGGGGCTGG + Intergenic
1026909451 7:74083865-74083887 GGGCCGGGCCGGGCCGGGCCGGG - Intronic
1026923729 7:74174525-74174547 CAGCCGGGGCGGCGGGAGGCGGG + Intronic
1029238739 7:99143830-99143852 CGGCGGGGCCGGGCCGGGCCGGG - Exonic
1029496026 7:100895808-100895830 CGGCCGAGCCGGGCCGGGCCGGG + Exonic
1030121161 7:106112107-106112129 CAGGCGGGCCTGGCCGGCGCGGG + Intronic
1030470668 7:109959011-109959033 CAGCGGGGCCTGTCAGGGGCTGG + Intergenic
1031253104 7:119413436-119413458 CAGCGGGGTGGGCCCGGGGGAGG + Intergenic
1032020714 7:128405976-128405998 GGGCCGGGCGGGCCGGGGGCGGG + Intronic
1032391290 7:131556722-131556744 CGGCCGGGCCGGGCGGGGCCGGG + Intronic
1032391293 7:131556727-131556749 GGGCCGGGCGGGGCCGGGGCCGG + Intronic
1033589426 7:142797355-142797377 CACCCGGTCCGGCCCTGTGCTGG + Intergenic
1033662053 7:143408873-143408895 CGGGCGGGCCGGGCGGGGGCGGG + Exonic
1034256246 7:149726063-149726085 GAGCTGGGCCAGCCCGAGGCTGG + Intronic
1034273959 7:149816036-149816058 CTGGCGGGCAGGCCCTGGGCAGG - Intergenic
1034412302 7:150947824-150947846 GGGCCGGGCCGGGCGGGGGCAGG - Exonic
1034418641 7:150977947-150977969 GGGCCGGGCCGGGCCGGGGTGGG - Exonic
1034446106 7:151115081-151115103 GCGCCGGGTCGGCGCGGGGCTGG - Intronic
1035167411 7:156999980-157000002 CCGGGGGGCGGGCCCGGGGCCGG + Intronic
1035182144 7:157097292-157097314 CAGACGGGCTGGCCAGGGGCTGG - Intergenic
1035515912 8:232294-232316 AGGCGGGGCCGGGCCGGGGCGGG - Intronic
1035747574 8:1973562-1973584 CCGGCGGGCAGGCGCGGGGCAGG + Intergenic
1037581251 8:20247157-20247179 CATCTGGGCCGGCCTGGGACAGG + Exonic
1037589958 8:20303974-20303996 GAGCCGGGGCGGGGCGGGGCGGG + Intergenic
1037589975 8:20304005-20304027 GGGCGGGGCCGGCCCGGGGCGGG + Intergenic
1037855283 8:22367204-22367226 GAGCGGGGCGGGCCGGGGGCGGG + Intergenic
1037890723 8:22622558-22622580 CAGCCGGGCGGGCGAGGGGGAGG + Intronic
1039880454 8:41622233-41622255 CAGAGGGGCCGGGGCGGGGCAGG + Exonic
1040423436 8:47261044-47261066 GCGGCGGGCCGGCGCGGGGCTGG + Intronic
1042271579 8:66961657-66961679 CGGGCGGACCGGGCCGGGGCCGG - Exonic
1042611626 8:70607684-70607706 CTGCCGAGCTGGCTCGGGGCGGG - Intronic
1045098933 8:98825865-98825887 CGGCCGGCGCGGCCGGGGGCGGG - Intronic
1045108842 8:98920441-98920463 CAGCCGGACGGGCCAGGTGCAGG - Intronic
1045510800 8:102810722-102810744 CAGCCGCGCCGACCCCGCGCTGG + Intergenic
1049019085 8:139941496-139941518 CAGGAGGGCAGGCCAGGGGCTGG + Intronic
1049149355 8:141024351-141024373 GAGCAGGGCTGGCCCAGGGCTGG + Intergenic
1049166397 8:141128611-141128633 CAGCCGCGCCGCCTGGGGGCCGG - Exonic
1049194528 8:141308132-141308154 CGGCCGGGCCGGGCCGGGCAGGG + Intronic
1049351209 8:142165748-142165770 CGGCAGGGCCAGCCTGGGGCTGG - Intergenic
1049409123 8:142464666-142464688 CCGGCGGCCCGGCCCGGGGCCGG - Exonic
1049474538 8:142790611-142790633 GGGCCGGGCCGGGCCGGGCCAGG + Intergenic
1049509002 8:143018477-143018499 CAGCCGCGCGGCCCCGGGGCGGG - Intronic
1049585065 8:143429226-143429248 CAGCACGGCCGGGCCGGGCCTGG + Exonic
1049602813 8:143515764-143515786 CAGCTGGGCCAGGCAGGGGCTGG + Intronic
1053072897 9:35111511-35111533 GAGCCGGGGCGGCCCCGGGGAGG - Exonic
1053142279 9:35689610-35689632 TTGGCGGGCAGGCCCGGGGCTGG + Intronic
1053169007 9:35865083-35865105 CAGCAGGGCCCTCCTGGGGCAGG - Intergenic
1053885008 9:42637170-42637192 CAGCGGCGCCTGCCCTGGGCTGG - Intergenic
1054173177 9:61858182-61858204 CATCCGGGCAGGCCTGAGGCTGG - Intergenic
1054224029 9:62444621-62444643 CAGCGGCGCCTGCCCTGGGCTGG - Intergenic
1054664365 9:67722599-67722621 CATCCGGGCAGGCCTGAGGCTGG + Intergenic
1056992420 9:91423951-91423973 CGGCAGGGGCGGGCCGGGGCGGG + Intergenic
1056992591 9:91424563-91424585 GAGCCGCGACGGCCCGGAGCCGG + Intergenic
1057026408 9:91737060-91737082 CAGTGTGGCAGGCCCGGGGCAGG + Intronic
1057199888 9:93134302-93134324 CCGCCGGGCGGGCCGGGGGCGGG - Intergenic
1057259836 9:93577171-93577193 CAGGCGGCCCGGCCCGGGCCTGG - Intronic
1057352899 9:94315536-94315558 CAGTTGGGGCGGCCCCGGGCAGG - Intergenic
1057596571 9:96419341-96419363 CAGCCAGGCGGGGCTGGGGCGGG - Intergenic
1057654848 9:96942055-96942077 CAGTTGGGGCGGCCCCGGGCAGG + Intronic
1058053354 9:100427422-100427444 CAGCCGGGCGGGGGCGGGGGTGG + Intronic
1058424193 9:104862630-104862652 CTGCCGGGCCGGGCCGGGCCGGG + Intronic
1058424196 9:104862635-104862657 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1058424199 9:104862640-104862662 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1058424202 9:104862645-104862667 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1058424205 9:104862650-104862672 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1058424208 9:104862655-104862677 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1058424211 9:104862660-104862682 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1058424214 9:104862665-104862687 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1058424217 9:104862670-104862692 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1058424220 9:104862675-104862697 GGGCCGGGCCGGGCCGGGCCGGG + Intronic
1058486636 9:105448271-105448293 AAGCCGGGCCGGCACAGGGTGGG + Intronic
1058723976 9:107784587-107784609 CAGCAGGGCTGGCCCTGGTCAGG + Intergenic
1059208260 9:112486796-112486818 CGGGCGGGCCGGGGCGGGGCCGG - Intronic
1059208451 9:112487384-112487406 GCGGCGGGGCGGCCCGGGGCAGG - Intronic
1059375199 9:113876088-113876110 CGGCGAGGCCGGCCCGGGGGCGG + Intergenic
1060139835 9:121201061-121201083 CAGCCGGGCCGGGCCGGGGCCGG - Intronic
1060478029 9:123999941-123999963 CTGCGGGGCCGGCCCGGAGCCGG - Intergenic
1060596821 9:124853503-124853525 CCGCCGGGGCGGGGCGGGGCCGG + Exonic
1060855872 9:126914863-126914885 ACGCCGAGCCGGGCCGGGGCCGG - Exonic
1061204508 9:129155241-129155263 CTGCCTGTCCTGCCCGGGGCTGG - Intergenic
1061208671 9:129178365-129178387 CAGCCGAGTAGCCCCGGGGCGGG - Intergenic
1061289467 9:129642367-129642389 GAGCCGGGCCGGGCCCTGGCAGG - Intergenic
1061489816 9:130938729-130938751 CTCCCGGGCCGCCCCGGCGCGGG - Exonic
1061587706 9:131579345-131579367 CAGCGGGGCCGGGCGGGAGCTGG - Exonic
1061749862 9:132770257-132770279 CAGCCCCGCCAGCCCGGGCCCGG + Intronic
1061839226 9:133347954-133347976 CCGCCGGGTCGGCCTAGGGCGGG + Intronic
1061859363 9:133460246-133460268 CCGCCGGGGCGGGGCGGGGCAGG - Intronic
1061882264 9:133574311-133574333 CAGCTGGAGCGGCCAGGGGCTGG + Intronic
1061945642 9:133907028-133907050 CAGCCTGGCTGGCCGGCGGCGGG + Intronic
1061961923 9:133992842-133992864 CGGCCGGGCGGGGCAGGGGCGGG + Intergenic
1062022612 9:134326547-134326569 CGGCGCGGCCGGCCCGGGCCCGG - Intronic
1062070645 9:134553438-134553460 CAGCCGGGCCGCGCCAGGCCTGG - Intergenic
1062136487 9:134931172-134931194 CACCCCGCCCGGCCCGGTGCTGG + Intergenic
1062398867 9:136363737-136363759 CGGCGGGGCGGGGCCGGGGCAGG - Exonic
1062410572 9:136422116-136422138 CAGCAGGGGCGGCCAAGGGCAGG + Intronic
1062499373 9:136845706-136845728 CAGCCGGGGCGGACTGGTGCCGG - Exonic
1062584199 9:137241628-137241650 CTGCCGCGCCCGTCCGGGGCGGG + Intronic
1062653518 9:137590380-137590402 CAGCCAGGCGGGCTCCGGGCGGG + Exonic
1203634194 Un_KI270750v1:96084-96106 CATCCGGGCAGGCCTGAGGCTGG + Intergenic
1185469412 X:373709-373731 GGGCAGGGCCGGGCCGGGGCCGG + Intronic
1187507270 X:19887760-19887782 CCGCCGGGCGGGGGCGGGGCCGG + Intergenic
1189659343 X:43279769-43279791 GGGCCGGGCGGGCCGGGGGCGGG + Intergenic
1190337268 X:49270035-49270057 CCGTGGGGCGGGCCCGGGGCGGG + Exonic
1195923258 X:110002892-110002914 AGGCCGGGCCAGCCGGGGGCTGG - Intronic
1196442224 X:115727973-115727995 TGGCCGGGCCGGGCCGGGCCTGG + Intergenic
1196443333 X:115732931-115732953 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196443335 X:115732936-115732958 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196443338 X:115732941-115732963 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196444184 X:115736996-115737018 TGGCCGGGCCGGGCCGGGCCGGG + Intergenic
1196444187 X:115737001-115737023 GGGCCGGGCCGGGCCGGGCCGGG + Intergenic
1196444189 X:115737006-115737028 GGGCCGGGCCGGGCCGGGCCTGG + Intergenic
1196445654 X:115844846-115844868 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196445656 X:115844851-115844873 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196445659 X:115844856-115844878 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196446325 X:115847827-115847849 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196446327 X:115847832-115847854 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196446330 X:115847837-115847859 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196446996 X:115850808-115850830 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196446998 X:115850813-115850835 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196447001 X:115850818-115850840 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196447665 X:115853791-115853813 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196447667 X:115853796-115853818 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196447670 X:115853801-115853823 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196448335 X:115856770-115856792 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196448337 X:115856775-115856797 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196448340 X:115856780-115856802 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196449004 X:115859761-115859783 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196449006 X:115859766-115859788 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196449009 X:115859771-115859793 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196449675 X:115862752-115862774 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196449677 X:115862757-115862779 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196449680 X:115862762-115862784 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196450344 X:115865735-115865757 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196450346 X:115865740-115865762 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196450349 X:115865745-115865767 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196451014 X:115868720-115868742 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196451016 X:115868725-115868747 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196451019 X:115868730-115868752 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196451685 X:115871699-115871721 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196451687 X:115871704-115871726 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196451690 X:115871709-115871731 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196452356 X:115874686-115874708 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196452358 X:115874691-115874713 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196452361 X:115874696-115874718 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196453026 X:115877655-115877677 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196453028 X:115877660-115877682 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196453031 X:115877665-115877687 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196453696 X:115880648-115880670 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196453698 X:115880653-115880675 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196453701 X:115880658-115880680 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196454365 X:115883657-115883679 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196454367 X:115883662-115883684 GGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196454370 X:115883667-115883689 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1196455445 X:115888729-115888751 GGGCCGGGCCGGGCCGGGCCTGG - Intergenic
1196455447 X:115888734-115888756 TGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1198518158 X:137428577-137428599 CAGCAGGGCCTGCCTGGGCCGGG + Intergenic
1199881105 X:151974758-151974780 CATCGGGGCGGGCCTGGGGCGGG - Intergenic
1199976603 X:152898136-152898158 CGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1200065532 X:153502632-153502654 CTGCTGGGCCGGCCTGAGGCTGG + Intronic
1200146416 X:153928490-153928512 CGGCAGGGCGGGGCCGGGGCCGG - Intronic