ID: 1149616043

View in Genome Browser
Species Human (GRCh38)
Location 17:58000018-58000040
Sequence GGTGCTAGGCTGGGATTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149616043 Original CRISPR GGTGCTAGGCTGGGATTTCA GGG (reversed) Intronic
901844162 1:11971423-11971445 GGTGCTGGGCTGGGACTCTAGGG + Intronic
902755402 1:18546095-18546117 GGTGCGATGCTGGAATCTCACGG - Intergenic
903013597 1:20347805-20347827 GGTGATGCCCTGGGATTTCAGGG + Intronic
903777718 1:25803825-25803847 GTAGCTGGGCTGGGATTACAGGG + Intronic
904398913 1:30242967-30242989 GGTGCTGGGCTGGGACTCCTGGG + Intergenic
904619353 1:31766056-31766078 GTTGCTAGACTGGGGCTTCAAGG + Intergenic
906011875 1:42534779-42534801 GTTGCTAGGAAGCGATTTCAGGG + Intronic
907660813 1:56390784-56390806 TGTGCTAGGCTAGGGTTTTAAGG - Intergenic
909326724 1:74360756-74360778 TGTGCTAGGCTGGAATGTCAGGG - Intronic
915106545 1:153538270-153538292 GGAGCCAGGCTGGGACATCAGGG - Intronic
916248211 1:162709389-162709411 AGTGCTAGGCTGGAATACCAGGG + Intronic
918220576 1:182432708-182432730 TGTCCTAGGCTGGCTTTTCAGGG + Intergenic
919297436 1:195720873-195720895 GGTGGGAGCCTGGGAGTTCAGGG + Intergenic
921126559 1:212183093-212183115 GGGGCTTAGCTGGGATTACAGGG + Intergenic
921625639 1:217374984-217375006 GGAGCTAGGCTTGGAGGTCAGGG + Intergenic
922017400 1:221664481-221664503 GCTGCTAGGCTGCTATTTCATGG + Intergenic
922239082 1:223743756-223743778 GGTGCAAGGCTGGGCTCTGAGGG + Intronic
1063764480 10:9122312-9122334 GGTGTTAAACTGGGATTTCTGGG + Intergenic
1064279540 10:13938996-13939018 GGTGCTATTCTGGGAATTCTAGG - Intronic
1075237475 10:120744038-120744060 GGTCCTTGGCTGGGATCACATGG + Intergenic
1076433058 10:130420957-130420979 TATGCTTGGCTGGGATGTCAAGG - Intergenic
1078245438 11:9570107-9570129 GGAACTGGGCTGGGATTTGAAGG + Intergenic
1080880798 11:36318665-36318687 TGTGCTAGGATAGGATTTCAGGG + Intronic
1082978891 11:59102469-59102491 GGGGCTGGGCTGGGTTTTTAAGG + Intergenic
1088243032 11:107790512-107790534 GGGACTATGCTGGGATTCCAGGG - Intergenic
1091798644 12:3311040-3311062 GGGGCTGGCCTGGGACTTCAAGG + Intergenic
1096215051 12:49793940-49793962 GGTGCAAGGCTGGAATGTCTGGG - Intronic
1102819561 12:115896135-115896157 TGTCCTAGGCTGGGTTTTCCAGG - Intergenic
1107426355 13:40296967-40296989 GGTGCCTGGCTGGGATCTCAAGG + Intergenic
1113427602 13:110222231-110222253 GGTGCTTGGCTGAGATCCCATGG - Intronic
1113489117 13:110677803-110677825 GGTGACAGTCTGGGCTTTCATGG - Intronic
1113905671 13:113818138-113818160 GGTGCCGGGCTGGGATCTGACGG + Intergenic
1114277362 14:21158887-21158909 GGTGCTTTGCTGGAATTACATGG - Intergenic
1114532588 14:23404997-23405019 GGTTTAAGGCTGGGATTGCAGGG - Intronic
1115728488 14:36242703-36242725 GGTGCTTGGCTGAGATTTGCAGG - Intergenic
1121849500 14:97207163-97207185 GGTGCTGGGCTGGGTTGGCAGGG + Intergenic
1122081294 14:99269616-99269638 GCTCCTATGCTGGGTTTTCAGGG + Intronic
1125592185 15:40861665-40861687 GGTGCTTGCCTGGGACTTCTAGG + Intergenic
1126995680 15:54441224-54441246 TGGTCTAGGCTAGGATTTCAGGG - Intronic
1127734622 15:61829545-61829567 GGTGCAGGGCTGGGATGCCAAGG - Intergenic
1128225320 15:65997415-65997437 GCTGCTAGGCTGTGAGTTCCAGG - Intronic
1132164954 15:99577402-99577424 GCTGCAAGGCTTGGCTTTCACGG + Intronic
1132276778 15:100573206-100573228 GGTCCTAGCCTGGGAGATCAAGG - Intronic
1132387559 15:101411220-101411242 GGTGCCAGGCTGGGCGTGCAAGG + Intronic
1134669122 16:16041600-16041622 TGTCCTAGGCTGGAATTTCCTGG + Intronic
1135658108 16:24269205-24269227 GGTTCTAGGCTGGTGGTTCAGGG - Intronic
1135821452 16:25690302-25690324 GGTGCTAGGCAGGAACTGCAAGG + Intergenic
1138522528 16:57578979-57579001 TGTGCAAGGCTGAGATTTGAAGG - Intronic
1141055012 16:80805479-80805501 GGAGCCAGGCAGGCATTTCATGG - Intergenic
1141267264 16:82508538-82508560 GGTAATAGGCTGGGGTTTCGAGG - Intergenic
1142502388 17:340238-340260 GGTCCTCAGCTGGGAGTTCATGG + Intronic
1143554082 17:7650223-7650245 GCTGCAGGGCTGGGATCTCAGGG + Intronic
1146372423 17:32273568-32273590 GGTACTAGGCTGGCACTTTACGG - Intronic
1147137588 17:38443227-38443249 GGTGCTAGGCAGGGAATGCTGGG - Intronic
1147900045 17:43778256-43778278 GGAGCTGGGCCGGGATTTCCAGG - Intronic
1149616043 17:58000018-58000040 GGTGCTAGGCTGGGATTTCAGGG - Intronic
1150828124 17:68494573-68494595 AGTGCTGTGCTGGGACTTCAAGG + Intergenic
1151560600 17:74867602-74867624 GGGGCACGGCTGGGAATTCACGG + Intronic
1152553101 17:81039631-81039653 GGTGCTGCCCTGGGCTTTCAGGG + Intronic
1155232272 18:23784997-23785019 GGCTCTAGGCTGGGCTTCCAAGG + Intronic
1158044171 18:53135196-53135218 GTTTCTAGGGTGGAATTTCAGGG + Intronic
1161973845 19:7598056-7598078 GGTGCTGGGCTGGGCGCTCAGGG + Intronic
1163173756 19:15550613-15550635 GGGGCCAGGCTGGGATGTCTGGG + Intronic
1163318841 19:16560183-16560205 GGGGCGAGCCTGGGATTCCATGG + Intronic
1163485134 19:17580922-17580944 GCTGCTGGGCTGGGGTTTCACGG + Intronic
1164813270 19:31175021-31175043 GGTCCCAGGCTGGGCTTTCCTGG + Intergenic
1165042784 19:33080961-33080983 GGGGCTAGGATGGGATGTCGTGG + Exonic
1165974337 19:39661472-39661494 TCTTTTAGGCTGGGATTTCAAGG + Intergenic
1166419581 19:42626152-42626174 GGGGTTTGGCTGGGACTTCAGGG - Intronic
1167870986 19:52370061-52370083 GGAGCGATGCGGGGATTTCAAGG - Intronic
926343037 2:11920632-11920654 GGTGAGAGGCAGGGATTTTAGGG - Intergenic
928094435 2:28394919-28394941 GGGGCTAGGGTGGGCTTCCAGGG + Intronic
928415605 2:31089147-31089169 CATGGTAGGCTAGGATTTCAAGG - Intronic
932071392 2:68624171-68624193 TGTGCTAGGCTGAGTTTTGAAGG - Intronic
932338543 2:70944551-70944573 GGTGCCAGGCTGGGAGCCCAAGG - Intronic
934213884 2:90010505-90010527 TGAGCTAGGCTGGGATGTCCTGG + Intergenic
935171631 2:100614847-100614869 GGGACCAGGCTGGGATTGCATGG - Intergenic
939580440 2:143940002-143940024 GGAGGTAGGATGGGATTTTACGG - Exonic
939925851 2:148172648-148172670 GGTGCTAGGCTGTTAGTTCCAGG + Intronic
941877456 2:170448536-170448558 GGTGCCTGGTTGGGGTTTCAAGG + Intronic
942007186 2:171716548-171716570 GGTAGTAGACAGGGATTTCAAGG - Intronic
946419472 2:219556913-219556935 GGTGCTAGGCTAGGATTATGAGG - Intronic
947806555 2:232972647-232972669 TTTGCTAGGCAGGCATTTCAAGG - Intronic
948305584 2:236944691-236944713 GGTGCTAGGCTGGAGTCCCAGGG + Intergenic
948390020 2:237605220-237605242 GGTGCTTCGCTGGGAATTCTTGG + Intergenic
1170591225 20:17773391-17773413 GGGGCAAGGCTGTGACTTCAAGG + Intergenic
1171114240 20:22510714-22510736 TCTGCTAGGCAGGGATTTCAGGG + Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1173911086 20:46671444-46671466 TGTTGTAGGCTGGGTTTTCAAGG - Intronic
1175213150 20:57374426-57374448 GGTTCTGGGCTGGCATTTGATGG + Intronic
1177276305 21:18917201-18917223 GGTGCTACGTTGGAATTCCACGG + Intergenic
1178471071 21:32893434-32893456 TCTTCTAGGCTGGGATTTCCTGG - Intergenic
1180603040 22:17035276-17035298 TGTGTTAGGCAGAGATTTCAAGG + Intergenic
1183384566 22:37507638-37507660 GGTGTAAGGCTGGTATCTCAAGG + Intronic
1183492173 22:38122531-38122553 GGTGCCAGGCTGGGAGTCTAGGG + Intronic
1183496737 22:38150099-38150121 GGTGCTAAGCGTGGATTTCTGGG - Intronic
1185047365 22:48535102-48535124 GTTGCTGGGCTGGGATCCCAGGG - Intronic
949850272 3:8413553-8413575 GGTGCTAAGCTGTGAGTCCATGG - Intergenic
951678575 3:25270623-25270645 AGTGATAGGCTGGGATAACACGG - Intronic
951698376 3:25469161-25469183 GCTGCTGGGCTGGGTTTTCCTGG + Intronic
955126720 3:56119514-56119536 GGTTCTAGGCTGGGCTTACTGGG - Intronic
955301574 3:57784708-57784730 GGTGCTAGGATGGAATGTTAAGG + Intronic
958192293 3:90198453-90198475 GTTGCAAAGCTGGGATTGCAAGG - Intergenic
961466661 3:127085889-127085911 GGTGCAAGGGTGGGATGCCAAGG - Intergenic
964430808 3:156604305-156604327 GGTGCTTGGCTAGAACTTCAAGG - Intergenic
965402620 3:168231100-168231122 GGTGTTAGCCTGGGGTTGCAGGG - Intergenic
967359634 3:188614871-188614893 GGTGCCAGGCAGGGATTTAATGG - Intronic
968598928 4:1500138-1500160 TGTGCAAGGCTGGGCTTGCAGGG + Intergenic
968641108 4:1715490-1715512 GGTGCTCGGCTGGCAATTCCTGG + Intergenic
969311602 4:6356219-6356241 GGTGCTTGGCTGGGGTTTGGGGG - Intronic
970783484 4:19767825-19767847 GGTGCTAGGCAGCCATTTCTAGG + Intergenic
973644864 4:52940250-52940272 GGTCCTTGGCTGGGTTTTAAAGG - Intronic
974670027 4:65017985-65018007 GGTGCTAGGCTGGCCCTTCAGGG - Intergenic
980961637 4:139481599-139481621 GGTGCTTGCCAGGGATTTCCAGG + Intergenic
981022873 4:140047341-140047363 GGTGTGAAGCAGGGATTTCAAGG + Intronic
986915573 5:12615685-12615707 GTTGCTTGGTTGGGATTTAAGGG - Intergenic
987220891 5:15789597-15789619 GGTGCAAAGCTGTGATCTCAAGG - Intronic
988916183 5:35895554-35895576 GGTTGAAGGCTGGGCTTTCATGG - Intergenic
992554317 5:77888453-77888475 GGGGCTTGGCTGGGGTTTCGAGG + Intergenic
995417370 5:111925831-111925853 GGTCCTAGCCAGGGTTTTCAGGG + Intronic
996799997 5:127392595-127392617 GGTGCTAGACTGGAATTCAAAGG - Intronic
999306761 5:150524559-150524581 GGTGCTTTGCAGGCATTTCATGG + Intronic
1000272498 5:159699730-159699752 GGTACTAGGGAGAGATTTCAGGG + Intergenic
1001152999 5:169248348-169248370 GGTTCTAGGCTGGAATGTGATGG - Intronic
1002879768 6:1240553-1240575 GGGGCTATGTTGGGATTTGAGGG - Intergenic
1003267987 6:4583405-4583427 GGTGGTAGTCTGGGAGTTTAAGG - Intergenic
1004687028 6:17956543-17956565 GGTGTTAGGCTGTGATATTATGG + Intronic
1006029042 6:31165759-31165781 GGTGGTAAGCTTGGATCTCAGGG - Intronic
1007381393 6:41492514-41492536 GGAGGGAGGCCGGGATTTCAGGG + Intergenic
1007736345 6:43984653-43984675 GGTGGTAGGGTGGGATTGCTGGG + Intergenic
1008544967 6:52576508-52576530 GAGGCCAGGCTGGGGTTTCAGGG + Intronic
1009691808 6:67044306-67044328 GGAGCTAGGCTGGCCTTTCTCGG + Intergenic
1017152982 6:151297619-151297641 TGTGCAAGTCTGTGATTTCAAGG + Intronic
1018649958 6:165985472-165985494 GGTGATGTGCTGTGATTTCAAGG - Intronic
1023415180 7:39925466-39925488 AGTGCTGGGCTGGGATTCCAGGG - Intergenic
1024904108 7:54356550-54356572 AGTGCTAGAGTGGAATTTCAGGG - Intergenic
1024979200 7:55143488-55143510 GGTGAGAGGCTGGGATGCCAAGG + Exonic
1026778565 7:73247893-73247915 GGTACTAGGGTGGGACTGCATGG + Intergenic
1027019422 7:74801295-74801317 GGTACTAGGGTGGGACTGCATGG + Intronic
1027068604 7:75144646-75144668 GGTACTAGGGTGGGACTGCATGG - Intronic
1029699282 7:102235861-102235883 GATGCTTGGCTGGAATTTCTGGG - Intronic
1030031471 7:105373804-105373826 GGTGGGAAGCTGGGACTTCAAGG - Intronic
1031732729 7:125318399-125318421 AGTTCTAGGCTGGGATCTCAAGG + Intergenic
1032089391 7:128903776-128903798 GGGGCTAGGCGGGCACTTCAGGG + Exonic
1035705744 8:1673031-1673053 GCTGCTAGCCTGGGACTGCATGG + Intronic
1035715256 8:1749216-1749238 GGTGGCAGGCGGGGTTTTCAGGG + Intergenic
1039392019 8:37189093-37189115 GCTGCTTGGCTGGAAATTCATGG - Intergenic
1040709687 8:50173612-50173634 ATTTCTAGGCTGGGTTTTCAAGG + Intronic
1042478332 8:69275407-69275429 GGTACTAGGTGGGCATTTCAGGG + Intergenic
1044613288 8:94115310-94115332 TGTGCAAGTCTGGGATTTGAAGG - Intergenic
1047359344 8:124153415-124153437 GGTGCTGGGCTTGGAGCTCATGG + Intergenic
1052327858 9:27235671-27235693 GGTGCTAGGCTTTTCTTTCATGG - Intergenic
1053535811 9:38924358-38924380 GGTGCTAGGCTGTGCCTTAAAGG + Intergenic
1054208034 9:62148771-62148793 GGTGCTAGGCTGTGCCTTAAAGG + Intergenic
1054630321 9:67439579-67439601 GGTGCTAGGCTGTGCCTTAAAGG - Intergenic
1056531556 9:87492747-87492769 GAGGGAAGGCTGGGATTTCAGGG - Intergenic
1058775898 9:108283392-108283414 GGTGCAAGGCTGGGAGTATACGG - Intergenic
1059001903 9:110357175-110357197 GGTGTTAGGCTGTAATTTCCAGG + Intergenic
1060146584 9:121258142-121258164 GGTGCTATGCTCTGATTTCAGGG + Intronic
1061321537 9:129833806-129833828 AGTGCAAGGGTGGGATTTGAGGG + Intronic
1189647404 X:43148630-43148652 GGTGCTAGGATTGAAATTCAAGG + Intergenic
1190050907 X:47147566-47147588 GGTGCTAGGATGGGGCTTCTGGG + Intronic
1195519798 X:105818011-105818033 GTTGCTGGGCTGGGAATTCCTGG + Intergenic
1196613184 X:117737073-117737095 GATGCTAGGCTTGAACTTCAGGG - Intergenic
1198261665 X:134970389-134970411 TGTGCTAGGCTTTGATTTGAAGG - Intergenic
1198518629 X:137430924-137430946 GCTGCTTGGCTGGGAGTTAAAGG + Intergenic
1199282938 X:146022915-146022937 GGTGCTAGTGTGGTATTTCGGGG - Intergenic