ID: 1149623254

View in Genome Browser
Species Human (GRCh38)
Location 17:58061702-58061724
Sequence GAGGACAACCTAGGACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149623254_1149623261 24 Left 1149623254 17:58061702-58061724 CCCTGGGGTCCTAGGTTGTCCTC No data
Right 1149623261 17:58061749-58061771 TTGCTCATCCTAGGAGCTGGAGG No data
1149623254_1149623259 15 Left 1149623254 17:58061702-58061724 CCCTGGGGTCCTAGGTTGTCCTC No data
Right 1149623259 17:58061740-58061762 TATACTATCTTGCTCATCCTAGG No data
1149623254_1149623260 21 Left 1149623254 17:58061702-58061724 CCCTGGGGTCCTAGGTTGTCCTC No data
Right 1149623260 17:58061746-58061768 ATCTTGCTCATCCTAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149623254 Original CRISPR GAGGACAACCTAGGACCCCA GGG (reversed) Intergenic
No off target data available for this crispr