ID: 1149630472

View in Genome Browser
Species Human (GRCh38)
Location 17:58117773-58117795
Sequence TCTCTGATGTCAGCAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149630469_1149630472 8 Left 1149630469 17:58117742-58117764 CCAGCAGATGGATGTAATGGTTC No data
Right 1149630472 17:58117773-58117795 TCTCTGATGTCAGCAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149630472 Original CRISPR TCTCTGATGTCAGCAAACCC TGG Intergenic
No off target data available for this crispr