ID: 1149630489

View in Genome Browser
Species Human (GRCh38)
Location 17:58117943-58117965
Sequence TACTGAGTGCTGCTGTATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149630489_1149630494 18 Left 1149630489 17:58117943-58117965 CCAGTATACAGCAGCACTCAGTA No data
Right 1149630494 17:58117984-58118006 GACAATATTACTCTTGGGCTAGG No data
1149630489_1149630492 12 Left 1149630489 17:58117943-58117965 CCAGTATACAGCAGCACTCAGTA No data
Right 1149630492 17:58117978-58118000 TGTTAGGACAATATTACTCTTGG No data
1149630489_1149630493 13 Left 1149630489 17:58117943-58117965 CCAGTATACAGCAGCACTCAGTA No data
Right 1149630493 17:58117979-58118001 GTTAGGACAATATTACTCTTGGG No data
1149630489_1149630491 -4 Left 1149630489 17:58117943-58117965 CCAGTATACAGCAGCACTCAGTA No data
Right 1149630491 17:58117962-58117984 AGTATGTGGCGAATTTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149630489 Original CRISPR TACTGAGTGCTGCTGTATAC TGG (reversed) Intergenic
No off target data available for this crispr