ID: 1149634667

View in Genome Browser
Species Human (GRCh38)
Location 17:58157090-58157112
Sequence GCGCTCCTCCGCGGCCGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149634667_1149634676 26 Left 1149634667 17:58157090-58157112 CCGAGGCGGCCGCGGAGGAGCGC 0: 1
1: 1
2: 3
3: 16
4: 185
Right 1149634676 17:58157139-58157161 CAGTGTGGATGCGCTCGTGTCGG 0: 1
1: 0
2: 2
3: 12
4: 57
1149634667_1149634671 11 Left 1149634667 17:58157090-58157112 CCGAGGCGGCCGCGGAGGAGCGC 0: 1
1: 1
2: 3
3: 16
4: 185
Right 1149634671 17:58157124-58157146 CTCCAGCCTGCCCTACAGTGTGG 0: 1
1: 0
2: 6
3: 125
4: 1655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149634667 Original CRISPR GCGCTCCTCCGCGGCCGCCT CGG (reversed) Intergenic
902586218 1:17439871-17439893 GCGCGCCTCGCCGCCCGCCTCGG + Intergenic
907528676 1:55070836-55070858 GCGCTCATCCCCGCCCACCTTGG - Intronic
908714295 1:67053767-67053789 CCGCTCCTCCTCCGCGGCCTGGG + Intronic
910760962 1:90730561-90730583 GCGTCGCTCCGCGGCCGCGTTGG - Intergenic
913703292 1:121395926-121395948 GCCCTCCACCGCCGCCGCCACGG + Intergenic
916792449 1:168136482-168136504 GCGCCCCTCCCCTGCGGCCTGGG - Intronic
916961392 1:169893496-169893518 GACCGACTCCGCGGCCGCCTTGG + Intronic
919463241 1:197902936-197902958 CCGCCCCGCCGCGGCCGCCCCGG + Intronic
920435404 1:205943739-205943761 CCCCTCCTCCAGGGCCGCCTTGG - Intergenic
921383955 1:214551419-214551441 GCCATCCTCCCCGGCCTCCTCGG - Intronic
924527278 1:244863747-244863769 GCTCTTCCCCGCGGCCTCCTTGG + Exonic
924754978 1:246932244-246932266 GCGCGCCGCCGGGGCCGCCAGGG - Intergenic
1065188580 10:23191845-23191867 GTCCTCCTCCGCGGCAGCCTGGG - Intergenic
1068953906 10:62804983-62805005 GCGGTCCCCGGCGGCCGCCACGG - Exonic
1071532343 10:86400144-86400166 GCACCGCTGCGCGGCCGCCTAGG - Intergenic
1072190522 10:93073604-93073626 GCCCTCCCCCACCGCCGCCTCGG + Intronic
1072784000 10:98268251-98268273 GGCCTCCTCCGCGGCCAGCTCGG - Intergenic
1073213006 10:101819676-101819698 GCGCTCCTGCGCTCCAGCCTGGG - Intergenic
1073266421 10:102230804-102230826 GCCCTCCGCCGCGGCTGCCCCGG - Exonic
1075682781 10:124344255-124344277 GTGCTCCTCCCGGGCCACCTGGG - Intergenic
1076574275 10:131453586-131453608 GCGCTCCTCCCCGGCCCCTCTGG + Intergenic
1076804236 10:132847211-132847233 GTGCTCCTCCGGGGCTGCCCTGG + Exonic
1076998734 11:311541-311563 GCGCTCCTGGGCGGGCCCCTTGG + Intronic
1077000009 11:318218-318240 GCGCTCCTGGGCGGGCCCCTTGG - Intergenic
1077097567 11:805417-805439 GCGCTGCTGCGCGGGCGGCTCGG - Intronic
1077220923 11:1415834-1415856 GGGCTCCACCACGGCCTCCTCGG + Intronic
1077435997 11:2539506-2539528 GGACTCCACCGCGGCAGCCTGGG + Intronic
1079494960 11:21032000-21032022 GCGCTCCTGCACGCCAGCCTGGG + Intronic
1081857274 11:46311890-46311912 GCGCTCCTTGGAGGCAGCCTGGG - Intronic
1082928946 11:58579346-58579368 GGGCTCCTCCGGAGCCGCCTTGG - Exonic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083437604 11:62653269-62653291 GCGCTCCGCCGCTCGCGCCTCGG - Exonic
1083672137 11:64305633-64305655 CCCCTCCTCCGCCGCCTCCTCGG - Intronic
1083757811 11:64801001-64801023 GCGCTCCACAGCAGCCACCTCGG + Exonic
1084264496 11:67997873-67997895 CCGCTCCTCCGCGGCCTGCGTGG - Intronic
1084387725 11:68854733-68854755 GCGGTCCTGCGCGGGCGCCGGGG - Intergenic
1084538920 11:69774771-69774793 GCGCTCCCCGACGGCCGCATCGG - Exonic
1084712396 11:70852095-70852117 ACGCTCCTCCCCGGCGGCCAGGG - Intronic
1085109696 11:73876787-73876809 ACGCTCCTACGCGGCGGCTTGGG + Exonic
1089374777 11:117986498-117986520 GCGCTCCTCAGCCTCCGTCTTGG + Exonic
1091220247 11:133926361-133926383 CCGCTCCTGAGCGGCCGCCAAGG - Intronic
1091383651 12:78315-78337 GCGCCCCTCCTCGGCCTCCACGG + Intronic
1092796044 12:12111058-12111080 GCGCGCCTCCTCCGCCGCCGCGG + Intronic
1096251959 12:50039358-50039380 GCCATCCTCCGCAGCCACCTGGG + Intergenic
1097850401 12:64404984-64405006 GCGCTCCTCGGCGGCGGCCCCGG - Intronic
1100315441 12:93441384-93441406 CCGCACCTCCGCGGCCCCGTCGG + Intronic
1102457189 12:113078001-113078023 GCGCTCCGCCGGGGGCGCCCGGG - Exonic
1102854132 12:116278037-116278059 GCCCTCCTCCGCGGCCACCACGG - Intergenic
1103954248 12:124567583-124567605 GCGCTCCCCGGCGGCCGCGGCGG + Intronic
1104952484 12:132447865-132447887 GCGCCCTTCCGCAGCCTCCTGGG + Intergenic
1105018854 12:132803228-132803250 GCCCTCCTCAGCGGGCGCCTAGG + Intronic
1105617379 13:22030877-22030899 GGGCTCCTCAGCAGCCGGCTGGG + Intergenic
1110965488 13:81689963-81689985 GCGCGCCTCCTCCGCCGCCGCGG + Intergenic
1113655813 13:112067354-112067376 CCGCTCCGCCGAGGGCGCCTGGG + Intergenic
1113764252 13:112870979-112871001 TCCCTCCTCCACGGCCACCTGGG + Intronic
1113924018 13:113930373-113930395 GTGCTCCTGCGCCCCCGCCTCGG - Intergenic
1113924025 13:113930395-113930417 GTGCTCCTGCGCCCCCGCCTCGG - Intergenic
1114046493 14:18880723-18880745 GCTCTGCTCCGCGGGCGCTTTGG + Intergenic
1114117719 14:19638727-19638749 GCTCTGCTCCGCGGGCGCTTTGG - Intergenic
1117441688 14:55766159-55766181 GCCATCTTCCGCAGCCGCCTGGG - Intergenic
1118627700 14:67674465-67674487 GGCCTCCTCCGCCGCCTCCTCGG - Exonic
1118971596 14:70642222-70642244 GGGCTCCTCCGCCGCCGCCCGGG - Exonic
1122418405 14:101561077-101561099 GCGCGGCTCGGCGGCCGCCGGGG + Intergenic
1124453700 15:29821977-29821999 GAGCGCCTCCGCGGCCGCCAGGG - Intronic
1124500373 15:30223085-30223107 GCCCTCCTCCGCCGCCTCCGGGG - Intergenic
1124743200 15:32315581-32315603 GCCCTCCTCCGCCGCCTCCGGGG + Intergenic
1124957225 15:34367314-34367336 CTGCTCCTCCGCGCCCGCCGCGG + Intergenic
1130115303 15:81000956-81000978 GCTCGCCGCCGCCGCCGCCTCGG - Exonic
1132275338 15:100558913-100558935 GCTCTCCGCCACGGCCGCCTGGG + Intergenic
1133281523 16:4668191-4668213 GCACCCCTGCGTGGCCGCCTGGG - Intronic
1135023807 16:18984030-18984052 GCGCTCCTCAGAGGCTGCCGAGG - Exonic
1136488164 16:30586319-30586341 GCGCTCCATCGCGCCCGGCTAGG - Intergenic
1142742557 17:1939778-1939800 GCGCGCCTGCCTGGCCGCCTGGG - Intronic
1143164771 17:4892357-4892379 GCGCCCCCCCGCCGCCCCCTCGG + Intronic
1147044835 17:37744564-37744586 CCGCTGCTCCGCCGCCTCCTCGG + Exonic
1147150267 17:38510188-38510210 CCGCTCCTCCGGCGCCGCCGGGG - Exonic
1147392971 17:40121791-40121813 CCGCTCCTCCGCGCGCTCCTCGG + Intergenic
1147971089 17:44219418-44219440 GCGCGCGTCCTCAGCCGCCTCGG + Intronic
1148615506 17:48997426-48997448 ACGTTTCTCCGCGGCCGCCCTGG - Exonic
1149634667 17:58157090-58157112 GCGCTCCTCCGCGGCCGCCTCGG - Intergenic
1150228649 17:63538022-63538044 GAGCTCCTCCGCGGCCCCACTGG - Intronic
1150562142 17:66303085-66303107 GCGCTCCGGCGCGTCCGCCCCGG + Intronic
1153900608 18:9614496-9614518 CCCCTCCTCCGCGGCCGCCCGGG + Exonic
1154303998 18:13217801-13217823 GCGCGCCGCCGCGGCCGGCCGGG + Intronic
1154325615 18:13388720-13388742 GCACTCCTCCGCAGTCGCCGTGG + Intronic
1157599642 18:48886049-48886071 ACGCTCCCCCGCGGCTGCCCGGG - Intergenic
1158773754 18:60552930-60552952 GAGCTCCTACCCGGCCACCTTGG - Intergenic
1160706345 19:531913-531935 GGGCCCCTCCGCCGCCGCCATGG + Exonic
1160909790 19:1469177-1469199 GCGCGCCCCCGGGCCCGCCTCGG - Exonic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1161006796 19:1941201-1941223 GCGCTCCGCCGCGCCCGCTCCGG - Exonic
1161265331 19:3361015-3361037 GCGCTCTTCCTCCGCCGCCCAGG - Intronic
1161349203 19:3783133-3783155 CAGCTCCTCCTCGGCCGACTTGG + Exonic
1161796053 19:6387394-6387416 CCACTCCTCCTCGGCCTCCTCGG + Exonic
1166106685 19:40601237-40601259 GCGCCCCCGCGCGGCCGCCGGGG + Intronic
1167052262 19:47086485-47086507 GCGATCCTCCACGGCTTCCTCGG + Exonic
1202681423 1_KI270712v1_random:7112-7134 GCCCTCCGCCGCCGCCGCCCCGG - Intergenic
925069108 2:951809-951831 GCGCTTCTCGGCAGCCTCCTAGG - Intronic
925183650 2:1832648-1832670 GCTCTCCTCCGCGGCCACCAAGG + Intronic
927168800 2:20351071-20351093 GGGCTCCGCCGCGGCGGGCTCGG + Intronic
928540275 2:32278078-32278100 GGTCGCCGCCGCGGCCGCCTCGG + Exonic
933596793 2:84290679-84290701 GCCCTCTTCCGCGGCCGCGGTGG + Intergenic
937208565 2:120252818-120252840 GCGCGCCTCCGGCGTCGCCTAGG - Exonic
939613005 2:144332514-144332536 CCCCTCCCCCGCGGCCGCCGCGG + Intronic
942346134 2:175004946-175004968 GCGCTCCTCCCAGGCGGGCTAGG + Exonic
943645981 2:190408353-190408375 GCGCTCCTCCGGGGCTGCGACGG - Exonic
944457616 2:199911540-199911562 GCGCGCCGCCGCTGCCGCCCGGG - Exonic
945203721 2:207310203-207310225 GCCCTCCACCCCGGCCCCCTTGG - Intergenic
946227208 2:218270367-218270389 GCGCGCCTCCGGGGTCTCCTGGG + Intergenic
947119730 2:226801204-226801226 GCGCTCCCCCGCGGCCCGCCGGG - Intergenic
947641162 2:231708602-231708624 GCGCGCCTCCTCCGCCGCCGCGG + Exonic
947717955 2:232351313-232351335 GGGCTGCACCGCGGCGGCCTCGG - Intergenic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1169220595 20:3820255-3820277 GCGCCCCCTCGCGGCCGCCGGGG + Intergenic
1171020382 20:21579371-21579393 GCACTTCTCCATGGCCGCCTTGG + Intergenic
1173582939 20:44160142-44160164 GGGCGCCCGCGCGGCCGCCTCGG + Exonic
1174066290 20:47868067-47868089 GCTCTCCTGCGGGGCCTCCTCGG - Intergenic
1174658673 20:52192087-52192109 GCGCTGCTCCCGGGACGCCTGGG + Intronic
1176206557 20:63891780-63891802 GAGCTCCTCCTCCGCCTCCTGGG - Intergenic
1176255984 20:64153212-64153234 GCGCTCCCCTGCCGCCTCCTTGG + Intronic
1176286029 21:5020248-5020270 ACCCTCCCCCGCGGCCGCCTCGG + Intergenic
1177010989 21:15730125-15730147 CCGCTCGTCCGCGGCGGCCCGGG - Exonic
1178350915 21:31872881-31872903 GCGCGCCTCCGAGGCCGCGCAGG + Intergenic
1179871152 21:44243227-44243249 ACCCTCCCCCGCGGCCGCCTCGG - Intergenic
1179906469 21:44425673-44425695 CGGCTCCTCCGCGGCCTTCTGGG - Exonic
1180465029 22:15603359-15603381 GCTCTGCTCCGCGGGCGCTTTGG + Intergenic
1180737011 22:18024615-18024637 CCGCAGCTCCGCGGCCTCCTGGG - Intergenic
1180784537 22:18539466-18539488 GGGCTCCTCCTTGGCCTCCTTGG - Intergenic
1181128114 22:20713519-20713541 GGGCTCCTCCTTGGCCTCCTTGG - Intronic
1181241440 22:21478823-21478845 GGGCTCCTCCTTGGCCTCCTTGG - Intergenic
1182338877 22:29603638-29603660 GCGCCTCTCAGCGGCCGACTAGG - Exonic
1184278625 22:43425034-43425056 GCCCTCCTCCCCTGCGGCCTGGG + Exonic
1184663862 22:45977444-45977466 GCGCTCCTCCGCGCACGCGGGGG + Intergenic
1184680681 22:46071050-46071072 GCGCGCCCCAGCAGCCGCCTCGG + Intronic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
1185313824 22:50170433-50170455 GCGCTCCGCCGCCGCCCCCGGGG - Intergenic
1185333388 22:50261438-50261460 GCGCACCTCCCAGGCCGTCTTGG + Exonic
953319843 3:41961944-41961966 GCGCTCTTCCGCGACCGCTTAGG + Intronic
953881754 3:46694504-46694526 CTGCTCTTCCACGGCCGCCTTGG - Intergenic
959849822 3:111072386-111072408 GCCCTCCCCCGCGGCCGCGCGGG + Intronic
960281373 3:115784525-115784547 GCGCCCCTCCGTGCTCGCCTGGG + Intergenic
960386409 3:117026593-117026615 GCGCGCCTCCTCAGCCGCCGCGG + Intronic
962676950 3:137764574-137764596 TCGCTCCCCCGGGGCTGCCTGGG + Exonic
966849345 3:184155290-184155312 GCGCCTCTCCGCGGCGGCCGGGG + Intronic
967118193 3:186360938-186360960 GCGCTGCGCCGCTGCCTCCTCGG - Intronic
969256865 4:6008236-6008258 GCGCAGTTCCGCAGCCGCCTCGG + Intergenic
969271387 4:6105674-6105696 GCGCGCCTCCTCGCGCGCCTCGG + Exonic
969354970 4:6619949-6619971 GCGCTCCTCCACTGCCACCACGG - Exonic
969912859 4:10461331-10461353 GCGCGCTTCCGCGGCAGCCGCGG - Intergenic
975420461 4:74158163-74158185 TCGCTGCTCCGCGGCCGCCTTGG + Exonic
975983447 4:80183764-80183786 GCCCTGCCCCGCGCCCGCCTGGG + Intergenic
989102307 5:37834689-37834711 GCGGTCTTCGGCGGGCGCCTCGG + Exonic
989991663 5:50774445-50774467 GCGCCTCTGCCCGGCCGCCTTGG - Intronic
992597593 5:78361147-78361169 GCTCTCCGCCGCCGCCACCTCGG - Intronic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
998193046 5:140043096-140043118 CCGCTCAGCCGCCGCCGCCTTGG + Exonic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1001823043 5:174724751-174724773 GCGCTCCTCCGCGGCCCCCTCGG - Exonic
1001948032 5:175796749-175796771 CAGCTCCTCCGCGGCCGACGAGG - Exonic
1002456027 5:179345695-179345717 GCGCTTCTCTGCCGCCGCCTCGG - Intergenic
1002666771 5:180831184-180831206 GCCCGCCGCCGCCGCCGCCTCGG + Intergenic
1002691398 5:181053070-181053092 GGGCGCCACCGCAGCCGCCTGGG - Intronic
1003418914 6:5938438-5938460 GGGCTCCTCCGCTGAAGCCTGGG - Intergenic
1003644047 6:7899966-7899988 GTGCTCCTCTGCAGCAGCCTCGG + Intronic
1004596227 6:17102224-17102246 GCGCTCCTCCTCCGCGGGCTTGG - Intergenic
1007479766 6:42142313-42142335 CCCCTCCTCCGGGGCCTCCTGGG + Exonic
1011734414 6:90296965-90296987 GCGCACCTCCCCGGCCGCTGGGG + Intergenic
1013273255 6:108561081-108561103 GGGCGCCGCCGCCGCCGCCTGGG - Exonic
1016949447 6:149566256-149566278 GCGCCTCTCCGCGGCCGCCCGGG + Intergenic
1017651002 6:156582574-156582596 GAGCTCCTCCACGGTCACCTGGG + Intergenic
1017877404 6:158536416-158536438 GCGCCCATCCGCCGCCGCCCCGG - Exonic
1018653219 6:166008441-166008463 CCGCTCCTCCGCCCCCGCTTGGG - Intergenic
1020046682 7:5045979-5046001 GCACACCCCCGCGCCCGCCTAGG - Exonic
1024075090 7:45814035-45814057 TCGCCCCACCGCGGCCGCCCGGG - Intergenic
1025130201 7:56371000-56371022 GGGCTCCTCCGCGCCCAGCTTGG - Intergenic
1025130521 7:56372298-56372320 GGGCTCCTCCGCGCCCAGCTTGG - Intergenic
1025130839 7:56373592-56373614 GGGCTCCTCCGCGCCCAGCTTGG - Intergenic
1027121918 7:75527980-75528002 GCACAGCTCCGCGTCCGCCTAGG + Intergenic
1029423473 7:100483571-100483593 GCGCCCCCCAGCGGCAGCCTGGG - Intergenic
1034946652 7:155266758-155266780 GAGCACCTCCACGGCTGCCTCGG - Intergenic
1034977739 7:155457987-155458009 GGGCTCCGGCGCCGCCGCCTGGG - Intergenic
1037529184 8:19757245-19757267 TCCCTCCTGCGCGGCCGCCGCGG + Intronic
1039921631 8:41897306-41897328 GCGCGCCTCCGGGGCTCCCTGGG + Intergenic
1048469534 8:134695137-134695159 GAGCTCCTCCACTGCAGCCTGGG - Intronic
1049183799 8:141238112-141238134 GTGCTGCTCCGTGGACGCCTAGG + Intronic
1050472506 9:6007909-6007931 GCTCTCCTCAGCCGCCGGCTCGG + Intergenic
1053011793 9:34637791-34637813 GCGCTCCCCCGCCACCGCCGTGG + Intronic
1053161261 9:35814908-35814930 GCGCACCCCCGTGGCCGCCACGG + Exonic
1054842626 9:69759823-69759845 GCGCGCCTCCGCCGCCTCCGAGG - Intronic
1060965816 9:127711866-127711888 GCGCAGCTCCTCGGCCTCCTTGG - Exonic
1061131888 9:128713107-128713129 GCGCTCCCCAGCGGCCGCACTGG + Exonic
1061840586 9:133356568-133356590 GGGCTGCTCCGCGGGCGCGTCGG + Exonic
1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG + Intergenic
1185877588 X:3713212-3713234 GCTCTCCGCCGCGGCCGCCTGGG + Exonic
1187915600 X:24149968-24149990 GCGCGCCTCCGCCGCCGCTCGGG - Intronic
1195156060 X:102125733-102125755 TCGCTGCTCCCCCGCCGCCTGGG - Exonic
1195158056 X:102142404-102142426 TCGCTGCTCCCCCGCCGCCTGGG + Exonic
1198750225 X:139931845-139931867 CCTCCCCTCCCCGGCCGCCTGGG + Intronic
1199615183 X:149650275-149650297 GTGCTCCTCTGGGGCCTCCTGGG + Intergenic
1199635427 X:149808032-149808054 GTGCTCCTCTGGGGCCTCCTGGG - Intergenic
1199948018 X:152682846-152682868 GTGCTCCTCTGGGGCCTCCTGGG - Intergenic
1199961661 X:152785608-152785630 GTGCTCCTCTGGGGCCTCCTGGG + Intergenic
1200129006 X:153830923-153830945 GCGCCCCTCCCCCGCCGCCGTGG - Intergenic
1200229397 X:154436760-154436782 GCGCGCCGCTGCGGCAGCCTGGG - Intergenic
1200418302 Y:2935619-2935641 GCGCACCTCCGCAGCCGCTCAGG - Exonic
1200787720 Y:7274332-7274354 GCTCTCCGCCGCGGCCGCCTGGG - Intergenic