ID: 1149636273

View in Genome Browser
Species Human (GRCh38)
Location 17:58172488-58172510
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149636272_1149636273 -7 Left 1149636272 17:58172472-58172494 CCAACTCAGAGTTGCTGTCCAGC No data
Right 1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG No data
1149636271_1149636273 5 Left 1149636271 17:58172460-58172482 CCAAAGGAGACACCAACTCAGAG No data
Right 1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149636273 Original CRISPR GTCCAGCAGCACCATGCTGT AGG Intergenic