ID: 1149637953

View in Genome Browser
Species Human (GRCh38)
Location 17:58185404-58185426
Sequence CTGAGGGTGTGCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149637953_1149637967 26 Left 1149637953 17:58185404-58185426 CCCTCCTCCCTGCACACCCTCAG No data
Right 1149637967 17:58185453-58185475 CCTCATTCTCAGGAAGCCCTGGG No data
1149637953_1149637962 2 Left 1149637953 17:58185404-58185426 CCCTCCTCCCTGCACACCCTCAG No data
Right 1149637962 17:58185429-58185451 TTCTCATGAAAATAGGGCCAAGG No data
1149637953_1149637965 25 Left 1149637953 17:58185404-58185426 CCCTCCTCCCTGCACACCCTCAG No data
Right 1149637965 17:58185452-58185474 ACCTCATTCTCAGGAAGCCCTGG No data
1149637953_1149637960 -5 Left 1149637953 17:58185404-58185426 CCCTCCTCCCTGCACACCCTCAG No data
Right 1149637960 17:58185422-58185444 CTCAGTGTTCTCATGAAAATAGG No data
1149637953_1149637961 -4 Left 1149637953 17:58185404-58185426 CCCTCCTCCCTGCACACCCTCAG No data
Right 1149637961 17:58185423-58185445 TCAGTGTTCTCATGAAAATAGGG No data
1149637953_1149637963 16 Left 1149637953 17:58185404-58185426 CCCTCCTCCCTGCACACCCTCAG No data
Right 1149637963 17:58185443-58185465 GGGCCAAGGACCTCATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149637953 Original CRISPR CTGAGGGTGTGCAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr