ID: 1149638121

View in Genome Browser
Species Human (GRCh38)
Location 17:58186349-58186371
Sequence CTCTGCTGCAGTTGCTCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149638121_1149638125 4 Left 1149638121 17:58186349-58186371 CCTTAGGAGCAACTGCAGCAGAG No data
Right 1149638125 17:58186376-58186398 CTGGATGTTTACAGGACCAGTGG No data
1149638121_1149638124 -4 Left 1149638121 17:58186349-58186371 CCTTAGGAGCAACTGCAGCAGAG No data
Right 1149638124 17:58186368-58186390 AGAGGCGACTGGATGTTTACAGG No data
1149638121_1149638127 21 Left 1149638121 17:58186349-58186371 CCTTAGGAGCAACTGCAGCAGAG No data
Right 1149638127 17:58186393-58186415 CAGTGGTGCCAGATCTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149638121 Original CRISPR CTCTGCTGCAGTTGCTCCTA AGG (reversed) Intergenic
No off target data available for this crispr