ID: 1149641327

View in Genome Browser
Species Human (GRCh38)
Location 17:58204804-58204826
Sequence CAGCAGCCTGCACTTGCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 353}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149641327_1149641330 8 Left 1149641327 17:58204804-58204826 CCTGGAGCAAGTGCAGGCTGCTG 0: 1
1: 0
2: 2
3: 29
4: 353
Right 1149641330 17:58204835-58204857 GCTGGCTACAGCTCAGAGCTGGG 0: 1
1: 1
2: 2
3: 25
4: 254
1149641327_1149641328 -10 Left 1149641327 17:58204804-58204826 CCTGGAGCAAGTGCAGGCTGCTG 0: 1
1: 0
2: 2
3: 29
4: 353
Right 1149641328 17:58204817-58204839 CAGGCTGCTGACGCTTCTGCTGG 0: 1
1: 0
2: 0
3: 25
4: 181
1149641327_1149641331 21 Left 1149641327 17:58204804-58204826 CCTGGAGCAAGTGCAGGCTGCTG 0: 1
1: 0
2: 2
3: 29
4: 353
Right 1149641331 17:58204848-58204870 CAGAGCTGGGTTCCCCAGCCAGG 0: 1
1: 1
2: 4
3: 49
4: 384
1149641327_1149641329 7 Left 1149641327 17:58204804-58204826 CCTGGAGCAAGTGCAGGCTGCTG 0: 1
1: 0
2: 2
3: 29
4: 353
Right 1149641329 17:58204834-58204856 TGCTGGCTACAGCTCAGAGCTGG 0: 1
1: 0
2: 1
3: 22
4: 188
1149641327_1149641332 29 Left 1149641327 17:58204804-58204826 CCTGGAGCAAGTGCAGGCTGCTG 0: 1
1: 0
2: 2
3: 29
4: 353
Right 1149641332 17:58204856-58204878 GGTTCCCCAGCCAGGAGTGAAGG 0: 1
1: 1
2: 3
3: 16
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149641327 Original CRISPR CAGCAGCCTGCACTTGCTCC AGG (reversed) Exonic
900215324 1:1478604-1478626 CACCAGCTGGCACTTGCTCAGGG - Intronic
900222585 1:1517271-1517293 CACCAGCTGGCACTTGCTCAGGG - Exonic
900352946 1:2245548-2245570 CTGCAGCCTCCACCTCCTCCTGG + Intronic
900469412 1:2845872-2845894 CTACAGGCTGCTCTTGCTCCTGG + Intergenic
902516543 1:16992557-16992579 CTGCAGCCGGCTCTTCCTCCAGG + Exonic
902551122 1:17220151-17220173 CAGCAGCCTGCAGGGGCTCCTGG + Intronic
902614671 1:17617365-17617387 CAGGTGCCTACCCTTGCTCCTGG + Intronic
902662839 1:17917329-17917351 CAACAGCCAGCACTAACTCCAGG - Intergenic
904143523 1:28371674-28371696 CTGCAGCCTGGACCTCCTCCTGG + Intronic
905009234 1:34735945-34735967 CAGCAGCCTTCCCTTGATGCAGG + Intronic
905159033 1:36015118-36015140 CAGAGGCCTGGACTTGCTACTGG - Intronic
905505511 1:38476293-38476315 CAGCCGCCTTCTCCTGCTCCCGG + Intergenic
906136918 1:43506365-43506387 CAGCACCCTGGACAGGCTCCAGG + Intergenic
907248318 1:53121879-53121901 CAGCAGCCTCCACCAGCCCCCGG - Intronic
908402322 1:63783041-63783063 CAGCAGCCTGCAGCTGCTCTGGG + Intronic
909374159 1:74921143-74921165 CAGCAGCCAGGCCTTCCTCCAGG + Intergenic
911310801 1:96289654-96289676 GAGCAACCTGCTCTTGCTACAGG - Intergenic
911664468 1:100538362-100538384 GAGAAGCGGGCACTTGCTCCTGG + Exonic
912020145 1:105097971-105097993 CAGCAGCGTCAACTTGCTCGTGG - Intergenic
913680966 1:121186674-121186696 CAGCCGCCTGCGCGGGCTCCGGG - Intronic
914032797 1:143974313-143974335 CAGCCGCCTGCGCGGGCTCCGGG - Intergenic
914156650 1:145093652-145093674 CAGCCGCCTGCGCGGGCTCCGGG + Intronic
915454486 1:156030438-156030460 AATCACCCTGCCCTTGCTCCTGG - Intergenic
915737367 1:158093582-158093604 CAGCAGGAAGCACTTGTTCCAGG + Intronic
916106360 1:161435500-161435522 CAGCAGCCTGGACCTGTTGCAGG + Intergenic
917671859 1:177280810-177280832 GAGCAGCATGCGCTTCCTCCAGG - Exonic
917751640 1:178058560-178058582 CAGCAGCCCTCACTTACCCCTGG - Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918070473 1:181130395-181130417 CCGCAGCCTGCCCTTCCTCAAGG - Intergenic
919398666 1:197081770-197081792 CAGCAGCTTGCACCTGCACTTGG + Intergenic
920011792 1:202873464-202873486 CAGGATGCTGCACTTGCTCTGGG - Intergenic
920171813 1:204076616-204076638 CAGCACCCTGTTCTTCCTCCTGG - Intronic
920468278 1:206205198-206205220 CAGCCGCCTGCGCGGGCTCCGGG - Intronic
921708136 1:218346917-218346939 CAGCACCAGGGACTTGCTCCAGG + Exonic
923092791 1:230752650-230752672 CAGCAGGCTGTGCTAGCTCCTGG - Intronic
924811740 1:247408816-247408838 GGGCAGCCTGCACAAGCTCCTGG + Intergenic
1065983927 10:30930556-30930578 CAGCAGCCCTCGCTTGCTCTCGG - Intronic
1069360271 10:67633518-67633540 CAGCAGCCTGCTCCTTCTTCTGG - Intronic
1069557220 10:69406369-69406391 GAGGGGCCTGCACTTGCTCTGGG - Intronic
1069630016 10:69891949-69891971 CAGCAGCCAGCACTTTGTCCTGG + Intronic
1070085971 10:73237492-73237514 CTGCAGCCTCCACCTCCTCCTGG + Intronic
1070688831 10:78509800-78509822 CAGGCCCCTGCACTTGCTCCTGG - Intergenic
1071034723 10:81231604-81231626 CAGCAGCTTGTACTTACTTCAGG + Intergenic
1072026698 10:91467170-91467192 GAGCAGCCTGCTCTTGCCACGGG + Intronic
1072641703 10:97215914-97215936 CTGCAGCCTGCATTTGGCCCAGG - Intronic
1073267060 10:102234199-102234221 CAGCAGCCTGTATTTGCACATGG + Intronic
1074288437 10:112120187-112120209 GAGCAGCCTTCACTTTCTGCTGG + Intergenic
1075155733 10:119974573-119974595 CTTCAGCCTGCACTTTCTCAGGG - Intergenic
1076060852 10:127412926-127412948 CAGCACCCTGGACCTCCTCCAGG + Intronic
1076130271 10:128009147-128009169 CAGCAGCCTGCACATTCTGGAGG + Intronic
1076445674 10:130512289-130512311 CAGCCCCTTGCACCTGCTCCTGG + Intergenic
1076815526 10:132912968-132912990 CAGCTGCCTGCCTTTGCTCTGGG + Intronic
1077150623 11:1071550-1071572 GGGCAGCCTGCACTTGCTGGAGG + Intergenic
1077246509 11:1541884-1541906 CAGAAGCCTGCCCTGCCTCCCGG + Intergenic
1077388787 11:2289600-2289622 CAGCAGGCTGCATGGGCTCCAGG + Intergenic
1077501704 11:2912389-2912411 CTGCAGCCTGTTCTGGCTCCTGG + Intronic
1077616220 11:3676003-3676025 CAGCATCCTCCACTTGTTCAGGG - Exonic
1078527462 11:12111335-12111357 CAGTAGCCCGCTCTCGCTCCAGG + Intronic
1083054944 11:59810644-59810666 CAGCAGCCTCCACATGGTCACGG + Exonic
1083904897 11:65662998-65663020 GCGCGGCGTGCACTTGCTCCCGG - Exonic
1084072530 11:66745392-66745414 CAGAAACCTGCACCTGCACCGGG - Intronic
1084859203 11:72007177-72007199 CAGCAGCCTGACCTTGGTCATGG + Exonic
1085427235 11:76415339-76415361 CAGCAGCCTCCAGTCCCTCCTGG - Intergenic
1085605195 11:77891339-77891361 GAGGATCCTGCACATGCTCCAGG + Exonic
1086443261 11:86849072-86849094 CATGAGCTGGCACTTGCTCCAGG - Intronic
1087158168 11:94924305-94924327 TAGCAGCCAGCACTCGCTGCAGG + Intergenic
1088926961 11:114312333-114312355 CAGCAGCCTCTACTGCCTCCCGG - Exonic
1089970551 11:122689709-122689731 CAGAAGCCTGGACTTGCAACTGG - Intronic
1090575110 11:128094005-128094027 CAGCAGGCTGGACTTGCTGCAGG - Intergenic
1090684410 11:129100002-129100024 GAGCAACCTGCACTCGCTACAGG + Intronic
1091392436 12:133796-133818 CAGCATCTGGCATTTGCTCCTGG + Intronic
1092947012 12:13465972-13465994 CAGCAGGATTCACTTGCTCCTGG + Intergenic
1093153094 12:15647164-15647186 CAGCAGCTTCCCCTTGGTCCAGG + Exonic
1096119478 12:49078453-49078475 CTTCATCCTGCATTTGCTCCTGG + Intergenic
1096499214 12:52055106-52055128 CAGCGGCCTTCACTTCCACCTGG - Exonic
1096558320 12:52417982-52418004 CATCACCCTGCAGTTGCTCTAGG + Intergenic
1097038236 12:56138209-56138231 TGGCCGCCTGCACTTGCGCCTGG + Exonic
1098955511 12:76685507-76685529 CAGCAGCCTGCAGCTTCCCCTGG + Intergenic
1100715594 12:97302138-97302160 CAGAAGGCTGGACTTGCTCAAGG - Intergenic
1101908640 12:108846512-108846534 CAGCAGCCTGCACATGCAGAAGG + Intronic
1102970567 12:117162849-117162871 GAACAGCCTGCACGTGGTCCAGG - Intronic
1103736919 12:123066423-123066445 CAGACCCCTGCTCTTGCTCCTGG - Intronic
1103956332 12:124578902-124578924 CAGCAGTCTGAAGTGGCTCCTGG + Intergenic
1103998909 12:124847722-124847744 AAGAAGCCTGCAATTCCTCCTGG - Intronic
1104271112 12:127283036-127283058 CAGCTGCCTGCACTTTTTCAAGG - Intergenic
1104603090 12:130166579-130166601 AAACAGACTGCACTAGCTCCAGG - Intergenic
1104736421 12:131138361-131138383 CTGCAGGCTGCACGTGCTCTGGG + Intronic
1105519352 13:21117601-21117623 CAGCTGCCTGGATTTGCTCATGG - Intergenic
1106760598 13:32863753-32863775 GAGCAGCAAGCACTTGCTCAGGG - Intergenic
1107978609 13:45713757-45713779 CAGCACCCTGCAGCTCCTCCGGG + Exonic
1110166424 13:72448450-72448472 CAACAGCCTGCATGTGCACCTGG + Intergenic
1110249796 13:73368881-73368903 CAGCCACCTCCATTTGCTCCGGG - Intergenic
1111778679 13:92694331-92694353 CAACAGCTTGCACATGCACCTGG + Intronic
1112438843 13:99410618-99410640 CTGCAGCCTCCACCTCCTCCTGG + Intergenic
1112565590 13:100549068-100549090 CAGCCGCGAGCCCTTGCTCCTGG - Intronic
1112804590 13:103149879-103149901 CTCCAGCCTGCAGTTGCTTCAGG + Intergenic
1113131519 13:107042485-107042507 CAGCAGTCTGCAGTTGATCTGGG - Intergenic
1113594820 13:111523725-111523747 CAGCAGCATGCATTGGGTCCAGG - Intergenic
1113710094 13:112457501-112457523 CAGCAGCCTGTGCCTGCGCCAGG + Intergenic
1113926466 13:113944371-113944393 CAGCAACCTGCCCTGGCACCTGG - Intergenic
1114205843 14:20570572-20570594 CAGCAGCCTGGACATGTTGCAGG - Intergenic
1115004818 14:28468760-28468782 CATCAGCCTGCAGCTGCTCAGGG + Intergenic
1118471105 14:66076197-66076219 CAGCAGCATTCCCTGGCTCCTGG - Intergenic
1118920668 14:70147009-70147031 CAGCAGCCTGTATTTCCTCCAGG + Intronic
1119667932 14:76498313-76498335 CAGCAGCTTGCCCGTCCTCCAGG - Exonic
1119898876 14:78243411-78243433 CAGCAGCTGGCACTTCCTCATGG + Intronic
1120929808 14:89836942-89836964 CTGCAGCCTCCACTTCCTCCTGG - Intronic
1121446824 14:93984041-93984063 CAGCAGGCTGGACTTTCTCATGG + Intergenic
1121577783 14:95002468-95002490 CAGGAGTCTGCATCTGCTCCCGG + Intergenic
1122724017 14:103738852-103738874 CAGCAGCGTGCACTGGTCCCCGG + Intronic
1123214066 14:106790567-106790589 CCGCCCCCTGCACCTGCTCCTGG + Intergenic
1124515366 15:30362917-30362939 TAGCAGCCTCCACTGCCTCCCGG + Intronic
1124649371 15:31463619-31463641 CAGAGGCCTGGACTTGCACCTGG + Intergenic
1124955819 15:34359664-34359686 CACCATCCTGCACCTGCTGCTGG - Exonic
1125462589 15:39920660-39920682 CAGCAGCCTGGCCCTGCGCCCGG + Exonic
1125506920 15:40272448-40272470 CAGCAACCTGTACCTGCCCCAGG + Exonic
1125685637 15:41561671-41561693 CAGCAGACAGCACGTGCTCCAGG - Intronic
1126580655 15:50239566-50239588 CACAAGCCTGCAATTGCTCTTGG + Intergenic
1128602631 15:69010717-69010739 CAGCAGCCTCTACTTGCCTCTGG + Intronic
1131891874 15:96981707-96981729 TAGCAGCCTGGACCTCCTCCAGG + Intergenic
1132147488 15:99437289-99437311 CTGTAGCCTGCACTGGCTCTTGG + Intergenic
1132913063 16:2325687-2325709 CACCTGCCTGCAGTTGCCCCAGG - Intronic
1133214697 16:4284626-4284648 CAGGTGCCTGCCCTTGCGCCTGG - Intergenic
1133749702 16:8714880-8714902 CTGCTGCCTGCATTTCCTCCGGG + Intronic
1133888932 16:9860078-9860100 CAGCATCCTGTGCCTGCTCCCGG - Intronic
1135644983 16:24154014-24154036 CAAGAGCCTGCAATAGCTCCTGG - Intronic
1136536311 16:30902023-30902045 CAGCCCCCTGCCCGTGCTCCGGG + Intronic
1137668899 16:50267843-50267865 CAGCCTCCTGCACTTCCTGCAGG - Intronic
1138891449 16:61149251-61149273 AAAAAGCCTGAACTTGCTCCAGG - Intergenic
1139505392 16:67395877-67395899 GAGCTGCCCGCACCTGCTCCTGG + Intronic
1139630312 16:68227743-68227765 CAGCAGGCTGCAGTTTCTGCTGG - Exonic
1141177285 16:81729494-81729516 CAGCAGCCTGCACTTCCTTTCGG - Intergenic
1141507637 16:84489305-84489327 GAGCAGCCAGCACCTGCACCCGG + Exonic
1141920461 16:87132357-87132379 CAGGAGCCTGCACCTGTTCCTGG - Intronic
1142029056 16:87829443-87829465 GAGCAGCCTTCACTGGATCCAGG + Intergenic
1142273252 16:89102037-89102059 CTGCTGCCTGCACAGGCTCCAGG - Intronic
1142280407 16:89144977-89144999 CAGCTGTATGCACTTCCTCCAGG - Intronic
1142713196 17:1734413-1734435 CAGCAGCAGGAACTTGCTCAAGG - Intronic
1142751285 17:1989466-1989488 CAGCAGCTGGCCCTGGCTCCAGG - Intronic
1143330538 17:6131767-6131789 CAGGAGCCTGCACCAGGTCCAGG - Intergenic
1143431532 17:6891130-6891152 CATCAGACTGCAGTTTCTCCAGG + Intronic
1144108385 17:12007768-12007790 CAGGAGCCACCACATGCTCCTGG - Intergenic
1145898018 17:28471900-28471922 CACCAGCCTGGCCTCGCTCCAGG + Intronic
1146061374 17:29609165-29609187 CAGCAGCCAGCAGCAGCTCCCGG - Exonic
1147443598 17:40461945-40461967 GAGCAGCCCGCCCTTGCTGCAGG - Intergenic
1147502861 17:40982396-40982418 CAGCAGCCTGCATGGGATCCTGG - Exonic
1147552132 17:41450865-41450887 AAACAGCCTGCACAGGCTCCTGG - Intergenic
1147670136 17:42172083-42172105 TTGCAGCCTGCCCTGGCTCCAGG - Intronic
1148437717 17:47695799-47695821 CAGGAGCCTGCCCCTGCTGCCGG + Exonic
1148769284 17:50057522-50057544 CTGAAGCCTGGACATGCTCCTGG - Intronic
1149641327 17:58204804-58204826 CAGCAGCCTGCACTTGCTCCAGG - Exonic
1150266366 17:63834671-63834693 CATCAGCCTGCTTTTGCCCCAGG + Intronic
1151064439 17:71134260-71134282 CAGCAGGGTGCACTTGTTTCTGG + Intergenic
1151453762 17:74214322-74214344 CAGCTGCTTGCGCTTGTTCCAGG + Intronic
1151541112 17:74764887-74764909 CAGCAGCCTGTCCTTGCCCGGGG + Intronic
1152245783 17:79183916-79183938 CCGTTGCCAGCACTTGCTCCTGG + Intronic
1154145987 18:11866614-11866636 GAGCAGCCTGCACTGAATCCAGG + Intronic
1155917819 18:31573291-31573313 CAGGAGGCTTCACTTGCTCAAGG + Intergenic
1157702240 18:49769102-49769124 CAAAAGCCTGCAGTAGCTCCTGG + Intergenic
1159086418 18:63797278-63797300 CAGCAGCATACACTTAGTCCTGG + Intronic
1159254347 18:65926692-65926714 CAGAGGCCTGCCTTTGCTCCTGG - Intergenic
1160822627 19:1065618-1065640 CAGCTGCCTGCACATGCGTCTGG + Intergenic
1162284991 19:9731509-9731531 GAGCAGCCTGAACTTGATGCAGG - Intergenic
1162397263 19:10424342-10424364 CGGCTGCCTCCACCTGCTCCTGG - Intronic
1163445047 19:17341161-17341183 CAGCAGCCAGCGCCTCCTCCTGG + Exonic
1163563389 19:18034667-18034689 CTGCAGCCTTGACTTCCTCCTGG - Intergenic
1164684273 19:30156790-30156812 CAGCAGCCTCAACTTGCTGGAGG + Intergenic
1164897652 19:31891168-31891190 CTGCCTCCTCCACTTGCTCCTGG + Intergenic
1165142812 19:33712611-33712633 CAGCCGCCCACACTTGCTCCAGG + Intronic
1165224142 19:34342217-34342239 CAACAGCCTGCGCTGGCTGCTGG - Exonic
1165321549 19:35088519-35088541 CAGGAGCCAGCACTGCCTCCTGG - Intergenic
1165737294 19:38184816-38184838 CAGCAGCCTCCCCATGCTCCCGG + Intronic
1165864215 19:38926231-38926253 CAGCTGCCTTCTCTTCCTCCAGG + Exonic
1166152560 19:40884508-40884530 CACCAGCCTGCACCTGGGCCTGG + Intronic
1166178675 19:41091916-41091938 CACCTGCCTGCACTGGCTGCTGG - Intronic
1167029447 19:46947749-46947771 CAGAGGCCTGCACTTGCAACTGG - Intronic
1167039270 19:47013064-47013086 CAGCACCCAGCATTCGCTCCAGG + Intergenic
1167095511 19:47373173-47373195 AAGGAGCCTGGACTTTCTCCAGG - Intronic
1167096144 19:47375950-47375972 CAGCGGCCTGCAGCTGCGCCAGG - Exonic
1167465742 19:49650462-49650484 CTGCAGCCTCCACCTCCTCCTGG + Intronic
1167672190 19:50859663-50859685 CAGCATCCTGCAGATGGTCCTGG + Intronic
1167674946 19:50878092-50878114 CAGCATCCTGCAGATGGTCCCGG + Intronic
1168316374 19:55486491-55486513 CAGCGGCCTGCGCTTTGTCCTGG + Exonic
925081117 2:1067886-1067908 CATAAGCCTGCACTTCCTCCCGG - Intronic
926425460 2:12735331-12735353 CAGGAGCCTGCTCTTTCTCTAGG - Intronic
926690579 2:15730674-15730696 CAGCAGCCGGCATCTGCCCCAGG - Intronic
930013830 2:46957438-46957460 CAGCATCCAGCACCTGCTCTGGG - Intronic
930536633 2:52652463-52652485 CAGCAGCCTGGACCTGTTGCAGG + Intergenic
930939560 2:56997814-56997836 CAGCAGCCTGCCCCTGCTTTGGG + Intergenic
933799965 2:85952945-85952967 CTGCAGCCTGAACTTGGTCAGGG + Intergenic
934773204 2:96921152-96921174 GAGCAGCACGCACCTGCTCCGGG + Exonic
935056710 2:99573852-99573874 CAGCAGCCAGCACTTCCTCCAGG + Intronic
936673441 2:114686066-114686088 AAGCAGCCTGCATGTGTTCCAGG - Intronic
937308500 2:120886851-120886873 CAGCACCTTGTGCTTGCTCCTGG - Intronic
937565076 2:123275549-123275571 CACCAGACTTCAATTGCTCCTGG - Intergenic
941704049 2:168638895-168638917 CAGCAGCCACCATTTGCTCTTGG - Intronic
942046544 2:172102385-172102407 CAGCAGCCTCCACAAGCCCCAGG - Exonic
945084350 2:206116440-206116462 CTGCAGCCTGCACGTGGTCCTGG - Intronic
946966562 2:225042744-225042766 CCGCAGCCTGCAGTTCCCCCGGG - Intergenic
947873106 2:233450555-233450577 CAGCAGCCTGCACAGGCTGGGGG - Intronic
948185689 2:236019623-236019645 CAGCAGCCTGCACCTGGACGGGG + Intronic
948309086 2:236971869-236971891 CAGCCCCCTGCCCTGGCTCCTGG - Intergenic
948529486 2:238595295-238595317 CAGCTGCCTGCAGTTGCCCAGGG - Intergenic
949041242 2:241850900-241850922 CTCCAGCCTGCACCTGCACCAGG - Exonic
1170712820 20:18807681-18807703 CAGCTGGCTGCACTTGCCCCAGG + Intergenic
1174450301 20:50615999-50616021 CACCAGCCTGGAATTCCTCCTGG + Exonic
1175140308 20:56855899-56855921 CAGCAGCCAGCAGTGGCTCGGGG + Intergenic
1175538644 20:59734016-59734038 CACAAGGCTGAACTTGCTCCAGG + Intronic
1175750871 20:61496324-61496346 CTGCAGCCTCAACTTCCTCCTGG - Intronic
1175777003 20:61659789-61659811 AAGCAGCCTGCCCCAGCTCCTGG - Intronic
1177239972 21:18443735-18443757 CTGCAGCCTCCTCTTGTTCCAGG + Intronic
1177710055 21:24762514-24762536 CACCAGCATTCACTGGCTCCTGG + Intergenic
1178679371 21:34659772-34659794 CAGCAGCCAGCAGTGGCACCTGG - Intergenic
1178940335 21:36900285-36900307 CATCCTCCTTCACTTGCTCCAGG - Intronic
1179896053 21:44364360-44364382 CAGCCTCCTGCTCTTGCCCCAGG - Intronic
1179974491 21:44856421-44856443 CAGCAGCCTTCCCTCGCCCCTGG + Intronic
1181089882 22:20465279-20465301 GGTCAGCCTGCACCTGCTCCAGG + Exonic
1181756685 22:25029178-25029200 CAGCAGCCTTCTCTGGCTCTGGG - Exonic
1182183727 22:28378794-28378816 CGGCTGCTTGAACTTGCTCCTGG - Intronic
1182270796 22:29152142-29152164 CAGGGGACTGCCCTTGCTCCTGG - Intronic
1182444213 22:30380776-30380798 CATCCTCCTGCACTTCCTCCTGG + Intronic
1182794178 22:32978324-32978346 CAGAAACCTGCTCTGGCTCCCGG - Intronic
1183363129 22:37393326-37393348 CAACAGCCTCCACTCGCACCTGG + Intronic
1184295605 22:43522404-43522426 CATCAGCCTTCACTTTCTGCTGG + Intergenic
1185118533 22:48951962-48951984 CAGGAGCCTTCAGTTGCTGCTGG - Intergenic
949523658 3:4881116-4881138 ACGCAGCCTGCACTTGATGCTGG - Intronic
949722002 3:7000312-7000334 CAGGTGCCTGCAATTGCACCTGG + Intronic
950422643 3:12907820-12907842 CAGCAGCCAGGGCTGGCTCCGGG - Intronic
950427919 3:12934659-12934681 CAGGAGCCTGCACGTTCCCCAGG + Intronic
950626045 3:14247819-14247841 CAGCAGGCTGCCCCTGCTTCTGG - Intergenic
952955378 3:38554035-38554057 GAGGACCCAGCACTTGCTCCTGG - Intronic
953117634 3:40008968-40008990 CTCCTGCCTGCCCTTGCTCCAGG + Intronic
954240879 3:49292523-49292545 CAGGGGCCTGCAATGGCTCCAGG - Exonic
955117448 3:56019749-56019771 CAGCAGCAAGGACTTTCTCCTGG + Intronic
955176332 3:56617733-56617755 CAGCAGCCTGGATTTGCCCATGG - Intronic
956056132 3:65300870-65300892 CAGAAGCCTGGACTTGCCACTGG - Intergenic
956178906 3:66500261-66500283 CGGCCGCCTGCACTTGCGCTGGG - Exonic
956514951 3:70036348-70036370 CAACAGCCTGTATTTTCTCCTGG + Intergenic
956644735 3:71444645-71444667 CAGCTGCCTGGAATTGCTCCTGG + Intronic
956815757 3:72906879-72906901 CAGCAGCTTGGACTTGATCTTGG + Intronic
956967456 3:74478521-74478543 CAGAAACCTCCACTGGCTCCTGG - Intronic
960664128 3:120094077-120094099 CCGCCGCCTGCAGCTGCTCCTGG - Intronic
961424838 3:126836883-126836905 CAGTCCCCCGCACTTGCTCCTGG - Intronic
961431508 3:126887455-126887477 CACGAGCCTCCACTTGCACCAGG - Intronic
962255230 3:133865861-133865883 CAGCAGCCAGCATTTGCTATGGG + Intronic
962979513 3:140474915-140474937 CAGCACCCTGCACTTTCTCAGGG + Intronic
963723817 3:148896203-148896225 CAGCTGCTAGCACTTGCTCTGGG + Intronic
964143989 3:153436328-153436350 CTACAGCCTGGACTTGCTTCTGG + Intergenic
964433870 3:156632460-156632482 CAGCAGCCTGACCTTGAACCAGG + Intergenic
966181858 3:177196453-177196475 CGGCAGCCGGGCCTTGCTCCGGG - Exonic
966450884 3:180060073-180060095 CAGCAAGCTCCACTTGCTCTAGG - Intergenic
967394341 3:188990274-188990296 CAGCAGCCTTCTCTAGTTCCGGG - Intronic
967931827 3:194695552-194695574 CAGCAGGCTCCTCCTGCTCCAGG + Intergenic
968008165 3:195256825-195256847 CTTCAGCCTGCACCTGCCCCTGG - Intronic
968217452 3:196905445-196905467 CAGAAGCCTGGACTTGCAACTGG - Intronic
968629016 4:1640814-1640836 CTGCCGCCTGCACCTGCCCCGGG - Exonic
968629032 4:1640876-1640898 CTGCTGCCTGCACCTGCCCCAGG - Exonic
968968677 4:3782224-3782246 CACCAGCCTGCAGCTGCTCAGGG - Intergenic
968976460 4:3824658-3824680 CTCCAGCCTGGATTTGCTCCTGG + Intergenic
969198714 4:5584691-5584713 CAGCATCCAGGACTTGCTCCTGG - Exonic
969714539 4:8861885-8861907 CAGCGGCCTCCTCTTGGTCCCGG - Intronic
969757863 4:9161867-9161889 CAGGAGCCTGCTTGTGCTCCCGG - Intergenic
970440666 4:16078585-16078607 CAGCAGCTTGCTCTTGCTCCAGG - Intronic
971209203 4:24599631-24599653 TAGCAGCCCTCACTTGCTCTCGG - Intergenic
971209614 4:24603103-24603125 CAAGAGCCTGCAGTTGTTCCAGG + Intergenic
973004264 4:44989516-44989538 CAGCCGCCTGCAATTGGTTCAGG + Intergenic
973791854 4:54385207-54385229 CAGCATCCTCCACCGGCTCCAGG - Intergenic
974884272 4:67797568-67797590 AAGCAGCCTTCAGGTGCTCCAGG + Intergenic
975033966 4:69658440-69658462 CAGCAGCCCTCACTTGCTCTCGG - Intergenic
975386353 4:73764371-73764393 CAGTAGCCTACAGTTGCCCCAGG - Intergenic
975837113 4:78435216-78435238 CTACACTCTGCACTTGCTCCAGG + Intronic
977793758 4:101137592-101137614 CATCAGCCTACCCTTGCTCTGGG - Intronic
978351570 4:107825202-107825224 CAGCTGAAGGCACTTGCTCCCGG - Intronic
978729139 4:112004343-112004365 CAGAAGCCTGCCATTGCACCGGG - Intergenic
981514831 4:145596593-145596615 CTGCAGCCTCCACTGGCTGCAGG - Intergenic
981905166 4:149914401-149914423 GAGCAGCCTGCAATTGCTCTGGG - Intergenic
982101933 4:151976418-151976440 CAGCACCCTGTGCTTGCCCCTGG + Intergenic
984093711 4:175408480-175408502 CAGCAGCCTGAACCTGATGCAGG - Intergenic
985677349 5:1238863-1238885 CAGGAGCCAGCGCCTGCTCCAGG + Intronic
985764687 5:1770692-1770714 CAGCAGCCTCTCCTTTCTCCAGG + Intergenic
986713121 5:10502330-10502352 CACCCGCCTCCACCTGCTCCCGG - Intergenic
986873736 5:12081192-12081214 CAGCAGCCTGCAGCTGCTGGAGG - Intergenic
987009711 5:13749742-13749764 CAGGAACTTCCACTTGCTCCAGG + Intronic
987099108 5:14577114-14577136 CAGCAGCCTTCCCTCGCTCTCGG + Intergenic
987923632 5:24314155-24314177 TAGCAGCCCTCACTTGCTCTCGG + Intergenic
988591914 5:32556667-32556689 CATGAGCTGGCACTTGCTCCGGG + Intronic
988719207 5:33859281-33859303 CAGCAGTCTGAAGTTGATCCGGG + Intronic
989190578 5:38666296-38666318 CAGTAGCCTCCTATTGCTCCTGG - Intergenic
994692414 5:103034832-103034854 CACAAGCCTGCAGGTGCTCCGGG - Intergenic
996338977 5:122415281-122415303 CTGCAGCCTACTCTTGCTCTTGG - Intronic
997358671 5:133280607-133280629 CAGCTGCCTGGTCTTGCTCCTGG + Intronic
997373682 5:133382041-133382063 CCCCATCCTGCACTTCCTCCCGG + Intronic
997373860 5:133383178-133383200 CCACATCCTGCACTTCCTCCTGG + Intronic
998317342 5:141194517-141194539 CGCCACGCTGCACTTGCTCCTGG + Exonic
998791188 5:145767446-145767468 CAGCCTCTTGCACTTGCACCCGG - Intronic
999197208 5:149790516-149790538 CAGTAGCCTGCACTTCCTGGAGG + Intronic
999549238 5:152666594-152666616 GAGCAGCCTTATCTTGCTCCTGG - Intergenic
1003908050 6:10720396-10720418 TAGCAGCCTTCGCTTGCTCTCGG - Intergenic
1004252163 6:14031765-14031787 CATCACCCTGCACTGGTTCCAGG - Intergenic
1004769628 6:18767447-18767469 CAGCAGCCTGCTGTTGGTGCTGG + Intergenic
1004885617 6:20049166-20049188 CAGCAGGTTGAACTTGTTCCAGG - Intergenic
1005710567 6:28500258-28500280 CAGGAACCTGCAGTTGCTCCAGG - Intergenic
1005841726 6:29748390-29748412 CAGCAGGAAGCACTAGCTCCGGG + Intergenic
1006073761 6:31516166-31516188 CACCTGCCTGCAGGTGCTCCTGG + Intergenic
1006295204 6:33167179-33167201 CAACAGCCTCCACTTCCTCCAGG + Intronic
1007595078 6:43046249-43046271 CATCACCCTGCACATGCGCCGGG - Exonic
1009418899 6:63443454-63443476 TAGCAGCCCTCACTTGCTCTTGG - Intergenic
1009660720 6:66607121-66607143 CAGCAGCCTGAACCTGTTGCAGG + Intergenic
1010807778 6:80259251-80259273 CAGCAGCTTGCTGCTGCTCCAGG + Intronic
1010844705 6:80690674-80690696 CAGGATCATGCAGTTGCTCCAGG - Intergenic
1011311278 6:85982074-85982096 TGGCATCCTGCACTTGGTCCTGG + Intergenic
1014624972 6:123714188-123714210 CTGCAGCCTGGACTTACTGCAGG - Intergenic
1015042566 6:128739794-128739816 CAGCAGTCTGAATTTGCTTCTGG + Intergenic
1015145318 6:129978575-129978597 CAGCAGCCGGCAGCTGCCCCTGG + Intergenic
1016615427 6:146042283-146042305 TAGCAGCCTCCACTTCCTCCTGG - Intronic
1018384484 6:163290541-163290563 CGGCTGCCTCCACTTACTCCTGG + Intronic
1019168741 6:170116842-170116864 CAGCCTCCTGCTCTTCCTCCTGG - Intergenic
1019399393 7:843413-843435 CAGCATGCTGCAGTTGCTGCAGG - Exonic
1023035366 7:36126885-36126907 CAGTAGCCTGCAGATGCTTCAGG + Intergenic
1023865107 7:44234769-44234791 CAGGACCCTGGGCTTGCTCCTGG - Intronic
1024420264 7:49157725-49157747 CAGCAGCAGCCACCTGCTCCAGG + Intergenic
1024507926 7:50178704-50178726 AAGAAGCCTGCCTTTGCTCCTGG + Intergenic
1024776198 7:52789301-52789323 CAGCACCCTGAACCTGCACCTGG + Intergenic
1025847407 7:65212752-65212774 GAGGATCCTGCACATGCTCCAGG - Intergenic
1025897651 7:65718642-65718664 GAGGATCCTGCACATGCTCCAGG - Intergenic
1027938373 7:84637666-84637688 CAGCAGCCAGCAGTGCCTCCAGG + Intergenic
1029026357 7:97421006-97421028 CAGACACCTGCACTTACTCCTGG - Intergenic
1030303129 7:107993863-107993885 CAGCAGCCTGCTGTTCCTGCTGG - Intronic
1031489549 7:122370011-122370033 CTGCAGCCTTGTCTTGCTCCAGG + Intronic
1032855142 7:135828034-135828056 CAACAGCCTGCACTTTCCCAAGG - Intergenic
1033777588 7:144629676-144629698 CAACAGCTTGCACTTCCACCTGG + Intronic
1035126326 7:156610426-156610448 CAGCTGCCCGTTCTTGCTCCAGG - Intergenic
1035456539 7:159013123-159013145 CAGCATCCTCCAAATGCTCCTGG - Intergenic
1035704726 8:1666907-1666929 CAGCAGCCGGCAGCTGCTCTCGG + Intronic
1035755420 8:2027364-2027386 CCGCAGCCTTGACTTCCTCCTGG + Intergenic
1039897946 8:41729733-41729755 CAGCAGCCTCCATCTGTTCCCGG + Intronic
1040545824 8:48397137-48397159 AAGCTGCCTCCACTTCCTCCGGG + Intergenic
1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG + Intergenic
1041006683 8:53502822-53502844 GAGCAGACGGCACTTGCTACTGG - Intergenic
1041181150 8:55249513-55249535 CAGCACCATGCACTTGGCCCAGG - Intronic
1042946182 8:74156777-74156799 CAGCAGCCTGAGCTTGATCTAGG + Intergenic
1043559007 8:81468918-81468940 CAGCGGCCTGGACTTGCTACTGG - Intergenic
1043844844 8:85152519-85152541 TAGCAGCCCTCACTTGCTCTCGG + Intergenic
1045555195 8:103208760-103208782 CTGCTGCCTGCTCTTGATCCTGG + Intronic
1046064004 8:109175336-109175358 CAGCAGCCTGAACCTGTTGCAGG + Intergenic
1046407637 8:113794982-113795004 CAGAATCCTGAACTTGATCCTGG + Intergenic
1046691820 8:117294299-117294321 CAGCACCCTGCACTTTGCCCAGG - Intergenic
1047986549 8:130240863-130240885 CAGCAGCCTGCATCTTCTCTGGG - Intronic
1049148529 8:141019637-141019659 CACCAGGCTGCTCCTGCTCCTGG + Intergenic
1049594692 8:143477931-143477953 GGCCAGCCTGGACTTGCTCCCGG + Intronic
1051102460 9:13536599-13536621 GAGCAGCATCCACTTGCTTCTGG - Intergenic
1051875732 9:21791233-21791255 CAGAAGCCTGGACTTGCAACCGG + Intergenic
1053462042 9:38278619-38278641 CGGCAGCCTGCACTTGGGGCAGG + Intergenic
1056001988 9:82227554-82227576 CAGCAGCCTGCCCTTCCCCCGGG + Intergenic
1056385147 9:86090605-86090627 CAGCAGTCTGAAGTTGCCCCGGG - Intronic
1056821066 9:89842488-89842510 AATGAGCCTGCACTGGCTCCCGG - Intergenic
1056899487 9:90584612-90584634 GAGCATCCTGCATCTGCTCCAGG + Intergenic
1060722354 9:125987450-125987472 GAGCAGCCTGCCCTTGCCCACGG - Intergenic
1061024788 9:128041491-128041513 CAGAGGCCTGAACTTGCTGCTGG + Intergenic
1061728779 9:132597251-132597273 CAGCAGCTTGGACCTCCTCCAGG - Intronic
1061810664 9:133161145-133161167 AAACAGCCTGCTGTTGCTCCCGG - Intronic
1062313808 9:135955283-135955305 CAGCAGCCTTACCTTGGTCCTGG + Exonic
1062321633 9:135993139-135993161 CAGCAGCCTCCCTGTGCTCCTGG - Intergenic
1062446670 9:136598155-136598177 CAGTAGCCTGGACTGGCTCGAGG - Intergenic
1062544440 9:137055219-137055241 CAGCAGCCTGCACTCCCTGGTGG - Intergenic
1186189686 X:7056366-7056388 CTGCCACCTGCACATGCTCCCGG + Intronic
1186799444 X:13078604-13078626 AAGAAGCCAGGACTTGCTCCAGG - Intergenic
1188589806 X:31819995-31820017 AAGCAGCCTGACCTAGCTCCTGG - Exonic
1188883063 X:35513761-35513783 CAGAGGCCTGAACTTGCTACTGG + Intergenic
1190825857 X:54017370-54017392 CTGCAGCCTCCACCTCCTCCTGG - Intronic
1193749778 X:85327190-85327212 GAGCAACCTGCACTTGCCCTGGG - Intronic
1194077648 X:89416973-89416995 TAGCAGCCTTCGCTTGCTCTCGG + Intergenic
1194627508 X:96242825-96242847 CAGCAGCAAGCACCTGTTCCTGG + Intergenic
1195850943 X:109280812-109280834 CATGAGCCGGCACTTGCCCCAGG + Intergenic
1196427214 X:115582961-115582983 CAGCAGCCTGAACCTCCCCCAGG - Intronic
1199280416 X:145993942-145993964 CAGCAGACTGGACATTCTCCTGG - Intergenic
1199635498 X:149808360-149808382 CAGCAGCAGGCACCTCCTCCAGG - Intergenic
1199875359 X:151923814-151923836 CAGCAGCAGGCACTTCCTCCAGG - Exonic
1200143524 X:153913717-153913739 CAGCAGGCTGTACAGGCTCCAGG + Intronic
1200336252 X:155354032-155354054 GAGCAGCCTGCCCTTCCCCCTGG - Intergenic
1200350218 X:155487195-155487217 GAGCAGCCTGCCCTTCCCCCTGG + Intergenic
1200430299 Y:3072519-3072541 TAGCAGCCTTCGCTTGCTCTGGG + Intergenic
1202257959 Y:22940508-22940530 CATGAGCTAGCACTTGCTCCAGG - Intergenic
1202410949 Y:24574266-24574288 CATGAGCTAGCACTTGCTCCAGG - Intergenic
1202459832 Y:25095806-25095828 CATGAGCTAGCACTTGCTCCAGG + Intergenic