ID: 1149643258

View in Genome Browser
Species Human (GRCh38)
Location 17:58218978-58219000
Sequence GGGTTCTTAGAGGCTGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149643258 Original CRISPR GGGTTCTTAGAGGCTGTGAG TGG Intronic
900418300 1:2545030-2545052 GGGCTTTGAGAGGCTGTGAGAGG + Intergenic
907013322 1:50986180-50986202 TGGTTGTCAGGGGCTGTGAGAGG + Intergenic
907813430 1:57894818-57894840 GGGTTTGTAGAGGGTGGGAGAGG + Intronic
908480369 1:64533466-64533488 GGCTTTTCAGAGGCTGAGAGTGG + Intronic
908527914 1:65005371-65005393 TGGTTATTAGAGGCTGGGAAGGG + Intergenic
909915676 1:81315663-81315685 GGGCTCTTAGTGTCTGTGAGAGG - Intronic
910045434 1:82908286-82908308 TGGTTGCTAGAGGCTGTGAAGGG - Intergenic
910331716 1:86080258-86080280 TGGTTATTTGAGGCTGGGAGGGG + Intronic
910383282 1:86653789-86653811 TGGTTCCTAGAGGCTGGGAAGGG - Intergenic
911102598 1:94106095-94106117 CTGGCCTTAGAGGCTGTGAGAGG - Intronic
912960729 1:114193153-114193175 TGGTTCTCAGAGGCTGGGAAGGG - Intergenic
913474276 1:119221861-119221883 GGATTATTAGAGGGTGTCAGGGG - Intergenic
914988723 1:152480367-152480389 GTGTTCTGAGAGGCTATGAAAGG + Intergenic
916498538 1:165366856-165366878 GGGTTTTGGGAGGCTGTGATGGG - Intergenic
916586755 1:166156060-166156082 AGGCTCTCAGAGGCTGTTAGAGG - Intronic
917320317 1:173774387-173774409 GGGTTCTTATATGCTGTAGGTGG + Exonic
919144645 1:193618260-193618282 TGGTTACTAGAGGCTGTGAAAGG - Intergenic
919926597 1:202194716-202194738 GGTTTCCTAGAAGCTGGGAGGGG + Intronic
920258600 1:204673851-204673873 TGGTTCTTTGAGTGTGTGAGAGG + Intronic
920390624 1:205598222-205598244 GGGTGGCCAGAGGCTGTGAGAGG - Intronic
921586698 1:216955205-216955227 TGGTTATAAGAGGCTGGGAGGGG - Intronic
921672080 1:217936630-217936652 TGGTTATCAGAGGCTGTGGGTGG + Intergenic
924949638 1:248870723-248870745 TGGTTATCAGAGGCTGGGAGAGG + Intergenic
1063088882 10:2843765-2843787 GGTTTCATAGAGGCTGAGAAGGG - Intergenic
1065576952 10:27130548-27130570 AGGTTTTAAAAGGCTGTGAGTGG - Intronic
1066015519 10:31239192-31239214 TGGTTATTAGAGGCTGGGAAGGG + Intergenic
1068457251 10:57272220-57272242 TGGTTATTAGAGGCTGTGGATGG - Intergenic
1068989210 10:63133613-63133635 GTGGTCGCAGAGGCTGTGAGGGG + Intronic
1071488483 10:86119717-86119739 GTGTTCTTGAAAGCTGTGAGTGG - Intronic
1072844010 10:98808233-98808255 GGTTTCTGAGAGGGTTTGAGGGG - Intronic
1072916874 10:99542593-99542615 GGTTTCTTGGAGGCTGAGAGAGG + Intergenic
1074076990 10:110137453-110137475 GTGCTCTCAGAGGCTGTGATAGG + Intergenic
1074481021 10:113820759-113820781 GAGTTTTAAGAGCCTGTGAGAGG + Intergenic
1075316962 10:121460528-121460550 TGGCTCTTAGAGGGTGTGGGTGG + Intergenic
1075418835 10:122285915-122285937 GGGGGCTTAGTGGCTTTGAGGGG - Intronic
1076220267 10:128728182-128728204 CTGTTCTCAGAGGCTGTCAGTGG - Intergenic
1076381315 10:130026319-130026341 GGATTCTCAAGGGCTGTGAGGGG - Intergenic
1076532716 10:131155449-131155471 GTGTTCTCAGAGGCTGCGTGGGG - Intronic
1076749027 10:132532618-132532640 GGTATCCTAGAGGCTGTGTGAGG + Intergenic
1077169382 11:1159473-1159495 GGGCTGTACGAGGCTGTGAGGGG + Intronic
1077435202 11:2535610-2535632 GGGCTCTGAAAGGCAGTGAGTGG - Intronic
1080512661 11:32990293-32990315 TGGTTCCTAGAGGCTGGGAGAGG + Intronic
1081523377 11:43904951-43904973 GGTTTATTAGAGGTTGTGGGAGG + Intronic
1081685665 11:45041422-45041444 GGGATCATAGAGGCTTTGAGAGG + Intergenic
1082580396 11:54859632-54859654 GTTTTCTTAGAATCTGTGAGGGG + Intergenic
1084121316 11:67070672-67070694 GTCGTCTTAGAGGCTGTCAGAGG + Intronic
1084329988 11:68424540-68424562 GGGTCCTTAGCAGCTGTGGGGGG + Intronic
1084379476 11:68802095-68802117 TGGTTCTGAGGGGCTGGGAGAGG + Intronic
1084952432 11:72674094-72674116 GGGTGGTGAGCGGCTGTGAGAGG - Intronic
1085326809 11:75612598-75612620 GGGGTCTTGGAGGCTGTGCAAGG + Intronic
1086474293 11:87154141-87154163 TGGTTACTAGAGGCTGAGAGAGG - Intronic
1087739703 11:101873165-101873187 GGGTCCAAAGAGGCTGGGAGTGG + Intergenic
1088737082 11:112736811-112736833 AGATTTTTAGAGGCAGTGAGAGG + Intergenic
1088750200 11:112836540-112836562 GGGTGCTCAGAGGCCGTGAGGGG - Intergenic
1091423897 12:369140-369162 GGCTTCTTTGAGGGTGTGATAGG - Intronic
1093018046 12:14174334-14174356 GGGATCTAAAAAGCTGTGAGAGG - Intergenic
1095969014 12:47888733-47888755 GGGTATTTAGAGGCTGGGATGGG + Intronic
1096040756 12:48514278-48514300 TGGTTATTAGAGGCTGTAAAAGG - Intronic
1096196553 12:49652319-49652341 GGGTACTCAGAGGCTCAGAGTGG + Intronic
1096275034 12:50199547-50199569 AGGTGCTGTGAGGCTGTGAGAGG - Intronic
1098108184 12:67093309-67093331 TGGTTATTAGAGGCTGGGAAGGG + Intergenic
1101325234 12:103709778-103709800 GGCTTCTGAGAGCCTGGGAGAGG + Intronic
1102024654 12:109707395-109707417 TGGTTCTCCCAGGCTGTGAGTGG - Intergenic
1103064407 12:117885133-117885155 GGCTTCTGAGAGGCTCTGAGAGG + Intronic
1103742410 12:123099741-123099763 GGGATCTGAGAGGCTGTAGGTGG - Intronic
1103867486 12:124064459-124064481 GGCTCCTTAAAGGCTGAGAGAGG + Intronic
1103888108 12:124217765-124217787 GGGTTACCAGAGGCTGTCAGAGG + Intronic
1104408863 12:128541685-128541707 GGGGACTAAAAGGCTGTGAGAGG + Intronic
1104990669 12:132622215-132622237 GGGTTCCAGGTGGCTGTGAGAGG - Intronic
1105348326 13:19593938-19593960 TGGTTATTAGAGGCTGGGAAGGG + Intergenic
1107265444 13:38548036-38548058 TGGTTATTAGAGGCTGGGAAGGG - Intergenic
1107480717 13:40783775-40783797 TGGTTATTAGAGGCTGGGAAAGG + Intergenic
1108034546 13:46274999-46275021 TGGTTATTAGAGGCTGGGAAGGG - Intronic
1109878806 13:68443606-68443628 GAGTTCTTAGCTGCAGTGAGTGG + Intergenic
1111297921 13:86307536-86307558 GGGATCTTAGAGACTTTGATGGG + Intergenic
1115114386 14:29862034-29862056 GGGTTACTAGAGGCTGGGAAGGG - Intronic
1115171304 14:30510625-30510647 TGGTTATTAGAGGCTGGGAAGGG + Intergenic
1117043485 14:51789259-51789281 AGGTTACTAGAGGCTGGGAGGGG - Intergenic
1117551738 14:56843770-56843792 GGGTGCTTTGAGGTGGTGAGGGG + Intergenic
1123758163 15:23413090-23413112 GGGTTTCCAGAGGCTGTCAGGGG + Intergenic
1124145937 15:27125328-27125350 AGGTTATTAGAGGCTGAGAAGGG + Intronic
1124149441 15:27163905-27163927 GGGCTGTGAGAGCCTGTGAGGGG + Intronic
1125586147 15:40821599-40821621 GGAATCTCAGAGGGTGTGAGTGG + Intronic
1125896106 15:43302947-43302969 TGGTGCTTAGAGGCTGGGAAGGG + Intergenic
1126197209 15:45945376-45945398 TGGTTATTAGAGGCTGGGAAGGG + Intergenic
1127916014 15:63455762-63455784 GGGTTTTTAGGGGCTGGGGGTGG - Intergenic
1128769210 15:70269189-70269211 GTGTTCCCAGAGGCTGTGAAAGG + Intergenic
1129386016 15:75196432-75196454 GGGTCCTAAGAGGCTGAGACGGG + Intronic
1130174319 15:81552217-81552239 TGGTTATTAGAGGATGAGAGAGG + Intergenic
1130486169 15:84399407-84399429 GGGTACTTTGGGGCTGTGGGGGG + Intergenic
1131260667 15:90885892-90885914 GGGTTCTGAGAGTCAGGGAGAGG + Intronic
1131831429 15:96357142-96357164 GGGTTCCTAAAGCCTCTGAGCGG + Intergenic
1132527569 16:425396-425418 GGGTGCTCCGAGGCTGCGAGTGG - Intergenic
1134458179 16:14409804-14409826 GGGTTTCCAGAGGCTGTCAGGGG - Intergenic
1134610599 16:15605325-15605347 GGATTCTGAGAGGCAGAGAGAGG + Intronic
1134787362 16:16956664-16956686 GGGATTTTAGGGGATGTGAGTGG + Intergenic
1134845356 16:17435388-17435410 GGGTTCTTGTAGGGGGTGAGGGG - Intronic
1135324588 16:21518424-21518446 GGTTTCTCTGAGGCTCTGAGCGG - Intergenic
1136336075 16:29611694-29611716 GGTTTCTCTGAGGCTCTGAGCGG - Intergenic
1136340774 16:29641642-29641664 GAGTTCTTAAAGGCTGAGACAGG + Intergenic
1136409144 16:30066223-30066245 GGATCCTAAGAGGCAGTGAGGGG + Intronic
1139717101 16:68822455-68822477 GGGTGGCTAGAGGCTGGGAGAGG - Intronic
1141427431 16:83953234-83953256 GGGATCCAAGAGGCTCTGAGAGG - Intronic
1142358318 16:89614344-89614366 GAGTTCTCAGAGGCTGTGTGAGG + Intronic
1142762371 17:2050104-2050126 GGGTCCCTAGGGGCTGCGAGGGG - Intergenic
1144176915 17:12716442-12716464 GGGCTGTTACAGGCTGTGGGAGG - Intronic
1144762609 17:17715816-17715838 GTGAACTTGGAGGCTGTGAGAGG + Intronic
1144834418 17:18149412-18149434 GGAGCCTTAGAGGCTGTGTGGGG + Intronic
1145737550 17:27243631-27243653 TGGCTCTGAGTGGCTGTGAGTGG - Intergenic
1145976817 17:28988644-28988666 GGGTGGTGAGAGGCTGTGATGGG - Intronic
1146302673 17:31702262-31702284 TGGTTATCAGAGGCTGGGAGTGG - Intergenic
1147388439 17:40095343-40095365 GGGTTCCTGGAGGCTGAGTGTGG - Intronic
1148444430 17:47728897-47728919 AGAGCCTTAGAGGCTGTGAGAGG - Intergenic
1148701014 17:49586973-49586995 GGCTTTTCAGAGGCTGTGAATGG - Intergenic
1149147045 17:53506562-53506584 TGGTTATTAGAGGCTGGGAAGGG - Intergenic
1149407860 17:56372974-56372996 GGGCTCTGAGAGGCTGTCAAAGG + Intronic
1149643258 17:58218978-58219000 GGGTTCTTAGAGGCTGTGAGTGG + Intronic
1151426242 17:74032764-74032786 GTGTTGTTAGAGGCTGGGGGAGG - Intergenic
1151499123 17:74477705-74477727 TGGTGGTTACAGGCTGTGAGAGG + Intronic
1152045408 17:77931721-77931743 GGGTGCTGAGAGGCTTTGAAGGG + Intergenic
1152334701 17:79694016-79694038 GGTTTCTTAGGGGCTATGAGGGG + Intergenic
1155287752 18:24308607-24308629 AGGCTCTTAGAGGCTCTGGGTGG - Intronic
1155295456 18:24380659-24380681 GAGCTCTTACAGGCTGGGAGCGG + Intronic
1155342868 18:24830597-24830619 GGGGGCTTGGAGGCTGTGAGAGG - Intergenic
1155756396 18:29502449-29502471 GTGTTCTCAGAGGGTGGGAGAGG - Intergenic
1156513215 18:37659069-37659091 GGGTGATGAGAGGCTTTGAGAGG + Intergenic
1157526168 18:48384219-48384241 GCCTTGTTAGAGGCTGTGGGTGG - Intronic
1157559407 18:48636085-48636107 GAGTTCTCAGGGGATGTGAGTGG + Intronic
1159525259 18:69580842-69580864 TGGTTATTAGAGGCTGGGAAGGG - Intronic
1161843684 19:6697609-6697631 GGCTTCTTGGAGGCTGCCAGGGG - Intronic
1162395917 19:10418028-10418050 GGGTTCCTAGAGCCTGCGAAGGG - Intronic
1164847682 19:31448479-31448501 GGGTTCCTGCAGGCTGTGAAGGG + Intergenic
1165436323 19:35797355-35797377 AGGATCTGAGAGGCGGTGAGAGG + Intergenic
1165812158 19:38618091-38618113 GGGCTCTGAGAGCCTCTGAGGGG + Intronic
1167038060 19:47005806-47005828 GGGATCTTAGAAGCAGTCAGGGG - Intergenic
1168488188 19:56783022-56783044 TGGTTCTCAGAGGCTGGGAAGGG - Intronic
1168682747 19:58327709-58327731 GGGTTGTGAGATACTGTGAGAGG + Intronic
925957596 2:8982886-8982908 GGTTGCTTAGAGTCTCTGAGGGG - Intronic
925966511 2:9071804-9071826 GGATTCTTTGAGGCTGGGAAGGG - Intergenic
928125932 2:28616052-28616074 TGGTTATTAGAGGCTGGGAAGGG + Intronic
930055049 2:47245479-47245501 GAGTTCTCAGAGGCAGGGAGAGG + Intergenic
931141525 2:59463616-59463638 GGGCTGAGAGAGGCTGTGAGGGG + Intergenic
934088932 2:88534221-88534243 TGGTTATTAGAGGCTGGGAAGGG - Intergenic
937144763 2:119634797-119634819 TGGTTATCAGAGGCTGAGAGAGG + Intronic
937661290 2:124432438-124432460 GGTTTCTTAGAGAAAGTGAGTGG - Intronic
938571273 2:132564027-132564049 GGGCTGTTAGAGGCTGTGGGAGG - Intronic
938754457 2:134367023-134367045 GGGCTCTGAGAGGAGGTGAGAGG + Intronic
939289873 2:140180294-140180316 GGCCTCTAAGAGGCTGTGAGAGG - Intergenic
939942181 2:148363521-148363543 AGGTTCTCAGAGGCTGCGTGTGG - Intronic
940810081 2:158232844-158232866 TGGTTATTAGAGGCTGGGAAGGG + Intronic
941957648 2:171220807-171220829 GGGTTTTTAGGGGGTGAGAGGGG - Intronic
942217515 2:173736787-173736809 AGGTTATTAGAGGCTGGGCGTGG + Intergenic
946153224 2:217789944-217789966 GGGTTATTAGAGGCTGGGGAGGG + Intergenic
946211826 2:218153391-218153413 GGGTGCTTCAAGTCTGTGAGGGG - Intergenic
946447542 2:219752342-219752364 TGGTTATTAGAGGCTGGGAAGGG - Intergenic
947357453 2:229311739-229311761 GGGTTCTGAGAGGCAGAGGGAGG + Intergenic
948834731 2:240620511-240620533 GGGTCCTGAGAGGGTCTGAGGGG - Intronic
948881945 2:240863336-240863358 GGGGTGTTATGGGCTGTGAGAGG - Intergenic
1168937073 20:1674650-1674672 GGGTTCTGTGAGGATGGGAGAGG - Intergenic
1170438651 20:16355501-16355523 GTGTTCTTGGAGGCTGTAGGTGG - Intronic
1172165833 20:32898598-32898620 GGTTTCTTAGAGGCTTTGGCTGG - Exonic
1173043683 20:39489644-39489666 GGGTTTTTGGAGGCTGAGAGTGG + Intergenic
1173540386 20:43846813-43846835 GGCTTCTTAGAGGCTGGGAATGG - Intergenic
1174606341 20:51764654-51764676 GTGGTCTTGGAGGTTGTGAGAGG - Intronic
1176976072 21:15323690-15323712 GGGTTCTTGGAGTCTGAGAAAGG + Intergenic
1180929208 22:19577545-19577567 TGGTTGTGAGAGGCTGGGAGAGG - Intergenic
1180938054 22:19638766-19638788 AGGTTCACAGAGGCAGTGAGTGG + Intergenic
1182715969 22:32356460-32356482 GGGTTCTTAGTGTGTGTAAGGGG - Intronic
1183202055 22:36392130-36392152 AGGTTCTTAGAGGCTGGAAAAGG - Intergenic
1184535371 22:45083021-45083043 GGCTTCTTGGAGGCGGTGATGGG - Intergenic
1184765362 22:46569378-46569400 GAGTGCTGAGAGGCTGTGGGAGG + Intergenic
1184920142 22:47600409-47600431 GGGTGCGCAGAGGCTGAGAGGGG - Intergenic
1184920199 22:47600607-47600629 GGGATGTCAGAGGCTGGGAGGGG - Intergenic
1184920297 22:47600950-47600972 GGGTGCGCAGAGGCTGAGAGGGG - Intergenic
1184920338 22:47601106-47601128 GGGTACACAGAGGCTGGGAGGGG - Intergenic
1185099018 22:48827785-48827807 GTGTTCTTAGAGGCACTCAGAGG - Intronic
950404794 3:12797514-12797536 TGGTTCTGTGATGCTGTGAGAGG - Intronic
953646375 3:44759635-44759657 GGTTTTTGAGAGGCTTTGAGAGG + Intronic
953885234 3:46711310-46711332 GGGGTCTTAGGAGCAGTGAGGGG + Intergenic
954137433 3:48588485-48588507 GGGGTCTGAGAGGCTGGGCGGGG - Intronic
954409595 3:50364660-50364682 GGGTGCTCAGAGGCGGCGAGAGG + Exonic
954614897 3:51964513-51964535 GGGTGCTGAGAGGATGTGGGGGG - Intronic
955033832 3:55247090-55247112 GGGTTATTAGAGACAGTGACAGG + Intergenic
955041679 3:55323633-55323655 CGGTTCTGAGAGGCTGCGTGAGG - Intergenic
955074751 3:55602937-55602959 GGGTTCTCAGAGGGTGGGACAGG + Intronic
955449376 3:59050427-59050449 GGGTTCGTTGAGGCAGTAAGAGG + Intergenic
956619971 3:71212031-71212053 TGTTTCTCAGAGGCTCTGAGTGG + Intronic
956829929 3:73036227-73036249 GGGTTATCAGAGGCTGAGAAGGG + Intronic
957369710 3:79277455-79277477 TGGTTTTCAGAGGCTGTGAAGGG + Intronic
960714313 3:120560213-120560235 AGGTTCTTTCAGGCTGGGAGTGG + Intergenic
961398838 3:126619538-126619560 TGGTTATTAGAGGCTGGGAAGGG + Intronic
963188559 3:142444065-142444087 TGGTTCCTAGAGGCTGGGAAGGG + Intronic
963443963 3:145378300-145378322 GGATTGTTAGAGGCTGTTATGGG + Intergenic
963836029 3:150058824-150058846 GGCTTCTTAAAGACTCTGAGAGG + Intergenic
965231517 3:166060179-166060201 GGGTTGATAAAGGCTGGGAGTGG + Intergenic
965348858 3:167588110-167588132 TGGTTATTAGAGGCTGGGAAGGG - Intronic
967098585 3:186197283-186197305 GGGTTCTGATGGGCTGAGAGGGG + Intronic
967441913 3:189518035-189518057 GTGTTGTTAGAAGCTGTGATGGG - Intergenic
967849011 3:194068495-194068517 TGGTTATTAGAGGCTGGGAAGGG + Intergenic
968092049 3:195904512-195904534 TGGTTCTCAGGGGCTGAGAGAGG + Intronic
968554102 4:1238657-1238679 AGGGTCTTGGAGGGTGTGAGAGG - Intronic
970161171 4:13190680-13190702 CTGTTCTTAGAGGCTCAGAGAGG - Intergenic
972043379 4:34632844-34632866 TGGTTATCAGAGGCTGAGAGGGG + Intergenic
972763887 4:42133529-42133551 GAGATCATAGAGGCTGGGAGAGG - Intronic
972789200 4:42354526-42354548 GGGTGCTCAGAGGCTGGGAAAGG + Intergenic
973865202 4:55105928-55105950 GGGTACTTACAGTCTGTGCGGGG + Exonic
977325124 4:95565197-95565219 TGGTTATTAGAGGCTGGGAAGGG - Intergenic
978020040 4:103797435-103797457 GGGTTATGAGAGGCTGGGAAGGG - Intergenic
978037819 4:104017988-104018010 TGGTTATTAGAGGCTGCGAAGGG + Intergenic
978644648 4:110915539-110915561 TAGTTCCTGGAGGCTGTGAGTGG + Intergenic
979411175 4:120381666-120381688 TGGTTATCAGAGGCTGGGAGTGG + Intergenic
979946380 4:126837200-126837222 TGGTTATTAGAGGCTGAGAAGGG + Intergenic
979946384 4:126837237-126837259 TGGTTATTAGAGGCTGAGAAGGG + Intergenic
980420507 4:132553572-132553594 TGGGTATTAGAGGCTGGGAGGGG - Intergenic
981140714 4:141265615-141265637 TGGTTACTAGAGGCTGTGAGGGG + Intergenic
982997131 4:162363684-162363706 TGGATTTTAGAGGATGTGAGAGG - Intergenic
983520003 4:168698203-168698225 GGGTATTGAGAGGCTGTGGGGGG + Intronic
985141116 4:186841068-186841090 GGGTTCCTCGGGGCAGTGAGGGG - Intergenic
985384647 4:189432994-189433016 GGTTACTTAGAGTCTGTGTGGGG + Intergenic
986263995 5:6176811-6176833 GGGTTCTTAAAGGTTGAGGGAGG - Intergenic
988085956 5:26476030-26476052 AGGTTTTGAAAGGCTGTGAGGGG + Intergenic
988332539 5:29860825-29860847 GGGTTCTTGGAGGCAGTTAACGG + Intergenic
992337675 5:75789539-75789561 TGGTTATTAGAGGCTGGGAATGG + Intergenic
994331942 5:98516530-98516552 TGGTTATTAGAGGCTGGGAAGGG - Intergenic
995116841 5:108490753-108490775 TGGTTATTAGAGGCTGAGAGGGG + Intergenic
995535646 5:113133299-113133321 TGGTTATTAGAGGCTGGGAAGGG - Intronic
997790500 5:136755345-136755367 GGTTTCTAAGAGGCTCTGTGGGG - Intergenic
998466561 5:142349280-142349302 TGGTTCTTAGAAGCTGGGAAGGG + Intergenic
998560296 5:143165283-143165305 GGGTTTTTGGAGGCTGGGTGGGG + Intronic
999255845 5:150209700-150209722 GGATTCTGAGAGGCTATGGGGGG + Exonic
1001589665 5:172856712-172856734 TGGTTCCCAAAGGCTGTGAGGGG + Intronic
1002255854 5:177958341-177958363 GGAGACTTAGGGGCTGTGAGGGG - Intergenic
1002838672 6:887162-887184 GGGTTGCCAGGGGCTGTGAGGGG - Intergenic
1002928107 6:1616696-1616718 GTGTTCTCTGAGGCTGTTAGTGG + Intergenic
1003091534 6:3107858-3107880 GGGTTCTGAGATGCTTTCAGTGG + Intronic
1003331044 6:5129041-5129063 GAGGGCTTAGAGGCTGCGAGCGG + Intronic
1004368079 6:15028897-15028919 GGGTTCCTAGATGCTGGGAGAGG - Intergenic
1006925534 6:37652328-37652350 GCGTTCTTCATGGCTGTGAGTGG + Exonic
1007706410 6:43793971-43793993 GGGTTCCTAGGGGCTGGGTGAGG + Intergenic
1009760673 6:68001367-68001389 GGGTTGTCAGAGGCTGGGAAGGG - Intergenic
1014172313 6:118292170-118292192 GGGTGCTTAGAATCAGTGAGAGG - Intronic
1014644147 6:123953500-123953522 GTGTTGTTAGTGGCTGTGATGGG + Intronic
1014821931 6:125999117-125999139 GGGTGATTGGAAGCTGTGAGTGG + Intronic
1015675892 6:135748200-135748222 TGGTTATCAGAGGCTGAGAGTGG - Intergenic
1016426895 6:143944657-143944679 GGGTTTTTAGAGCATGTTAGAGG + Intronic
1017186386 6:151605055-151605077 TGGTTATTAGAGGCTGGGAAGGG - Intronic
1021180839 7:17503943-17503965 GGTTTCTTAGTGACTGTGGGAGG + Intergenic
1021376290 7:19911394-19911416 TGGTTCCTAGAGGCTGGGAAGGG + Intergenic
1024137562 7:46426178-46426200 GTGTTGGTAGAGGCTGTGTGGGG + Intergenic
1024183469 7:46922741-46922763 TGGTTATCAGAGGCTGGGAGTGG - Intergenic
1024491626 7:49992086-49992108 GGATTCTTAGAGGGTGGTAGAGG + Intronic
1025599856 7:62982825-62982847 GTTTTCTTAGAGCCTGTGAAGGG + Intergenic
1026993268 7:74599911-74599933 GGGCTCTTTAAGGCTGTGAGGGG - Intronic
1028802821 7:94986469-94986491 TGGTTATTAGAGGCTAGGAGAGG + Intronic
1030488226 7:110198705-110198727 GGGTTATCAGAGGCTGGGAAGGG - Intergenic
1030896911 7:115072020-115072042 TGGTTATTAGAGGCTGGGAAGGG + Intergenic
1031156746 7:118119742-118119764 GCGTTCTTAGAGGCTGGGAAGGG - Intergenic
1031355606 7:120783116-120783138 GGGATGTTAGAGGCAATGAGTGG + Intergenic
1031538839 7:122968033-122968055 TGGTTATTAGAGGCTGGGAAAGG + Intergenic
1032277478 7:130472069-130472091 GGGATATTAGAGGCTGGGAAGGG + Intergenic
1032595147 7:133232549-133232571 GGGTTCTGAGGGGGTGTTAGGGG - Intergenic
1032864136 7:135909161-135909183 GTGTTTTGAGAGGCAGTGAGAGG + Intergenic
1032891003 7:136194605-136194627 GTGTTATTAGAGGCTGGGAAGGG - Intergenic
1033639214 7:143244895-143244917 GGTTTCTTAGGGGGTGGGAGTGG + Intronic
1036787800 8:11699425-11699447 AGGTTCTTTGAGTCTGTAAGGGG - Intronic
1038310723 8:26444340-26444362 GGGTTCTGAGAGAATCTGAGGGG + Intronic
1038456487 8:27675087-27675109 GGGTTTTTAGAGGCACTCAGAGG - Intronic
1038515716 8:28186159-28186181 GGGTTGTCAGGGGCTGGGAGAGG + Intronic
1038897238 8:31798012-31798034 TGGTTATTAGAGGCTGTGAGGGG + Intronic
1039687989 8:39827711-39827733 TGGTTTTTAGGGGCTGAGAGTGG + Intronic
1043657260 8:82684390-82684412 GAATTGTTAGAGGCTATGAGTGG - Intergenic
1044359509 8:91265050-91265072 TGGTTAGTAGAGGCTGTGAAGGG - Intronic
1046872442 8:119218501-119218523 GTGTTCTGAGAGGCTGGGAGGGG - Intronic
1047048496 8:121082120-121082142 TAGTTATTAGAGGCTGTGAAGGG - Intergenic
1047181627 8:122594124-122594146 GGCTTCTTAGATGCTGTAGGTGG - Intergenic
1047653286 8:126947846-126947868 GGGTGCATAGAGGTTGTGAGAGG + Intergenic
1047724194 8:127670190-127670212 GGGATCTTAAAGGCTGTGAGAGG - Intergenic
1048316752 8:133368654-133368676 GGGGTCTTAGGGGCTATGAAAGG + Intergenic
1049441148 8:142610337-142610359 GGATTCCAAGAGGCTGTGGGAGG - Intergenic
1049485415 8:142856330-142856352 GGATTCTTTGAGACTGTGATAGG + Intronic
1050747586 9:8894523-8894545 GGGTGCTTAGAAACTGTAAGTGG + Intronic
1050956682 9:11670357-11670379 GGTTACTTAGAGGCTGGGAATGG - Intergenic
1052573445 9:30260134-30260156 TGGTTATCAGATGCTGTGAGGGG - Intergenic
1053396130 9:37776075-37776097 TGGTTCTAAGTGGCAGTGAGTGG + Intronic
1057612505 9:96558130-96558152 GGGTTATCAGAGGCTGGGAAGGG + Intronic
1058016359 9:100036834-100036856 TGGTTATTAGAGGGTGGGAGGGG + Intronic
1058193995 9:101952170-101952192 GGGGACTAAGAGGCTCTGAGGGG - Intergenic
1059086717 9:111310904-111310926 TGGTTACTAGAGGCTGAGAGGGG - Intergenic
1059349853 9:113656857-113656879 GGCTTCTTGGAGGAGGTGAGGGG + Intergenic
1059538278 9:115104598-115104620 GGGTTGTTTGAGGCAGTGAATGG + Intronic
1059999215 9:119943289-119943311 GGGTTTTTCAAGGCTGTGAAGGG + Intergenic
1061115879 9:128611626-128611648 GGGTTCTCAGAGGCAGGGAGTGG - Intronic
1061134969 9:128728560-128728582 GGCTTCACAGAGGCTGTGGGAGG + Intergenic
1062605769 9:137348282-137348304 TGGCTCTCTGAGGCTGTGAGGGG - Intronic
1062606171 9:137349788-137349810 GGGCTCTCTGAGGCTGTGAGGGG - Intronic
1185943575 X:4348792-4348814 TGGTTATTAGAGGCTGGGAAGGG - Intergenic
1186096715 X:6110345-6110367 GGGTACTTACTGTCTGTGAGTGG - Intronic
1187192710 X:17051017-17051039 AGGTTACCAGAGGCTGTGAGGGG - Intronic
1188210964 X:27422827-27422849 TGGTTATTAGAGGCTGGGAAGGG + Intergenic
1188469679 X:30524017-30524039 TGGTTATTAGAGGCTGGGAAGGG - Intergenic
1190479845 X:50865297-50865319 GTGTTCTTTCAGGCTATGAGAGG - Intergenic
1190902999 X:54697057-54697079 TGATTATTAGAGGCTGGGAGGGG - Intergenic
1191681491 X:63844962-63844984 CGGTTATTAGAGGCTGGGGGAGG + Intergenic
1192330583 X:70172404-70172426 GGGTTGTTAGAGGCCAGGAGTGG + Intergenic
1193178635 X:78426316-78426338 TGGTTCTCAGAGGCTGGGAAGGG + Intergenic
1193811911 X:86061767-86061789 TGGTTATTAGAGGCTGGGAAGGG + Intergenic
1194511163 X:94796517-94796539 TGGTTATTAGAGGCTGAGAAAGG - Intergenic
1196798627 X:119522670-119522692 GGGGTCCGGGAGGCTGTGAGTGG + Intergenic
1197254982 X:124253257-124253279 GGAGGCTTAGAGACTGTGAGAGG - Intronic
1199694932 X:150337173-150337195 GGGGCCTCAGAGCCTGTGAGAGG - Intergenic
1200275308 X:154726726-154726748 AGGTACTGAGAGGCTGGGAGAGG - Intronic
1200985280 Y:9296909-9296931 GAGTTCCTCGGGGCTGTGAGAGG - Intergenic
1201419711 Y:13785019-13785041 GGGTTCTTAGAAGTTCTTAGTGG + Intergenic