ID: 1149643398

View in Genome Browser
Species Human (GRCh38)
Location 17:58219888-58219910
Sequence AAGCCAGTGCAGTAACAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149643398 Original CRISPR AAGCCAGTGCAGTAACAAAG TGG (reversed) Intronic
900675386 1:3881989-3882011 AAGACTGTGCAGTAACAAGTGGG - Intronic
900852815 1:5157414-5157436 AAGCCAGGGCAGTCACATGGGGG + Intergenic
905360102 1:37413219-37413241 AAGGCAGTCCAGTACCCAAGAGG + Intergenic
905432160 1:37932050-37932072 AAGCCTGTGCAGGAACAAATGGG + Exonic
907217456 1:52877152-52877174 AAGCCAGCCCAGTAAGAAATGGG - Intronic
907556318 1:55347405-55347427 AAGCCAGTGCTCTAGGAAAGAGG - Intergenic
907976511 1:59436185-59436207 AAGTCAGTGCAGATAGAAAGGGG - Intronic
908569724 1:65396480-65396502 CAGCCAGTGCAACAGCAAAGAGG - Intronic
909029661 1:70524301-70524323 AAGCCAGAACTGTAAGAAAGTGG - Intergenic
909789430 1:79655953-79655975 TGGCCAGTGTAGTAAGAAAGTGG + Intergenic
912095075 1:106129744-106129766 AAGCCATGGCAGTAGGAAAGAGG - Intergenic
915125647 1:153661754-153661776 AAGCCAGTGCAATAAAAAAGTGG - Exonic
918544043 1:185662040-185662062 AAGCTAGTGCTGAAACAAAATGG + Intergenic
920972547 1:210755044-210755066 AAGCTCATGCAGTGACAAAGGGG + Intronic
923215382 1:231843968-231843990 AAGCCAGTGCAGAGACAAGATGG + Intronic
1068754032 10:60630696-60630718 AAGACACTGCAGTAGGAAAGAGG + Intronic
1069906673 10:71736212-71736234 AAGCCAGGGCAGAACAAAAGGGG - Intronic
1070303219 10:75220465-75220487 AAGTTAGTGCAACAACAAAGAGG - Intronic
1070838592 10:79467747-79467769 AAGGCAGTGAAGACACAAAGGGG + Intergenic
1074799249 10:116982552-116982574 AAGCCAGTTCTGAAACAAAAAGG - Intronic
1078251513 11:9620391-9620413 AAGCTATTGCAGTTACAAAATGG - Intergenic
1079503773 11:21132101-21132123 GAGCCAAGGCAGTAACATAGAGG + Intronic
1079866575 11:25743047-25743069 AAGCCAGTGCTATACCAAAAGGG - Intergenic
1080866628 11:36200988-36201010 AACAGAGTGCAGTAACAGAGGGG + Intronic
1081709526 11:45207998-45208020 AAGCCAGAGCAGGAGCCAAGTGG + Intronic
1084191887 11:67503270-67503292 AAGCCAGTGCAGCCCCAAGGTGG + Intronic
1088368295 11:109061669-109061691 AAGCCATTGCAGTAATCCAGGGG - Intergenic
1096290849 12:50341891-50341913 AAGCCAGTGTAATATCATAGGGG + Intronic
1096423328 12:51479214-51479236 CAGCAACTTCAGTAACAAAGTGG - Intronic
1096978179 12:55712288-55712310 AAGCCAGTGCTCAAAGAAAGGGG - Intronic
1097378253 12:58863051-58863073 AAGCCAGAGAGGTAACACAGGGG - Intergenic
1098601380 12:72335277-72335299 AAGCCTTTGCAGTAATAATGGGG - Intronic
1101150312 12:101877525-101877547 AAACGAGTGAAGTCACAAAGCGG - Exonic
1101653435 12:106697778-106697800 TAGCCAGTGCAATAAGACAGGGG - Intronic
1102748304 12:115269395-115269417 AAGACAGTGCATAAACAAATAGG - Intergenic
1109558393 13:64012919-64012941 AAGCCACCTCAGTAGCAAAGAGG - Intergenic
1110186959 13:72686202-72686224 ATGTCAGTGCAGATACAAAGAGG - Intergenic
1111036499 13:82681657-82681679 GAGCGAGTGCAGGAACACAGGGG + Intergenic
1111244663 13:85520263-85520285 AACACAGAGCAGTAACAGAGAGG + Intergenic
1111860409 13:93697395-93697417 AAAGCAGAGTAGTAACAAAGAGG - Intronic
1113531898 13:111033197-111033219 AAGCCAAGGCAGAAACAAGGGGG + Intergenic
1114308364 14:21443470-21443492 AAGACAGTGCAGTGTCACAGAGG + Intronic
1116030743 14:39568133-39568155 ATGCCAGTGGAGTAACCATGAGG + Intergenic
1116085050 14:40225421-40225443 AAAGTAGTGCAGTAACAAATAGG - Intergenic
1116206424 14:41873068-41873090 AAGCAAGAACAATAACAAAGTGG - Intronic
1116512272 14:45760877-45760899 TAACCAGTGCAGTAAGACAGAGG - Intergenic
1117498230 14:56326964-56326986 AAGGCAGTGCAGGAAGGAAGGGG - Intergenic
1117823218 14:59673188-59673210 AAGCAAGAGCTGTAACACAGTGG - Intronic
1121127495 14:91417587-91417609 AAGCCGGTGCACCAACAAAGGGG + Intronic
1122201195 14:100123743-100123765 AAGCCAGACCAGGAAGAAAGAGG + Intronic
1122832222 14:104404147-104404169 AAGCCAGAGGAGTAAGTAAGAGG + Intergenic
1124018361 15:25897802-25897824 AAGGCTGTTCAGTAGCAAAGAGG - Intergenic
1126744295 15:51810460-51810482 AAGCCACTGTAGTAACAAGAAGG - Exonic
1127485069 15:59411341-59411363 AATCCATAGCAGAAACAAAGAGG + Intronic
1129966183 15:79737863-79737885 AAGTCAGTGGAGAAGCAAAGAGG + Intergenic
1130038795 15:80386350-80386372 AATCCAGTGCTTTAACAATGGGG - Intronic
1133112624 16:3557645-3557667 GAACCAGATCAGTAACAAAGGGG - Exonic
1133857768 16:9565665-9565687 AAGCCAGTGTAGGAAATAAGCGG - Intergenic
1135804776 16:25532991-25533013 AAGGCAGTGCATTAAGAAATGGG - Intergenic
1138202764 16:55102238-55102260 AATCCAATGCAGAAAAAAAGAGG - Intergenic
1138703123 16:58886078-58886100 AGTCCAGTGCAGTAAGAAACTGG + Intergenic
1143225224 17:5296234-5296256 AACCCAATGCAGTACCAAAATGG - Intronic
1149643398 17:58219888-58219910 AAGCCAGTGCAGTAACAAAGTGG - Intronic
1152333714 17:79688018-79688040 GTGTCAGTGCAGTATCAAAGAGG + Intergenic
1155807448 18:30189939-30189961 AATCCAATGCAGTAATAGAGGGG - Intergenic
1160584489 18:79904791-79904813 AAGCCAGGGCATGAACACAGCGG - Intronic
1164821475 19:31254506-31254528 AAGCCAGTGCACTCTCAGAGAGG - Intergenic
1168554285 19:57325241-57325263 ATGACAGTGCAGTGAAAAAGGGG - Intronic
926613020 2:14966267-14966289 AAACTAGTGCAATAACTAAGAGG + Intergenic
927319812 2:21730039-21730061 AAGCCACTGCAATAACGAATGGG + Intergenic
928236338 2:29544752-29544774 AGACCAGTGCAGTAACTCAGAGG - Intronic
930918075 2:56718948-56718970 AAGACAGTGCAGTATAGAAGGGG - Intergenic
931285287 2:60827091-60827113 ACTCCAGTGCAGTCACATAGTGG - Intergenic
932283438 2:70513818-70513840 AGGCTAGTGCAGTAACAGATGGG + Intronic
936267623 2:111022653-111022675 CAGCCAGTGCAGTCACAGAGAGG + Intronic
936402371 2:112175229-112175251 AATTCAGTGCAGTTATAAAGGGG - Intronic
939468883 2:142594015-142594037 AAGAGAGTGCAGGAGCAAAGAGG - Intergenic
940891805 2:159042598-159042620 AAGCCAGTGCTGCAACTCAGAGG + Intronic
942165026 2:173233252-173233274 AAGCCAATGCAGTAACCTAAAGG + Intronic
942305656 2:174605087-174605109 AAGCCAATGCAGTAAGAGCGAGG + Intronic
945686763 2:212980520-212980542 AAATCAGAGCAGTAAGAAAGTGG - Intergenic
1169529547 20:6469733-6469755 AGGCAAGTGCCGTATCAAAGAGG + Intergenic
1173777948 20:45727013-45727035 AAGTCAGAGAAGTAAAAAAGAGG + Intergenic
1177278938 21:18952562-18952584 AGGGCAGTGCAGTAACTCAGTGG + Intergenic
1178220322 21:30650182-30650204 AAGACAGTGAAGAAACAAACAGG + Intergenic
1178262625 21:31114079-31114101 AAGCCATTTCTGTGACAAAGTGG + Intergenic
1181058781 22:20272213-20272235 AAGCCACAGCAGCAGCAAAGGGG + Intronic
1181909699 22:26228839-26228861 AGGCGAGCACAGTAACAAAGAGG - Intronic
949675380 3:6447553-6447575 AAGCCAGTGCAGGAACCAGCTGG + Intergenic
957935909 3:86942308-86942330 GAGCCATTGCAGTTACAAAGGGG - Exonic
960882325 3:122357418-122357440 AAGTAAGTGCAGTAATAAAAAGG - Intergenic
962901515 3:139765899-139765921 GAACCAGGGCAGTAGCAAAGAGG - Intergenic
965636614 3:170788488-170788510 ATGCTAATACAGTAACAAAGAGG + Intronic
969833607 4:9819253-9819275 CAGCCAGTGGAGTAGCAGAGTGG - Intronic
969921506 4:10544765-10544787 AAGTAAGTCCAGGAACAAAGAGG + Intronic
970132309 4:12885239-12885261 CAGCCAGTGCTGTCAGAAAGTGG + Intergenic
970651977 4:18188869-18188891 AAGGCAGTGCTGTAAGAAGGAGG - Intergenic
971902208 4:32675797-32675819 AAGATAGAGCAGTAACAAATTGG + Intergenic
972231350 4:37075905-37075927 AAGCCACTGCAGTGACACAGAGG + Intergenic
976931287 4:90569966-90569988 TAGCCAGTGCAATAACTGAGGGG + Intronic
977777904 4:100943832-100943854 AAGCAAATGCAGTCACAGAGAGG - Intergenic
978986471 4:115019637-115019659 AAACCAGGGCACTAACACAGTGG - Intronic
979826176 4:125235287-125235309 AAGACACTGCAGTAAAAAGGAGG - Intergenic
981884075 4:149651616-149651638 AAACTACTGCAGTAACAAAATGG + Intergenic
982510248 4:156273713-156273735 AAACCAGTGCGGGATCAAAGTGG - Intergenic
983115016 4:163804301-163804323 AAGCCAGTGCTGTAGGAAATTGG - Intronic
983890566 4:173025519-173025541 AAGCCATTGCAATAACCCAGGGG - Intronic
987947417 5:24629701-24629723 GAGCCTGTGAAGGAACAAAGAGG - Intronic
988699826 5:33662378-33662400 AAACCAATGCAATATCAAAGAGG + Intronic
991666000 5:69000528-69000550 AAGGCAGTGCATTAACATAAAGG + Intergenic
992330928 5:75716943-75716965 AAGCCATTGCAGTAAGCAAAAGG + Intronic
994449783 5:99928275-99928297 AAGAAAGTACATTAACAAAGAGG + Intergenic
998150959 5:139757209-139757231 AAGCCAGTGGAGTCACAGAGTGG + Intergenic
998969403 5:147574985-147575007 AAGACAGAGCAGTGAAAAAGAGG + Intergenic
999910332 5:156190731-156190753 AAGCCAGAGCAGGAAAAAGGTGG + Intronic
1000111977 5:158116868-158116890 AGGACAGTGCAGTAAAAAAAGGG + Intergenic
1000706133 5:164514449-164514471 AAAACTGTGAAGTAACAAAGAGG - Intergenic
1001443186 5:171761940-171761962 GAATCAGTGCAGTGACAAAGGGG + Intergenic
1003233035 6:4271917-4271939 AACTCAGTGCAGAAACAAGGTGG - Intergenic
1006513123 6:34532311-34532333 AACCCAGTGCAGTAATCAGGAGG + Intronic
1007093239 6:39197447-39197469 AAGGCTGTGCAGCATCAAAGTGG + Intronic
1007263560 6:40580736-40580758 AAGCCAGTGCAGTGGAAAAAGGG + Intronic
1008346896 6:50438673-50438695 AAGCCAGCAGAGTAAAAAAGTGG + Intergenic
1010198735 6:73264430-73264452 AAGCCAGTACAGGAACAAGGAGG + Intronic
1010921402 6:81686151-81686173 GGGCCAGGGCAGTAACAATGAGG - Intronic
1010953940 6:82069284-82069306 AAGCCAGTGTAGTTTCAAAAAGG + Intergenic
1013031561 6:106338626-106338648 AAGCCAGGGCTGTAACCAAGGGG + Intergenic
1015147836 6:130006907-130006929 AACCCTATGCAGTAGCAAAGTGG - Intergenic
1015385368 6:132616869-132616891 AAGCCAGAGATGGAACAAAGAGG - Intergenic
1016989385 6:149918826-149918848 AAGCAAGTGCAGTGAGGAAGAGG + Intronic
1016998641 6:149979266-149979288 AAGCAAGTGCAGTGAGGAAGAGG - Intergenic
1017011250 6:150065161-150065183 AAGCAAGTGCAGTGAGGAAGAGG + Intronic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1019008055 6:168819884-168819906 AAGCCAGTGAAGTTACCAACTGG + Intergenic
1019077528 6:169400097-169400119 AAGCCAGTGAAGTTACCAACTGG - Intergenic
1020366287 7:7384206-7384228 AACCCAGTGCAGTAACATACTGG + Intronic
1022461609 7:30613576-30613598 GGGCCTGTGCAGTAAAAAAGTGG + Intronic
1022658798 7:32346735-32346757 AACACCATGCAGTAACAAAGAGG + Intergenic
1024207844 7:47179006-47179028 GGGCCAGTGCAGTAACTCAGTGG + Intergenic
1024251559 7:47509465-47509487 GAGCAAGTGCAGTAACATACGGG - Intronic
1024533113 7:50409472-50409494 AAGCCAATGCAATAAGGAAGGGG + Intergenic
1026259539 7:68742522-68742544 AAGCCAGAGCAATCAGAAAGTGG + Intergenic
1030551253 7:110963109-110963131 AAGCAAATGCAGAAACTAAGAGG - Intronic
1031043709 7:116863753-116863775 AAGCCAGTGCAGGAAAATACAGG + Intronic
1032455413 7:132069655-132069677 AGGCCAGTGCAGTCAGACAGAGG - Intergenic
1032553205 7:132805124-132805146 AAGGATGTGCAGGAACAAAGGGG + Intronic
1035705393 8:1670840-1670862 AAGCCACTGCAGGAGTAAAGGGG + Intronic
1036761332 8:11510833-11510855 AAGCAACTGCCTTAACAAAGAGG - Intronic
1038626746 8:29201307-29201329 AAGCCAGATCAGTAAAAAGGAGG - Intronic
1039334437 8:36574261-36574283 AGGCCACAGCAGTAACACAGGGG + Intergenic
1040953018 8:52954759-52954781 AAGGCAGTGCAGACCCAAAGAGG - Intergenic
1041749227 8:61240760-61240782 TAGCCAGTGCAGTAAGATGGGGG - Intronic
1042401955 8:68360070-68360092 AAGCCACAGCTGAAACAAAGAGG - Intronic
1043868287 8:85400479-85400501 AAGCCAGTGCAGATTCACAGGGG + Intronic
1045830381 8:106453019-106453041 AAGCTTGTGCAAAAACAAAGAGG - Intronic
1046915073 8:119671325-119671347 GACACAGTGCAGAAACAAAGTGG + Intronic
1048435006 8:134408067-134408089 AAGCCAGTGCATTATCAGGGTGG + Intergenic
1049059088 8:140262144-140262166 AAGCCAGTGAACTTACTAAGGGG - Intronic
1057145589 9:92756988-92757010 ATGCCAGTGCAGTATGAAAGGGG + Intronic
1058348950 9:103999096-103999118 AAGACAGTGTAGTAGCAAAGTGG - Intergenic
1061380990 9:130257531-130257553 AGCCCAGTGCAGTATCACAGGGG + Intergenic
1061747709 9:132752631-132752653 AAGCCACTGGAGGAACAAGGTGG - Intronic
1186398473 X:9234462-9234484 AAGCCAATGCAGAAACAATACGG - Intergenic
1189789841 X:44592897-44592919 AAGACAGAGCAATAACAAATGGG - Intergenic
1190142612 X:47861440-47861462 AAGACAGTGTAGAAACAAGGTGG - Intronic
1193831774 X:86296603-86296625 AAGAAAGCACAGTAACAAAGAGG - Intronic
1195683651 X:107566777-107566799 AAGCCTGTGCATTCTCAAAGTGG - Intronic
1197040162 X:121927583-121927605 AAGCAACTGCATTAAAAAAGTGG + Intergenic
1197354612 X:125422253-125422275 AATCCAGTGCAGGAAAATAGAGG + Intergenic
1197871997 X:131069617-131069639 AAGCCAGGCCAGAAACACAGAGG + Intronic
1198885904 X:141336421-141336443 TATGCAGTGCAGTAAAAAAGAGG - Intergenic
1199409760 X:147507659-147507681 ATTCCAGTGCAATAGCAAAGGGG + Intergenic
1200941247 Y:8784051-8784073 CAGCCAATGCTGTGACAAAGTGG - Intergenic
1201398912 Y:13581520-13581542 AAGCCAGTGTAGAAACAGTGGGG - Intergenic