ID: 1149644313

View in Genome Browser
Species Human (GRCh38)
Location 17:58228687-58228709
Sequence GCCTGCTCAGCTGGGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149644313_1149644317 11 Left 1149644313 17:58228687-58228709 CCCAAGCTCCCAGCTGAGCAGGC 0: 1
1: 0
2: 0
3: 29
4: 280
Right 1149644317 17:58228721-58228743 TACCGTGTCCATCTTCCTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 99
1149644313_1149644320 23 Left 1149644313 17:58228687-58228709 CCCAAGCTCCCAGCTGAGCAGGC 0: 1
1: 0
2: 0
3: 29
4: 280
Right 1149644320 17:58228733-58228755 CTTCCTCCTGGTGACTAACTTGG 0: 1
1: 0
2: 0
3: 10
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149644313 Original CRISPR GCCTGCTCAGCTGGGAGCTT GGG (reversed) Intronic