ID: 1149645199

View in Genome Browser
Species Human (GRCh38)
Location 17:58235845-58235867
Sequence ATGTCTCTCTAGCAGACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149645199 Original CRISPR ATGTCTCTCTAGCAGACAGG AGG (reversed) Intronic
901157186 1:7148762-7148784 ACCTCTCTCCAGCAGACTGGGGG + Intronic
906330477 1:44879923-44879945 ATGCCTGTCGAGGAGACAGGTGG - Exonic
907515655 1:54991769-54991791 CTGTCTCTCTGGCAGGCAGCAGG + Intronic
910015425 1:82517810-82517832 CAGTCTTTCTACCAGACAGGAGG + Intergenic
916241531 1:162644766-162644788 TTGTATTTTTAGCAGACAGGGGG + Intronic
919273267 1:195378734-195378756 ATCTCTCTCGAGTAGACAAGAGG + Intergenic
920786568 1:209047992-209048014 ATGTTTTTGTAGCAAACAGGAGG + Intergenic
921971365 1:221152863-221152885 ATGTCTCTCTTATAGAGAGGGGG - Intergenic
923121638 1:230997813-230997835 GAGGCTCTCTAGGAGACAGGTGG - Intronic
923237214 1:232046086-232046108 ATGTCCCACTAGCAGGCAGGAGG + Intergenic
923436207 1:233970193-233970215 ATGCCCATCCAGCAGACAGGAGG - Intronic
1063627316 10:7702189-7702211 ATGTTTCTCCAGCAGACACACGG + Intergenic
1067946343 10:50691723-50691745 GCATCTCTCTGGCAGACAGGTGG + Intergenic
1070167434 10:73909479-73909501 AAGTCTCTCCAGAAGACAGTGGG + Intronic
1070251663 10:74778759-74778781 CTGTCTGTCTTGCAGACAGAGGG + Intergenic
1070881658 10:79856724-79856746 GCATCTCTCTGGCAGACAGGTGG + Intergenic
1071513990 10:86285008-86285030 ATGCCTCTCCAGCCCACAGGTGG + Intronic
1071648230 10:87373038-87373060 GCATCTCTCTGGCAGACAGGTGG + Intergenic
1074086404 10:110211206-110211228 ATGTGTCTCTAGCTGGGAGGGGG - Intronic
1078335371 11:10459059-10459081 ATGTCTTGATAGCAGAGAGGGGG - Intronic
1078540207 11:12207033-12207055 AAATCTCTTTAGCACACAGGTGG - Intronic
1079164297 11:18024411-18024433 ATGTCTGGCTAGAAGACAGATGG + Intronic
1080576637 11:33605666-33605688 CAATCTCTCAAGCAGACAGGAGG + Intronic
1080898031 11:36462327-36462349 ATTTTTCTCTTGCAGCCAGGCGG + Exonic
1082877709 11:58004797-58004819 ATGACTCTCCAGCCGACAGGGGG - Intergenic
1083947084 11:65929776-65929798 AGGTCTCTCTAGCATACAATTGG - Intergenic
1084353294 11:68619023-68619045 TTTTCTCTTTAGAAGACAGGTGG + Intergenic
1085623705 11:78056248-78056270 ATGTCTCCCTGGCAGACAGAAGG - Intronic
1085695405 11:78700314-78700336 ATGTCTCACTATCAAACAGTGGG + Intronic
1086948192 11:92865130-92865152 ATGTGTATCTAGAAGTCAGGGGG - Intronic
1087346945 11:96983485-96983507 ATGTCTATCTACCTGACCGGAGG - Intergenic
1089012713 11:115143857-115143879 ATGCCTCTCTGGCAGACAGCAGG + Intergenic
1091367208 11:135032362-135032384 AAGTCTCTGTAGCAGAGGGGAGG - Intergenic
1092854486 12:12659768-12659790 ATGTCTCCCTAGACGACACGAGG - Intergenic
1093438224 12:19162605-19162627 CTGTCTCTGTAGCAGACAACAGG - Intronic
1096254273 12:50053334-50053356 ATGTGTGTCTAGCAAACAGTAGG - Intergenic
1097151129 12:56980822-56980844 ATTTCTCTCCAGCACACAGCAGG + Intergenic
1097334566 12:58367789-58367811 CTGTCTCTATATAAGACAGGAGG + Intergenic
1104635218 12:130434350-130434372 ATGCCTCCCTAGCACACAGATGG + Intronic
1106041888 13:26101360-26101382 ATGTCTCTGTTGCACACAAGCGG - Intergenic
1106438641 13:29745765-29745787 CTGACTCCCTAGCAGAAAGGAGG + Intergenic
1107708887 13:43133253-43133275 CTGTTTCTCCAGCAGACATGGGG - Intergenic
1114412153 14:22511233-22511255 ATATCTCTCTAGAAGAAAGAGGG - Intergenic
1115782500 14:36785180-36785202 GTTTCTCTCTGGCACACAGGTGG + Intronic
1116131798 14:40864137-40864159 ATGGCTCTCTTGAAGACAGATGG + Intergenic
1118317624 14:64735301-64735323 ATCGCTTTCTAACAGACAGGAGG - Intronic
1120394815 14:83955541-83955563 ATGTTTCACAAGCAGACAGATGG - Intergenic
1120765188 14:88322367-88322389 TTGTCTCTCTGGCAGATGGGTGG - Intronic
1122440208 14:101726653-101726675 AGGTCTCCACAGCAGACAGGGGG - Intergenic
1202892990 14_KI270722v1_random:177054-177076 ATGCCTCTCTAGGAGACGTGAGG + Intergenic
1128357283 15:66936954-66936976 ATGTCTGTCGAGGAGACAGGGGG - Intergenic
1134049050 16:11124154-11124176 AGCTCTCCCTAGCAGGCAGGAGG + Intronic
1136265528 16:29115339-29115361 AGGTCTCACCAGCAGACAGAAGG - Intergenic
1141418133 16:83892925-83892947 TTGACTCTCTAGAAGCCAGGAGG - Intergenic
1141791624 16:86240385-86240407 ATTTCTCTCCAGCAGACATTTGG - Intergenic
1141898490 16:86974207-86974229 ATGTCTCTCCAGCTGCCAGCTGG - Intergenic
1142054336 16:87983273-87983295 AGGTCTCACCAGCAGACAGAAGG - Intronic
1142514260 17:416743-416765 CAGTCTCTCTAGCAGACATGTGG - Intronic
1142743222 17:1942386-1942408 ATGGCTCACTAGCAGATGGGGGG + Intronic
1143489846 17:7279888-7279910 TTGTATCTTTAGCAGACATGGGG + Intergenic
1144634367 17:16895400-16895422 TTGTGTTTCTAGTAGACAGGGGG + Intergenic
1145064189 17:19750929-19750951 ATGTCTCTCTGGCAGCCACTTGG - Intergenic
1146200508 17:30853391-30853413 ATGTCTCTATAGCAGAAGGTAGG - Intronic
1149645199 17:58235845-58235867 ATGTCTCTCTAGCAGACAGGAGG - Intronic
1153411708 18:4800525-4800547 AAATCTCTCTAGCAGCCAGGTGG + Intergenic
1155565331 18:27128002-27128024 CTGCCTCTCTAGAAAACAGGAGG + Intronic
1157510095 18:48264979-48265001 TTGTCTCTCATCCAGACAGGTGG - Intronic
1159609075 18:70506845-70506867 ATGTCTTTCTGGGAGAGAGGAGG + Intergenic
1161616114 19:5271178-5271200 ATGTCTCTGCAGGTGACAGGTGG + Intronic
1162720937 19:12662453-12662475 ATGTCTTTTTAGTAGAAAGGGGG - Intronic
926814074 2:16783065-16783087 CTGTCTCTCTAGCAGTTACGTGG - Intergenic
926999665 2:18780660-18780682 GTCTCTCCCCAGCAGACAGGTGG - Intergenic
928448985 2:31360911-31360933 ATGTATCTCTTGCAGATAAGGGG + Intronic
929588811 2:43132366-43132388 ATGTTCCTCAAGCCGACAGGTGG - Intergenic
933647663 2:84825648-84825670 ATGGCTCTCTAGGATTCAGGTGG + Intronic
937170324 2:119859540-119859562 GTGTCTCCCAAACAGACAGGAGG - Intronic
941045209 2:160667294-160667316 AATTCTCTTTTGCAGACAGGTGG - Intergenic
943373946 2:187052527-187052549 ATGTGTCTCTTGAAGGCAGGAGG + Intergenic
945372239 2:209033279-209033301 ATGGCTTTCTAGCGGACAGAAGG + Intergenic
945525341 2:210882240-210882262 AAGTCTGTCTAGTAGACTGGTGG - Intergenic
945703216 2:213197780-213197802 ATGACCCTCAAGCAGACACGTGG - Intergenic
946126174 2:217565077-217565099 TTGTCTGTCTAGCAGACAGGAGG - Intronic
946793451 2:223324520-223324542 ATAGCCCTCTTGCAGACAGGAGG - Intergenic
947864742 2:233388645-233388667 ATATCTCTCTCTCAGAAAGGCGG + Intronic
1178530762 21:33373639-33373661 CTGGCTCCTTAGCAGACAGGAGG + Intergenic
1179253820 21:39697915-39697937 ATGTTTCACTTGCAGACAGAGGG - Intergenic
1180712212 22:17847047-17847069 ATGCCTCTCCAGGAGTCAGGTGG - Intronic
1182744074 22:32592122-32592144 ATGTATCCCCAGCAGACAAGTGG + Intronic
1182752303 22:32651473-32651495 ATGTTTCTGGAGCACACAGGTGG + Intronic
951351393 3:21611255-21611277 ATATCTCTGTGGCAGACAGATGG - Intronic
951420198 3:22474889-22474911 TTGTATTTTTAGCAGACAGGGGG + Intergenic
953703494 3:45214209-45214231 CCGGCTCTCTAGCAGCCAGGTGG + Intergenic
954320600 3:49829857-49829879 ATGCCTCACTAGGAGGCAGGAGG + Intronic
955217000 3:56992500-56992522 ATGTGTCTGGAGCAGACAGAAGG - Intronic
956903915 3:73745632-73745654 AAGCATCTCTAGCACACAGGTGG - Intergenic
959173511 3:102874385-102874407 ATTTCTCCCTAGCAGAAAGCAGG - Intergenic
961358457 3:126353122-126353144 AGGTCTCTTTTGCAAACAGGTGG - Intronic
964421482 3:156508784-156508806 CTGTATCCCTAGCACACAGGTGG - Intronic
964741652 3:159972706-159972728 ATGGCCTTCCAGCAGACAGGAGG - Intergenic
968808973 4:2791724-2791746 GTGTCTCTCCAGCAGGGAGGAGG + Intergenic
971766006 4:30832954-30832976 ATATCTCTGTAGCAGAAAGGTGG + Intronic
973112396 4:46412243-46412265 ATGTGCCTATCGCAGACAGGAGG - Intronic
974442029 4:61931114-61931136 CTGTCTCACTAGCAGAAAAGGGG + Intronic
974936423 4:68414136-68414158 TTGTCTCTCCAGCTCACAGGAGG + Intergenic
979855829 4:125632849-125632871 ATCTATCTATAGCAGACAGAAGG - Intergenic
983814267 4:172103592-172103614 CTGTTTCTCTAGCAGACTGCAGG - Intronic
989994365 5:50810591-50810613 ATGTCTCTCTCGCTCACAGAAGG - Intronic
990772282 5:59262196-59262218 TTGTCTCTCTAACAGCCAGCAGG + Intronic
990832236 5:59972179-59972201 ATGCCCCTCTGGCAGACAGAGGG - Intronic
997756006 5:136400091-136400113 ATATCACTCTTTCAGACAGGAGG + Intergenic
998110404 5:139497524-139497546 ATGTCTCTGTAGGAGAGAAGTGG + Intergenic
999723853 5:154418758-154418780 CCGCCTCTCTTGCAGACAGGTGG - Exonic
999997556 5:157106703-157106725 ATGTGACTCTAGCAGACAGTGGG - Exonic
1000398069 5:160796865-160796887 TTGTTTCTCTAACAGACAGCTGG - Intronic
1001143277 5:169162983-169163005 ATATCTCAATAACAGACAGGAGG + Intronic
1002802126 6:533669-533691 TTGTCTCACCAGCAGGCAGGAGG + Intronic
1003773045 6:9328572-9328594 GTGTTTCTCTAGGAGACAGTTGG + Intergenic
1007014951 6:38456158-38456180 TTGTATCTTTAGTAGACAGGAGG + Intronic
1007517727 6:42426594-42426616 CTGTCTCTCTAACAAAGAGGTGG + Intronic
1007742426 6:44021062-44021084 ATCTCTCTCTAGCAGTCACCTGG - Intergenic
1009742206 6:67759755-67759777 AGGTCTCTCTAGAAGCCAAGTGG + Intergenic
1015911510 6:138172180-138172202 ATGTTTGTCTAGCGGAGAGGTGG + Intronic
1016815519 6:148299492-148299514 TTGTGTCTTTAGCAGACATGAGG - Intronic
1017685175 6:156906213-156906235 ATTTTTATCTAGGAGACAGGAGG + Intronic
1020489049 7:8756504-8756526 ATGTATTTTTAGCAGACATGGGG + Intergenic
1020986889 7:15147197-15147219 ATGTGTCTATAAAAGACAGGAGG - Intergenic
1023656698 7:42429778-42429800 ATGTCTCTCTATCAGAAATCAGG + Intergenic
1023683548 7:42713171-42713193 TTGTCTCTCTAGGAGCCAGATGG + Intergenic
1024823979 7:53367562-53367584 ATGTCTTTCTTGCAGCCAGGTGG + Intergenic
1025745276 7:64237365-64237387 ATCACTTTCTAGCAGCCAGGTGG + Intronic
1026832496 7:73618694-73618716 ATGTCTCCCTACCAAACAGATGG - Intronic
1026849800 7:73717598-73717620 AGGGCTTTCTAGCAGACAGGTGG - Intronic
1027049610 7:75013685-75013707 ATGTCTGTGTGGCAGACAGAGGG + Intronic
1027584367 7:80039675-80039697 TTATTTCTCTAGAAGACAGGGGG - Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028540037 7:91932864-91932886 ATGCCACTCTAGCTGACAGGAGG + Intergenic
1029158130 7:98531889-98531911 ATTTATCTCTAGCAGCCAGCAGG + Intergenic
1029383419 7:100227980-100228002 ATGTCTGTGTGGCAGACAGAGGG - Intronic
1034070474 7:148179866-148179888 ATGTTTCTCTAGGAGGCAAGTGG - Intronic
1035104972 7:156434689-156434711 ATGTCTCTCGAGAAGACAGGTGG + Intergenic
1046830498 8:118740562-118740584 TGGTCTCTCTAGCAGTCATGGGG + Intergenic
1047818325 8:128489600-128489622 ATTTCCCTCTTTCAGACAGGAGG - Intergenic
1048427157 8:134333309-134333331 AAGTATCTCAAGCAGACAAGTGG + Intergenic
1048675433 8:136773344-136773366 ATGTATCACTAGCAGATAAGGGG + Intergenic
1051838527 9:21367837-21367859 ATGTCTGTCCATCAGACAGGAGG + Exonic
1051844891 9:21440656-21440678 ATGTCTGTCCATCAGACAGGAGG - Exonic
1055455599 9:76468669-76468691 ATCTCTCTTTAGCAGAAAGATGG + Intronic
1058546835 9:106069578-106069600 ATCTCTCTCTGGCAGATATGTGG + Intergenic
1203490187 Un_GL000224v1:97354-97376 ATGCCTCTCTAGGAGACACGAGG + Intergenic
1203502810 Un_KI270741v1:39237-39259 ATGCCTCTCTAGGAGACACGAGG + Intergenic
1201126894 Y:10923799-10923821 ATCTCTCTCTATCACACAGGCGG + Intergenic
1201718320 Y:17071239-17071261 AAGTGTATCTAGCACACAGGAGG + Intergenic