ID: 1149645598

View in Genome Browser
Species Human (GRCh38)
Location 17:58239190-58239212
Sequence TTCCCTAAGCCGGAGCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149645592_1149645598 17 Left 1149645592 17:58239150-58239172 CCTCTCCACTATAGTGGAGATTT 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1149645598 17:58239190-58239212 TTCCCTAAGCCGGAGCTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1149645593_1149645598 12 Left 1149645593 17:58239155-58239177 CCACTATAGTGGAGATTTTGCAG 0: 1
1: 0
2: 1
3: 5
4: 116
Right 1149645598 17:58239190-58239212 TTCCCTAAGCCGGAGCTGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149645598 Original CRISPR TTCCCTAAGCCGGAGCTGTC AGG Intronic
902672629 1:17985314-17985336 TTCCCTAAGCCTCAGGTGTTTGG + Intergenic
903734300 1:25520417-25520439 TACCCTAAGCCTGGGCTTTCTGG - Intergenic
905365585 1:37449452-37449474 TTCCCTCTGCTGGAGCTGCCCGG - Intergenic
906617544 1:47244148-47244170 CTCCCCAAACCGGAACTGTCTGG - Intergenic
907312255 1:53545356-53545378 TCCCCAAAGCCTGACCTGTCCGG + Intronic
910178671 1:84458290-84458312 TTCCCTAAGGAGGAGGTGTTTGG - Intergenic
914214066 1:145608339-145608361 TTCCCTCAGCCCCGGCTGTCAGG + Intronic
914466010 1:147928742-147928764 TTCCCTCAGCCCCGGCTGTCAGG + Intronic
922421104 1:225461759-225461781 GTCCCAAAGCCAGAGATGTCAGG + Intergenic
924814999 1:247433700-247433722 TTCTCTATTCCGGAGCTCTCTGG + Intronic
924815004 1:247433742-247433764 TTCTCTATTCCGGAGCTCTCTGG + Intronic
924815018 1:247433910-247433932 TTCTCTATTCCGGAGCTCTCTGG + Intronic
1069485640 10:68821113-68821135 TTTCCTAGGCTGGAGCTGTCTGG + Intergenic
1069864381 10:71492443-71492465 TTCCCAATGCCTGACCTGTCTGG - Intronic
1071856631 10:89632292-89632314 TTCCATAAGCAGGATCTGTGTGG - Intronic
1077007550 11:365442-365464 TTCCCAAAGCCGGGGCTCACTGG + Intergenic
1078125922 11:8563323-8563345 CTCACTAGGCAGGAGCTGTCTGG + Intronic
1078706254 11:13746920-13746942 GTCCCAAAGCCTGAGGTGTCTGG + Intergenic
1087314228 11:96587251-96587273 TACCATAAGCCAGAGCAGTCAGG - Intergenic
1087842243 11:102932453-102932475 TTCCCATAGCTGGAGCTCTCAGG - Intergenic
1091604490 12:1938259-1938281 TTCCAGAAGCCAGAGCCGTCCGG - Intergenic
1097191162 12:57220277-57220299 TTCCCGAAGCCGGAGCCGGAGGG - Intronic
1099831212 12:87845030-87845052 TTAGCTAAGCTGGAGCTGTAAGG + Intergenic
1103967798 12:124651280-124651302 TTCCCCAAGCCAGAGATGGCTGG + Intergenic
1106135226 13:26968593-26968615 ATCCCTAAGCCCCAGCTGCCAGG + Intergenic
1117503083 14:56373952-56373974 CTCCCTAAGATGGAGCTCTCTGG - Intergenic
1121446568 14:93982628-93982650 TTCCATGAGCTGGAGCTCTCTGG + Intergenic
1122814436 14:104305561-104305583 TTCACAAAGCCGGTGCTCTCAGG - Intergenic
1124796759 15:32788616-32788638 TGCCCAAGGCAGGAGCTGTCAGG + Intronic
1125263998 15:37858696-37858718 TTCTCTAAGCAGGACCTGACTGG - Intergenic
1128648584 15:69394695-69394717 TGCCCTAAGCCCGAGCAGGCTGG + Intronic
1132061098 15:98693071-98693093 TTCCCTAACCCAGGGCTGTGTGG + Intronic
1139428723 16:66899675-66899697 TTCCCCAAGCCAGAGGTGCCAGG - Intergenic
1144792551 17:17868806-17868828 TTCCCTAAGCAGCAGCATTCCGG + Intronic
1149645598 17:58239190-58239212 TTCCCTAAGCCGGAGCTGTCAGG + Intronic
1150816608 17:68396866-68396888 CTCCCTAAGCAGGAGCAGCCAGG + Intronic
1151656209 17:75497229-75497251 ATGCCTAAGCAGGAGGTGTCTGG + Intronic
1153395781 18:4618982-4619004 TTTCCTAAGTCTGAGCTGTTTGG - Intergenic
1156556851 18:38077736-38077758 ATCCCTAAGGCTGAGATGTCAGG - Intergenic
1160251114 18:77204294-77204316 TTCTCTAAACCAGAGCTGGCAGG - Intergenic
1162378081 19:10316711-10316733 ATCCCTAGGCCAGAGCTGTTTGG + Exonic
1162935980 19:13981828-13981850 TTCCCTGAGCTGGAGCTGCCAGG + Intronic
1164643194 19:29841292-29841314 TTCCCTGAGCCTGTGCTCTCTGG - Intergenic
927257706 2:21054602-21054624 TTCCAGAATCCGGAGCTGTGAGG - Intergenic
928909872 2:36408665-36408687 TTGCATAAGCAGGAGCTGTCAGG + Intronic
936965713 2:118125868-118125890 ATCCCTAAGTCTGAGCTCTCTGG - Intergenic
942519725 2:176790904-176790926 TTCAAGAAGCCAGAGCTGTCTGG + Intergenic
946343375 2:219087113-219087135 TTCCCTGAGCCAGAGCTGACAGG - Intronic
948750114 2:240127280-240127302 TTCCCTGTGCCTGAGCTGTAAGG - Intronic
1171006004 20:21466447-21466469 GTCCATAAGCAGGAGATGTCAGG + Intergenic
1175282665 20:57814473-57814495 TTACCTAAGCAGGTGGTGTCAGG - Intergenic
1178607390 21:34051702-34051724 TTTCCTAAGGCAGAGCTTTCGGG + Intergenic
1178910011 21:36666805-36666827 CTCCCTAGGCCAGAGCTGTTAGG + Intergenic
1184381731 22:44148999-44149021 TTCCCTGAACCGGTTCTGTCAGG - Intronic
952959454 3:38580409-38580431 ATCCCTAAGACTGAGGTGTCAGG - Intronic
959505541 3:107152592-107152614 TTCCCTCAGCCAGGGCTGTGGGG - Intergenic
961974525 3:131009217-131009239 TTCCCTAAGACTGAGCTGTTAGG - Intronic
962729386 3:138265969-138265991 TTCACTACTCAGGAGCTGTCAGG + Intronic
963912732 3:150828629-150828651 TATCCTAAGGTGGAGCTGTCAGG + Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
968468368 4:764512-764534 TGCCCGATTCCGGAGCTGTCAGG + Intronic
969586811 4:8098629-8098651 TTCCAGATGCCGGAGCTGCCGGG + Intronic
976192490 4:82501464-82501486 TTGCCAAAGCAGGAGGTGTCCGG - Intronic
979181109 4:117728705-117728727 ATCCCAAAGCCAGGGCTGTCAGG + Intergenic
986405590 5:7421646-7421668 TTCCCTAAGTGGGTGCTCTCTGG + Intronic
991438387 5:66619332-66619354 TTCACTCACTCGGAGCTGTCAGG + Intronic
995803420 5:116024483-116024505 CTGCCTAAGGCTGAGCTGTCAGG + Intronic
998004521 5:138648243-138648265 CTCCCCAAGCCGGAGCACTCTGG - Intronic
998142879 5:139709827-139709849 TTCCCACAGCCAGAGCTGCCCGG - Intergenic
1007925659 6:45647516-45647538 GTCCCTAAGCAGGTGCTGCCTGG - Intronic
1009269091 6:61596209-61596231 TTCCATAAGCTGAAGCTGTAAGG - Intergenic
1047997927 8:130354576-130354598 TTCCCTAAACGGGAGCAGGCAGG - Intronic
1049752659 8:144292526-144292548 TTCTGCAAACCGGAGCTGTCCGG - Intronic
1055785483 9:79865177-79865199 CTCCCTAAACTGGAGGTGTCTGG - Intergenic
1185533836 X:842180-842202 TTCCCTGAGGCCGAGATGTCAGG - Intergenic
1185533902 X:843351-843373 TTCCCTGAGGCCGAGATGTCAGG + Intergenic