ID: 1149650534

View in Genome Browser
Species Human (GRCh38)
Location 17:58273480-58273502
Sequence TGGGCTGGTACCGATTGTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149650517_1149650534 27 Left 1149650517 17:58273430-58273452 CCAGGAGGCAAAAAAGACCCTGC 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1149650534 17:58273480-58273502 TGGGCTGGTACCGATTGTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 60
1149650525_1149650534 10 Left 1149650525 17:58273447-58273469 CCCTGCTGAGGGGGACACGGGGG 0: 1
1: 0
2: 0
3: 20
4: 203
Right 1149650534 17:58273480-58273502 TGGGCTGGTACCGATTGTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 60
1149650516_1149650534 30 Left 1149650516 17:58273427-58273449 CCTCCAGGAGGCAAAAAAGACCC 0: 1
1: 0
2: 0
3: 28
4: 267
Right 1149650534 17:58273480-58273502 TGGGCTGGTACCGATTGTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 60
1149650527_1149650534 9 Left 1149650527 17:58273448-58273470 CCTGCTGAGGGGGACACGGGGGT 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1149650534 17:58273480-58273502 TGGGCTGGTACCGATTGTCCAGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149650534 Original CRISPR TGGGCTGGTACCGATTGTCC AGG Exonic
901964520 1:12855448-12855470 ATGGCTGGTACCGATCATCCCGG - Intronic
902439750 1:16421634-16421656 TGGGGTGGAACTGAGTGTCCTGG - Intronic
905942495 1:41875117-41875139 TGGGCTGCTCCCGAAGGTCCTGG + Intronic
907718137 1:56946896-56946918 TGTGCTGGTGCCTATTGCCCTGG + Intronic
909707143 1:78598953-78598975 TGGGCTGGTCCCGAATTTCTTGG + Intergenic
915163592 1:153935949-153935971 TGGGCTGGTACTGTTTGCCTAGG - Intronic
917391828 1:174545469-174545491 TGGGAGGGTCCCGATTTTCCAGG + Intronic
1065236071 10:23653718-23653740 TGGATTAGTACAGATTGTCCTGG + Intergenic
1067284741 10:44899297-44899319 TGGGCTGATGCCGTTGGTCCTGG + Intergenic
1067382482 10:45787633-45787655 TGGGCTGGCACCGATTGCAAAGG - Intronic
1067890180 10:50128181-50128203 TGGGCTGGCACCGATTGCAAAGG - Intronic
1068439481 10:57032601-57032623 TGGGCTGGTATTGAGTGTCTTGG - Intergenic
1075562652 10:123479666-123479688 TGGGCTGGAGCCCATTCTCCTGG - Intergenic
1079239864 11:18714688-18714710 AGGGCTGGTAGCGATGGTCATGG + Intronic
1089518435 11:119048352-119048374 CGGGCTGGTACAGCTTGTCCTGG + Exonic
1090950684 11:131470595-131470617 TGTGCTGGTCCCCATTGGCCAGG - Intronic
1097373231 12:58809705-58809727 AGGGCTGGTACAGAGTGGCCTGG - Intronic
1098674865 12:73276670-73276692 TTGGCTGGTACCCAATTTCCAGG - Intergenic
1109567075 13:64131621-64131643 TGAGCTGGTACCTAATGTGCAGG - Intergenic
1115843637 14:37501868-37501890 TGGGAGTGTACCGATTTTCCAGG - Intronic
1121454069 14:94027240-94027262 AGGGCTGGTACTGATTGTGGTGG + Intronic
1121935954 14:98018792-98018814 TGGGCTGGTAAGGATTGCACCGG + Intergenic
1125627064 15:41117112-41117134 TGGGCTGGTTCCCAGTCTCCTGG + Intergenic
1130689312 15:86066737-86066759 TGGGAGGGTAGCGATTGTCTTGG + Intergenic
1147747020 17:42701011-42701033 TGGGCGGGTATAGATTGGCCTGG - Exonic
1149450303 17:56744937-56744959 TGGGCTGGTGCAGCATGTCCAGG + Intergenic
1149650534 17:58273480-58273502 TGGGCTGGTACCGATTGTCCAGG + Exonic
1151623754 17:75263468-75263490 TGGGCTGGTACCCATCCTCAAGG + Exonic
1154343931 18:13527088-13527110 TGGGCTGGAACCTCATGTCCTGG + Intronic
1163062100 19:14768270-14768292 TGGCCTGGGACCCACTGTCCAGG - Intronic
928124028 2:28603894-28603916 GGGGCTGGTTCTGATTGCCCAGG - Intronic
929433152 2:41905864-41905886 TTGTCTGGTACAGACTGTCCTGG - Intergenic
933782951 2:85814402-85814424 TGGGCTGGCATCGATGGTACAGG + Intergenic
948074669 2:235156622-235156644 TGGGCTGGTCCCCATACTCCGGG + Intergenic
1170539212 20:17371121-17371143 TGGGGTGGTACCCATTGGGCTGG + Intronic
1170950971 20:20935757-20935779 TTGGCTGAGACTGATTGTCCTGG - Intergenic
1172099357 20:32475919-32475941 TGGGCTGGTAGGGAGTTTCCTGG + Intronic
1176671643 21:9740323-9740345 TGGGCTGATACCTATTCTACAGG - Intergenic
1179446905 21:41438406-41438428 TGGGCTGGGGCTGATGGTCCAGG + Intronic
1183465454 22:37978038-37978060 TGGGCTGGTACTTGTAGTCCGGG + Exonic
950878387 3:16299991-16300013 GGTGCTGGTACCCATTTTCCAGG + Intronic
953965084 3:47298232-47298254 TGGCCAGGTACCTATAGTCCCGG + Intronic
968124080 3:196145644-196145666 TGGGCAGTTACAGATTCTCCTGG - Intergenic
971321428 4:25608993-25609015 TGATCTGGTACCGTTTGTCATGG + Intergenic
977736367 4:100421295-100421317 TGGGTTTGTACCGAATGTGCTGG - Exonic
985003309 4:185506582-185506604 TGGGCTCATTCCGATTGTCGTGG + Exonic
995797892 5:115961596-115961618 TGGGCTGGAACTGGTTTTCCCGG - Intergenic
997396816 5:133567495-133567517 TGGGCTGGTACCAAGTGTTAAGG + Intronic
1001290221 5:170451963-170451985 TGGGCTGGTGGCTATTGTCATGG + Intronic
1005695648 6:28350270-28350292 AGGGCCGTTACCGAGTGTCCGGG + Exonic
1022649081 7:32258564-32258586 ATGGCTGGTACAGATTGTGCTGG - Intronic
1022963152 7:35449446-35449468 AGGGCTGGGTCAGATTGTCCAGG - Intergenic
1035996034 8:4548134-4548156 TTGGATGGTACCGAATGTCTAGG + Intronic
1040712743 8:50209007-50209029 TGGGAATGTACCGATTTTCCAGG - Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1044818368 8:96136388-96136410 TGACCTGGTACAGTTTGTCCTGG - Intergenic
1045112022 8:98945213-98945235 TGGGCAGGCACCGGGTGTCCGGG - Intronic
1047925155 8:129675591-129675613 TGGCCTGGTGCCCATTATCCTGG - Intergenic
1057255740 9:93545537-93545559 TGGGCTGGCACCGCTTTTGCAGG + Intronic
1057489098 9:95508202-95508224 TGGGCCGGTGCAGATAGTCCCGG + Exonic
1186342204 X:8657026-8657048 TGGGCTCATACCAATTGGCCTGG - Intronic
1188903362 X:35762068-35762090 TTGGCAGGTGCAGATTGTCCAGG + Intergenic