ID: 1149650811

View in Genome Browser
Species Human (GRCh38)
Location 17:58275335-58275357
Sequence CCTGCGAAGAAGGAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 561}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149650805_1149650811 6 Left 1149650805 17:58275306-58275328 CCACAGGAAAGAAGACTGCAGGG 0: 1
1: 0
2: 1
3: 32
4: 322
Right 1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG 0: 1
1: 0
2: 5
3: 60
4: 561
1149650798_1149650811 28 Left 1149650798 17:58275284-58275306 CCTCCCAACACCAATAACAGACC 0: 1
1: 0
2: 0
3: 9
4: 181
Right 1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG 0: 1
1: 0
2: 5
3: 60
4: 561
1149650799_1149650811 25 Left 1149650799 17:58275287-58275309 CCCAACACCAATAACAGACCCAC 0: 1
1: 0
2: 4
3: 43
4: 231
Right 1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG 0: 1
1: 0
2: 5
3: 60
4: 561
1149650802_1149650811 18 Left 1149650802 17:58275294-58275316 CCAATAACAGACCCACAGGAAAG 0: 1
1: 0
2: 2
3: 26
4: 265
Right 1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG 0: 1
1: 0
2: 5
3: 60
4: 561
1149650797_1149650811 29 Left 1149650797 17:58275283-58275305 CCCTCCCAACACCAATAACAGAC 0: 1
1: 0
2: 1
3: 16
4: 221
Right 1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG 0: 1
1: 0
2: 5
3: 60
4: 561
1149650800_1149650811 24 Left 1149650800 17:58275288-58275310 CCAACACCAATAACAGACCCACA 0: 1
1: 0
2: 1
3: 21
4: 200
Right 1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG 0: 1
1: 0
2: 5
3: 60
4: 561
1149650803_1149650811 7 Left 1149650803 17:58275305-58275327 CCCACAGGAAAGAAGACTGCAGG 0: 1
1: 1
2: 2
3: 33
4: 282
Right 1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG 0: 1
1: 0
2: 5
3: 60
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149650811 Original CRISPR CCTGCGAAGAAGGAGAGGGA AGG Intronic
901194109 1:7430703-7430725 CATGCAGAGAATGAGAGGGAAGG - Intronic
901317058 1:8316580-8316602 CCTGGGAAGGAGGTGAGGGCTGG - Intergenic
901430534 1:9211386-9211408 CCTGGGAGGAAGGGGTGGGAGGG - Intergenic
901732607 1:11291148-11291170 CATGAGAAGAATGACAGGGATGG - Intronic
902451445 1:16499202-16499224 GCTGCGGAGAAGGCGAGCGAAGG - Intergenic
902542173 1:17163217-17163239 CCTGCGAAGGAGGAGTGGCCTGG - Intergenic
902836376 1:19049545-19049567 CCTGCCAAGAAGCAGGGGAATGG + Intergenic
903100182 1:21023260-21023282 CGTGGGGAGAGGGAGAGGGAGGG - Intronic
903359889 1:22770346-22770368 CCTGCCCAGAAGCAGAGGGGTGG + Intronic
903416061 1:23183955-23183977 CCTGAGAAGAAAGAGAGGGTTGG - Intergenic
903561117 1:24228625-24228647 CCTGAGGAGAGGGAGAGAGATGG + Intergenic
904007414 1:27370730-27370752 CCTGGAAAGAAGGGGAGGCAGGG + Exonic
904202485 1:28830096-28830118 CCTGAGGAGAGGGAGAGAGATGG + Intronic
904622436 1:31783311-31783333 CCGGCGGAAACGGAGAGGGAGGG + Intergenic
904855799 1:33497399-33497421 CCTGAGGTGAGGGAGAGGGAGGG + Intergenic
905616946 1:39408283-39408305 CTTGAGAAGGGGGAGAGGGAAGG + Intronic
906139371 1:43524635-43524657 CCTGAGAAGCAGGAGTGGGTAGG + Intergenic
906215175 1:44034320-44034342 CCTGCTGAGAAGGTGGGGGAGGG + Intergenic
907114238 1:51955125-51955147 GATGACAAGAAGGAGAGGGAGGG - Intronic
907555029 1:55335987-55336009 TCTGTGAACAAGGAGAGGGATGG - Intergenic
907652368 1:56307566-56307588 CCTGAGGAGAGGGAGAGAGAAGG - Intergenic
908171882 1:61513052-61513074 CCTGCCAAGAAGGGAAGTGAGGG + Intergenic
908185181 1:61645577-61645599 CAGGCGAGGAAGGAGAGGAAAGG + Intergenic
908467680 1:64414233-64414255 CGTGGGGAGAGGGAGAGGGAGGG - Intergenic
908512611 1:64861361-64861383 CCTGTGGAGAAGAGGAGGGAGGG + Intronic
908909115 1:69052153-69052175 CCCGGGAAAGAGGAGAGGGAAGG + Intergenic
910441168 1:87253446-87253468 CCTGTCAGGAGGGAGAGGGAGGG - Intergenic
910997023 1:93116859-93116881 CTTGAGGAGAGGGAGAGGGATGG + Intronic
912513231 1:110202227-110202249 CTTGCAATGAGGGAGAGGGAAGG + Intergenic
912710860 1:111948774-111948796 CATGCACAGCAGGAGAGGGAGGG + Intronic
913022975 1:114805342-114805364 CGTGGGGAGAGGGAGAGGGAGGG + Intergenic
913156893 1:116108456-116108478 CCAGAGAAGATGGTGAGGGAGGG + Intergenic
913487071 1:119341399-119341421 CCTGTAAAGAAGGAGGGGAAAGG - Intergenic
913538363 1:119795695-119795717 CCTGAGAACCAGGAGTGGGAGGG - Intronic
913615911 1:120558999-120559021 GCTGCGAGGCAGGCGAGGGAAGG + Intergenic
914334917 1:146705492-146705514 GCTGGGAAGAAGGAGAAAGAAGG - Intergenic
914574368 1:148951903-148951925 GCTGCGAGGCAGGCGAGGGAAGG - Intronic
915312054 1:155009805-155009827 CCTGGGAAGAAGGGAATGGATGG + Intronic
915361605 1:155289369-155289391 CCTGAAAAGGAGGGGAGGGATGG - Exonic
915471660 1:156129382-156129404 ACTGTGAAGAGGGATAGGGAAGG - Intronic
915589962 1:156865050-156865072 CCTGGGAAGAAAGATAGGGCAGG - Intronic
915838357 1:159196218-159196240 CATGAGAAGTAGGAGAAGGAAGG + Intronic
916041311 1:160963894-160963916 TTTGGGAGGAAGGAGAGGGAGGG + Intergenic
916087660 1:161282398-161282420 CGTGGGGAGAGGGAGAGGGAGGG + Intronic
916191586 1:162184158-162184180 CCTGAGGAGAGGGAGAGAGATGG + Intronic
916800203 1:168208717-168208739 CCTGAGGAGAGGGAGAGAGATGG + Intergenic
917498730 1:175566466-175566488 CCTGAGTAGAAGGTGAGTGAGGG + Intronic
917522417 1:175759228-175759250 CCTGAGAACAAGGAGAGTGGGGG + Intergenic
918574806 1:186044838-186044860 CCTGCCAAGAATGAGAGGGTGGG - Intronic
919436052 1:197562635-197562657 CCTGAGGAGAGGGAGAGAGATGG - Intronic
919883225 1:201914721-201914743 CCTGGGCAGGAGGAGAGGGAAGG - Intronic
920024438 1:202982963-202982985 CCCAAGGAGAAGGAGAGGGATGG + Intergenic
921301699 1:213757069-213757091 CTTGAGAAGGAGGAGAGAGATGG - Intergenic
921402624 1:214743042-214743064 ACTGAGGAGAAGGAGAGAGATGG + Intergenic
921964708 1:221076026-221076048 GAAGAGAAGAAGGAGAGGGAAGG - Intergenic
922389547 1:225125974-225125996 CCGAAGAAGAAGGAGAGAGATGG + Intronic
922936912 1:229430347-229430369 CCTGGGAAGGAGGCAAGGGAGGG - Intergenic
923246390 1:232136658-232136680 CCTGGGATGGAGGCGAGGGAGGG + Intergenic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923522363 1:234745320-234745342 CCTGAGGAAAAGGGGAGGGAAGG + Intergenic
923629308 1:235639473-235639495 CCGGCCCAGAAGGACAGGGAAGG - Intronic
923651280 1:235876317-235876339 TGTGGGAAGCAGGAGAGGGAGGG - Intronic
923660159 1:235950629-235950651 GCTGTGCAGAAGGAGAGGGAAGG + Intergenic
1063662743 10:8045244-8045266 GTTGCGAAGAGGGAAAGGGAGGG - Intergenic
1064108834 10:12520928-12520950 CGTGGGGAGAGGGAGAGGGAGGG + Intronic
1064883680 10:20085430-20085452 CCTGGTTAGAAGGTGAGGGAAGG + Intronic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1066057160 10:31692678-31692700 CCTTAGAAGAAAGAGAGGGATGG + Intergenic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1067234930 10:44439400-44439422 CTTGCTAATAAGGAGAGAGAGGG - Intergenic
1067275750 10:44832441-44832463 CCTGCGGAGAGGGAAAGAGAGGG + Intergenic
1067756327 10:49008602-49008624 ACTGCGGAGAAGGACTGGGAAGG - Intergenic
1070360826 10:75687052-75687074 CCTGAGGAGAGGGACAGGGATGG - Intronic
1070957545 10:80474238-80474260 GCTTCGGAGAATGAGAGGGAAGG + Intronic
1070979522 10:80633081-80633103 CCTGGGAGGCAGGAGAGTGATGG + Intronic
1072825999 10:98607101-98607123 CCTGAGAAGAAAGAGAGGGAGGG - Intronic
1073212740 10:101818156-101818178 CCTGCGGAGAGGGAGGGGGAAGG - Exonic
1073322850 10:102626134-102626156 CCTGGGGACAAGGACAGGGAGGG + Intronic
1073450501 10:103606479-103606501 CGTGGGGAGAGGGAGAGGGAAGG - Intronic
1073598989 10:104828360-104828382 GCTGAGGAGAAGGAGAGAGATGG + Intronic
1073772293 10:106748480-106748502 CCTGAGGAGAGGGAGAGAGATGG - Intronic
1073798932 10:107020030-107020052 CCTAGGAAGAAGGAGTGGGATGG - Intronic
1073977522 10:109117950-109117972 CATGCAAAGAATGAGAGGAAAGG + Intergenic
1074968112 10:118511299-118511321 CCTGAGGAGGAGGAAAGGGAGGG + Intergenic
1075489486 10:122854411-122854433 CTTGGGAAGCAGGAGATGGAGGG - Intronic
1075617248 10:123899643-123899665 CCTGGGAGGAAGGGGAAGGAAGG + Intronic
1076105586 10:127820260-127820282 CCTGCTCAGTAGGAGAGAGAAGG + Intergenic
1076281746 10:129252254-129252276 CCTGGGAAGAAGCAGAATGAAGG + Intergenic
1076564063 10:131386368-131386390 CGGACGAAGAAGCAGAGGGAAGG + Intergenic
1076733215 10:132448433-132448455 CCGCCTAAGAAGGAGAAGGAGGG + Exonic
1076814053 10:132905900-132905922 CCTGCAAGGAAGGCTAGGGAGGG + Intronic
1077081340 11:725968-725990 CCTGGGCAGAAGGAAAGGGCTGG + Intronic
1077347305 11:2068834-2068856 CCTGAGGAGAGGGAGAGAGATGG + Intergenic
1077626747 11:3779049-3779071 CCTGAGGAGATGGAGAAGGAGGG + Exonic
1077756897 11:5040967-5040989 CCTGAGAAGAGGGAGAGAGATGG - Intergenic
1079158403 11:17970402-17970424 CCTGAGGAGAGGGAGAGAGATGG - Intronic
1079240769 11:18720983-18721005 CCTTCGAGGAAAGGGAGGGATGG - Intronic
1079303679 11:19303419-19303441 CCTGAGGAGACGGAGAGAGATGG + Intergenic
1080665775 11:34334645-34334667 CATGGGAAGAGGGAAAGGGAAGG - Intronic
1081739775 11:45430703-45430725 TCAGAGCAGAAGGAGAGGGAGGG + Intergenic
1081853275 11:46288633-46288655 TCTGGGCAGCAGGAGAGGGATGG + Intronic
1082232869 11:49790395-49790417 CCTGAGGAGAGGGAGAGAGACGG + Intergenic
1083373073 11:62197023-62197045 CCTGGGAGAAAGGAGAGGAAGGG - Intergenic
1083738779 11:64696760-64696782 CCTGGGAAGGTGGAGTGGGAGGG - Intronic
1083879426 11:65540744-65540766 CCTGCGAGGAAGGTGCGGGCGGG + Intronic
1084662597 11:70555188-70555210 CCTGCACAGAGGGAGAGAGATGG - Intronic
1085034321 11:73291051-73291073 CCTGAGAAGAGGGTGAGGAAGGG + Intronic
1085763924 11:79265836-79265858 CCTGGGTAGAAGGTGAGAGACGG - Intronic
1086318609 11:85620300-85620322 CCTGAGGAGAGGGAGAGAGATGG - Intronic
1086617759 11:88843522-88843544 CCTGAGGAGAGGGAGAGAGACGG - Intronic
1086881299 11:92156839-92156861 CGTGGGGAGAGGGAGAGGGAGGG - Intergenic
1088256942 11:107911789-107911811 CGTGGGGAGAGGGAGAGGGAGGG - Intronic
1089537426 11:119169152-119169174 CCGGCCGAGAACGAGAGGGACGG + Exonic
1089626227 11:119752820-119752842 GCAGCTAAGAAGCAGAGGGAGGG - Intergenic
1089676177 11:120091410-120091432 CCTGGGTAGAAGGAGAGGGAAGG - Intergenic
1089943023 11:122439488-122439510 CTTTTGAAGAAGGAGAGGAAAGG + Intergenic
1089984349 11:122799067-122799089 GCTGCCTAGAAAGAGAGGGATGG - Intronic
1090464965 11:126925568-126925590 ACTGCCAAGGAGGAGAGGGCAGG - Intronic
1090813108 11:130265103-130265125 CCTGAGGAGGAGGAGAGAGATGG - Intronic
1091138031 11:133210397-133210419 CCTGGGAAGAGGGAGAGAGAAGG - Intronic
1091187069 11:133656546-133656568 CCTGGAAAGATGGAGAGGGAGGG + Intergenic
1091338200 11:134789312-134789334 CCTGGGAGGCAGGAGAGCGACGG + Intergenic
1091834094 12:3572448-3572470 CCTGCTGAGAATGAGAGAGATGG + Intronic
1091849069 12:3680500-3680522 CATGCAAAGGAGGAGAGGGATGG - Intronic
1092737627 12:11598238-11598260 GATGGAAAGAAGGAGAGGGAAGG + Intergenic
1094280687 12:28734272-28734294 CCTGAGGAGAGGGAGAGAGATGG - Intergenic
1096107280 12:49003727-49003749 ATTGGGCAGAAGGAGAGGGAGGG - Intronic
1096440327 12:51637205-51637227 CCTGAGGAGAGGGAGAGAGATGG - Intronic
1097032910 12:56102306-56102328 CCTGTGAAGAAGCTGAGGAATGG - Exonic
1097107862 12:56635770-56635792 CCTTAGAAAAATGAGAGGGAGGG + Intronic
1098855677 12:75650802-75650824 CCTGCTCAGAAGAACAGGGAAGG - Intergenic
1099018547 12:77374824-77374846 CCTGAGAATACAGAGAGGGAGGG - Intergenic
1100581839 12:95946635-95946657 CGTGGGGAGAGGGAGAGGGAGGG - Intronic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101934900 12:109049345-109049367 CCTGAGAAGAGTGAGAGAGAGGG + Intronic
1102268121 12:111506648-111506670 CGTGGGGAGAAGGAGAAGGAGGG - Intronic
1102759755 12:115375126-115375148 CCTGGGAAGAAGAAGAGGCAGGG + Intergenic
1103028728 12:117594969-117594991 CCTGCCCAGAAAGACAGGGAAGG + Intronic
1103563362 12:121803923-121803945 GCGGCGAGGAAGGAGAGGGGAGG + Intergenic
1103846936 12:123908306-123908328 CCAGAGAAGAAAGAGGGGGATGG - Intronic
1104331883 12:127854717-127854739 CCAGTGCAGAAGAAGAGGGAAGG + Intergenic
1104433053 12:128732461-128732483 CCTCCCAGGAAGTAGAGGGAGGG - Intergenic
1104949919 12:132435062-132435084 CCTGAGGAGAGGGAGAGGGATGG + Intergenic
1105298612 13:19113455-19113477 CCCGAGAAGATGGAGAGAGAAGG - Intergenic
1105367518 13:19778391-19778413 CGTGGGGAGAGGGAGAGGGAGGG - Intronic
1105502393 13:20983806-20983828 CCTGTGTAGAAGGAAAAGGAAGG + Exonic
1105609267 13:21954031-21954053 CCTGAAAAGAAGGAGCAGGAAGG - Intergenic
1105916197 13:24919013-24919035 CCTGGAAAGAAGGAGGGTGAGGG + Intronic
1105938201 13:25121147-25121169 GCTCAGAAGAAGGAGAGAGAAGG + Intergenic
1106304153 13:28495241-28495263 CCTGGGAGGAAGAAGAGGGTAGG - Intergenic
1106480802 13:30135629-30135651 CATGGGAAGGAGGAGAGCGAGGG - Intergenic
1107097531 13:36552645-36552667 CCTGAGAAGAAGGATGGGAAAGG + Intergenic
1107197172 13:37666730-37666752 CATGCGAAGATGAAAAGGGAAGG - Intronic
1109893461 13:68650914-68650936 CCTGAGGAGAGGGAGAGAGACGG - Intergenic
1111640519 13:90963854-90963876 CCCGAGGAGAAGGAGAGAGATGG - Intergenic
1111969377 13:94895101-94895123 CCAGTGGAGTAGGAGAGGGAAGG - Intergenic
1113128719 13:107010138-107010160 CCTGGGAAGAAAGACAAGGAAGG - Intergenic
1113305704 13:109076275-109076297 CCTAAGAAGAAGAAGAAGGAAGG - Intronic
1113807997 13:113121161-113121183 CCTGGGAAGAAGCGGAGGGTGGG + Intergenic
1113808673 13:113124228-113124250 CCTGGGAAGAAGCAGAGGGTGGG + Intronic
1114042987 14:18695985-18696007 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1114047278 14:18886425-18886447 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1114522836 14:23349558-23349580 CTTGAGAAGATGGGGAGGGATGG + Intronic
1115154675 14:30324414-30324436 CCTGAGGAGAGGGAGAGAGATGG - Intergenic
1115706389 14:36003201-36003223 CCTGTGCAGCAAGAGAGGGAGGG - Intergenic
1115784011 14:36804214-36804236 CTAGGGAAGAAGGAAAGGGATGG - Intronic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1116150635 14:41137212-41137234 CCTGAGAAGAGGGAGACAGATGG + Intergenic
1117296284 14:54382619-54382641 CCTATGAAGAAGGAGAGAGATGG - Intergenic
1117335554 14:54754565-54754587 CTTGCAAAGCAGGAGAGGTAGGG - Intronic
1118045249 14:61963098-61963120 CCTGAGGAGAGGGAGAGAGATGG - Intergenic
1118454803 14:65934805-65934827 CTTGCTGAGAAGGAAAGGGAGGG - Intergenic
1119017285 14:71071915-71071937 CCTGAAAAGAGGGAGAGGTAGGG + Intronic
1120170706 14:81245235-81245257 CGTGCCGAGAGGGAGAGGGAGGG + Intergenic
1120503085 14:85321489-85321511 CCTGTGAAAAAAGAGGGGGAAGG + Intergenic
1121165576 14:91793727-91793749 CCTGAGGAGAGGGAGAGAGATGG - Intronic
1122559470 14:102601555-102601577 CCTGTGAAAGAAGAGAGGGAAGG + Intronic
1123201911 14:106674253-106674275 CCTGAGAATATGGAGAGAGAAGG + Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124901587 15:33828239-33828261 CCTGAGGAGAAGGAGGGAGATGG - Intronic
1126105960 15:45147405-45147427 CTTGGGCAGAAGCAGAGGGAGGG - Intronic
1126400518 15:48264208-48264230 CCTGTAAAGGAGGAAAGGGATGG + Intronic
1127697980 15:61470472-61470494 GCTGTGAAGACGGAGAGAGATGG + Intergenic
1128247880 15:66145206-66145228 CATTAGAAGAGGGAGAGGGAGGG - Intronic
1128816183 15:70610277-70610299 CCTGGGAAGAAGGTCAGGGTGGG - Intergenic
1129867711 15:78922085-78922107 CTGGCGGAGAAGGAGAGGAACGG - Exonic
1130129830 15:81130836-81130858 CCTGAGGAGAGGGAGAGAGATGG + Intronic
1131071983 15:89471722-89471744 CCTGGGATGAAGGGGAGGGCAGG + Exonic
1131163951 15:90128824-90128846 CCTTCCAAGAAGGAGAAAGACGG + Intergenic
1131626034 15:94121932-94121954 CCTGGGGAGAAGGAGACAGAGGG - Intergenic
1132149885 15:99451869-99451891 CCTGGGCAGAAGGAGAGAGGAGG - Intergenic
1132258642 15:100401468-100401490 CCTGGGAGGAGGGATAGGGACGG - Exonic
1132330695 15:101010428-101010450 CCTGCGATGGAGAAGAAGGAAGG - Exonic
1132558314 16:582406-582428 CCTGCGATGAGGTACAGGGAGGG + Intronic
1133038164 16:3046212-3046234 CCTGGGGGGAAGGAGAGGGGCGG + Intergenic
1133485559 16:6215228-6215250 GAGGGGAAGAAGGAGAGGGAAGG + Intronic
1134271541 16:12737314-12737336 CATGGGAAGAAGGAGAAGAAGGG + Intronic
1134514162 16:14873401-14873423 GCTGCGGAGATGGAGAGCGACGG + Intronic
1134701804 16:16271900-16271922 GCTGCGGAGATGGAGAGCGACGG + Intronic
1134911724 16:18033104-18033126 CCTAAGAGGAAGGAGAAGGAAGG - Intergenic
1134970026 16:18522750-18522772 GCTGCGGAGATGGAGAGCGACGG - Intronic
1135169230 16:20168575-20168597 CCTGTGAAAGAAGAGAGGGAAGG + Intergenic
1135722905 16:24832353-24832375 CCAGTGGAGAAAGAGAGGGATGG + Intergenic
1137312267 16:47274985-47275007 TATGGGAAGAAGGGGAGGGAAGG + Intronic
1137315216 16:47312324-47312346 CCTGCTTAGAAGGAAAGGAAGGG - Intronic
1137391706 16:48086819-48086841 CCTGCAATGAAGGAGAGGAGAGG + Exonic
1137523195 16:49211214-49211236 CGTGGGGAGAGGGAGAGGGACGG + Intergenic
1137833013 16:51562323-51562345 TATGGGAAGAAGGAGGGGGATGG + Intergenic
1138686744 16:58733317-58733339 ACTGTGAACAAGGCGAGGGAAGG - Intronic
1138807244 16:60105071-60105093 AGTGCAAAGAAGGAGAGAGAAGG + Intergenic
1139062253 16:63266588-63266610 CTTGGGAGGGAGGAGAGGGAAGG - Intergenic
1139355156 16:66363248-66363270 CAGGCGAGGAAGGAGAGAGAAGG + Intergenic
1139471074 16:67178504-67178526 CCTGCGGGGAAGGCGAGGGGAGG + Exonic
1139673666 16:68508805-68508827 GCTGCAAAGCAGGAGATGGAAGG - Intergenic
1139998706 16:71005744-71005766 GCTGGGAAGAAGGAGAAAGAAGG + Intronic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1141522438 16:84590031-84590053 CCTGCAAGGAGGGAGAGGGCTGG - Intronic
1141638883 16:85329808-85329830 CCTGGGAAGAAGGCTGGGGACGG + Intergenic
1142107805 16:88315668-88315690 CCTGTGCAGAAGGTGGGGGAGGG + Intergenic
1142240311 16:88941734-88941756 CCTGCGGAGGGGGAGAGGGTGGG - Intronic
1142400382 16:89855468-89855490 CCTGCGAGCAAAGAGTGGGAGGG + Intronic
1142825154 17:2506258-2506280 CGTGGGGAGAGGGAGAGGGAGGG - Intronic
1142888963 17:2930496-2930518 CCTGCGAAGTAGGAAATGCAGGG - Intronic
1142986923 17:3700997-3701019 CCTGTGAGGGAGGAGAAGGAGGG - Intergenic
1143659276 17:8314884-8314906 CCTGTGGAGAAAGAAAGGGAAGG - Exonic
1144213433 17:13034294-13034316 TCTGCAAAGTAGGAGAGGGTGGG + Intergenic
1144261617 17:13527278-13527300 CTTTAGAAAAAGGAGAGGGAGGG + Intronic
1144274568 17:13653318-13653340 CCTGAGAAGAGAGAGAGAGAGGG - Intergenic
1145026905 17:19475325-19475347 CGTGGGGAGAGGGAGAGGGAGGG - Intergenic
1145277728 17:21444527-21444549 CCTGAGGAGAGGGAGAGAGATGG + Intergenic
1146672713 17:34752796-34752818 ACTGACATGAAGGAGAGGGAAGG - Intergenic
1146704294 17:34989405-34989427 TCTGAGAAGAAAGAAAGGGAAGG - Intronic
1147361565 17:39933947-39933969 GGTGGGAAGAAGGAGGGGGAGGG + Intergenic
1147424455 17:40339357-40339379 CCTGAGAAGGAGCTGAGGGAGGG + Intronic
1147599724 17:41738424-41738446 GATGAGAAGCAGGAGAGGGAGGG - Intergenic
1147622157 17:41875405-41875427 CGTGGGGAGAGGGAGAGGGAGGG - Intronic
1148049769 17:44764089-44764111 CTTGGGAACAAGGAGAGGGCAGG + Intronic
1148269761 17:46253749-46253771 CGTGGGGAGAGGGAGAGGGAGGG + Intergenic
1148278130 17:46324637-46324659 CCTGCAAAGAAGGCCAGGCACGG - Intronic
1148300338 17:46542492-46542514 CCTGCAAAGAAGGCCAGGCACGG - Intronic
1148336683 17:46846773-46846795 TCTGTGAGGAAGAAGAGGGAGGG + Intronic
1148698496 17:49575121-49575143 CCTGAGAAGCTGGAGAGTGAGGG - Intergenic
1149148242 17:53525573-53525595 CCAGCGAAGTAGGTGAGGCAAGG + Intergenic
1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG + Intronic
1150402163 17:64866825-64866847 CCTGCAAAGAAGGCCAGGCACGG + Intronic
1151119805 17:71780081-71780103 CCTGAGAAGAGGGAGAGAGATGG - Intergenic
1151347564 17:73511534-73511556 TCTGGGGAGGAGGAGAGGGAAGG + Intronic
1151482998 17:74381105-74381127 CCTGGGAAGAAGAAGAAGGGAGG - Intergenic
1151770174 17:76155556-76155578 CCTCAGAAGAAGGAGAGGTAAGG - Exonic
1151887908 17:76933936-76933958 CCAGCCAACAAGGAGAAGGAAGG + Intronic
1152011667 17:77722685-77722707 GCTGAGAAGGAGGAGAAGGAGGG - Intergenic
1152375761 17:79918252-79918274 CCTGTGCTGAAGGAGAGGGGTGG - Intergenic
1152580168 17:81162286-81162308 CCTGAGAGGAAGTAGGGGGATGG + Intronic
1152820550 17:82435667-82435689 CCTGCAAGGAAGGAGCAGGACGG - Exonic
1152970834 18:159100-159122 GCGGGGAAGAAGGGGAGGGATGG + Intronic
1153133182 18:1881396-1881418 CCTGAGGAGAGGGAGAGAGATGG + Intergenic
1153226419 18:2903416-2903438 CGTGGGAAGAAGGATGGGGAAGG - Intronic
1153292800 18:3518219-3518241 CCTGAGGAGAGGGAGAGAGATGG + Intronic
1153871730 18:9327343-9327365 CCTGAGGAGAGGGAGAGAGATGG - Intergenic
1155100400 18:22605112-22605134 CCTGGGATGGAGGTGAGGGATGG - Intergenic
1155741208 18:29290411-29290433 CCTGAGAAGAGGGAGACAGATGG - Intergenic
1156472870 18:37388434-37388456 ACAGAGAAGAAGGAGAGAGAAGG - Intronic
1156595564 18:38544031-38544053 ACTGAGGAGAGGGAGAGGGAGGG + Intergenic
1156674614 18:39512768-39512790 CATGAGGAGAAGGAGAAGGATGG - Intergenic
1156696918 18:39778585-39778607 CCTGGGGAGAAGGAGATAGAAGG + Intergenic
1157014359 18:43692755-43692777 CCTGCTAAGTAGGACAGGGCTGG + Intergenic
1157446376 18:47749438-47749460 CCTGGGGAGAAGCAGAGGGCGGG - Intergenic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1157584227 18:48790976-48790998 CCTGAGAAGATGGAGTGAGAAGG - Intronic
1157831368 18:50859779-50859801 CCTGCAGAGGAGGAGATGGAAGG - Intergenic
1159889924 18:73943638-73943660 CCTCCGGAGAAGGAAAGGCACGG + Intergenic
1159977138 18:74727968-74727990 GCTGGGGAGAAGGAGAGTGATGG + Intronic
1160228576 18:77029422-77029444 CGTGGGGAGAGGGAGAGGGAGGG + Intronic
1160422672 18:78758052-78758074 CCCGCCAAAATGGAGAGGGAGGG + Intergenic
1160667137 19:336173-336195 CCTGCGAAGGAAGAGAGGCAGGG + Exonic
1160874110 19:1289475-1289497 CCAGGGGAGGAGGAGAGGGAGGG - Intronic
1161166739 19:2791758-2791780 CATGTGAAGGAGGAGAGGAAAGG - Intronic
1161188256 19:2937652-2937674 CCTGCGAAGGAGGACAGTGCAGG + Intronic
1161573847 19:5044759-5044781 CCTGGGGCGCAGGAGAGGGATGG - Intronic
1162188057 19:8922622-8922644 GCTGCAAGGAAGGAGAGGGGAGG + Exonic
1162737028 19:12752376-12752398 CCTGAGATGAAGGTCAGGGAGGG + Intronic
1162841195 19:13357625-13357647 CCTGCATAGTAGGTGAGGGAAGG + Intronic
1163262511 19:16199694-16199716 CCTTCCAAGAAGGCGGGGGAGGG - Intronic
1164997718 19:32735000-32735022 CCTGGGGAGAGGGAGAGAGATGG - Intronic
1165233127 19:34399879-34399901 TCTGCCAAGAAGGGAAGGGAAGG - Exonic
1165313223 19:35040736-35040758 GCTGGGGAGAAGGAGAGGGAAGG + Intronic
1165802779 19:38563039-38563061 CGTGCAAAGAATGAGTGGGAAGG - Intronic
1167123280 19:47531845-47531867 CCTGAGATGCAGGAGAGAGAAGG - Intronic
1167756815 19:51417847-51417869 CCTGTGTAGGAGGAGAGGGCAGG + Intergenic
1168200671 19:54813191-54813213 CCAGCGATGAAGGAGAAAGAAGG - Intronic
1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG + Intronic
925658241 2:6173495-6173517 CCTGAGTAGAAGGAGAGAGTGGG - Intergenic
925953366 2:8937066-8937088 CCAGGGAAGAAGCAGAGGGGTGG - Intronic
926649452 2:15325983-15326005 CCCAAGAAGAAGGAGAGAGATGG + Intronic
926847638 2:17159814-17159836 TCTCCCAAGAGGGAGAGGGATGG + Intergenic
927029603 2:19106723-19106745 ACAGCAAAGATGGAGAGGGAGGG - Intergenic
927597850 2:24412960-24412982 CCTGGGAAACAGGAGCGGGAAGG - Intergenic
927696822 2:25244861-25244883 CCTGAGAACAAGGCCAGGGAGGG + Intronic
927716682 2:25357752-25357774 CCTTAGAAGCGGGAGAGGGAGGG + Intergenic
929097614 2:38278841-38278863 CCTGAGGAGAGGGAGAGTGATGG + Intergenic
929749966 2:44700553-44700575 CCTGGGGAGAGGGAGAGAGATGG + Intronic
929890041 2:45911284-45911306 CCTGAGAAGAAAGGTAGGGAAGG - Intronic
930826542 2:55701405-55701427 GCAGGGAAGAAGGAGAGAGAGGG + Intergenic
931263495 2:60640129-60640151 CCTGGAAGGAGGGAGAGGGAGGG - Intergenic
931279608 2:60777779-60777801 CCTGAGGAGAGGGAGAGAGATGG + Intronic
931868471 2:66435279-66435301 CTTGCAAAGAGGGAGAGAGAGGG + Intronic
932047604 2:68365382-68365404 CTTGTGAAGAAGGTGAGCGAAGG + Exonic
932286458 2:70537252-70537274 CCTGAGGAGAAGGAGAGAGATGG - Intronic
932353118 2:71047727-71047749 CCTCCGAAGGAGGCAAGGGAAGG + Intergenic
932434450 2:71695003-71695025 GCTGGGAGGAAGGAGAGTGATGG + Intergenic
933214321 2:79610693-79610715 CCTGTGAAGAAGGGATGGGATGG + Intronic
933302033 2:80552031-80552053 CTTGAGAAGAGGGAGAGAGATGG + Intronic
933944552 2:87274410-87274432 CTTGAGAAGAGGGAGAGAGATGG + Intergenic
934904202 2:98184831-98184853 CGTGGGAAGAAGGAGAGAGAAGG - Intronic
936335660 2:111587171-111587193 CTTGAGAAGAGGGAGAGAGATGG - Intergenic
936719789 2:115237402-115237424 CCTGCGGAAAAGGAGATAGATGG - Intronic
936970274 2:118170090-118170112 TCTGCTAAGAGTGAGAGGGAAGG - Intergenic
937437422 2:121892067-121892089 CGTGGGGAGAGGGAGAGGGAGGG - Intergenic
938305893 2:130253770-130253792 CCTGCGACAGAGGAGAGGTAAGG - Intergenic
938424657 2:131174971-131174993 CCTGAGAAGAAGGAGAGAGCTGG + Intronic
939187526 2:138878368-138878390 CTTGGGAAGCAGGACAGGGAAGG + Intergenic
939817386 2:146912463-146912485 CCTGAGGAGAGGGAGAGAGATGG - Intergenic
941346661 2:164377481-164377503 CCTGCCCAGAAGCAGGGGGATGG + Intergenic
941432301 2:165427079-165427101 CCTGGGAAGGAGGTGGGGGATGG + Intergenic
941444234 2:165581352-165581374 CCTGCTGACAAAGAGAGGGACGG - Intronic
941637016 2:167945772-167945794 CTGGCGAAAAAGGAGAGGCAGGG - Intergenic
941814988 2:169787347-169787369 CGTGGGGAGAGGGAGAGGGAGGG + Intergenic
942484236 2:176422545-176422567 CCTTCAAAGAAGCAGAGGGGTGG + Intergenic
943905694 2:193499153-193499175 CCTGAGGAGAAGGAGAGAAAAGG - Intergenic
945028653 2:205643258-205643280 AGTGGGAAGAAGGAGAGAGAGGG - Intergenic
945109988 2:206353512-206353534 CCTGGTAAGAACTAGAGGGAAGG - Intergenic
945487235 2:210411031-210411053 CCTGATAAGAAGGAGAGAGATGG + Intergenic
945674470 2:212839279-212839301 CCTGAGACGAGGCAGAGGGATGG + Intergenic
946407089 2:219497524-219497546 CCCGAGAAGTAGGAGAGGCAGGG + Intronic
947564437 2:231185215-231185237 CCTGCGGGGAAGGACAGGCAGGG - Intergenic
947770706 2:232668091-232668113 ACTGTGAAGAAAGAGGGGGAGGG - Intronic
947900097 2:233714051-233714073 ACTGAGAGGAAGGAGAGGCAGGG + Intronic
1169152079 20:3297273-3297295 CCTGCCAAGAAGCAGAGGGATGG + Intronic
1169541651 20:6606336-6606358 CCGAAGAAGAAAGAGAGGGAGGG - Intergenic
1169653887 20:7900657-7900679 CCTGAGGAGAGGGAGAGAGATGG - Intronic
1169836701 20:9888277-9888299 CCTGAGGAGAGGGAGAGAGATGG + Intergenic
1170110060 20:12795427-12795449 CATGGGAAAAAGGAGAAGGAGGG - Intergenic
1171519002 20:25761326-25761348 CCTCAGAAGAAGCAGAGGGAGGG - Intergenic
1171848656 20:30292663-30292685 CGTGGGGAGAGGGAGAGGGAGGG + Intergenic
1172028833 20:31967914-31967936 CCTCCGAGGAAGGAGGGAGAGGG + Intergenic
1172058877 20:32175352-32175374 CGTGGGGAGAGGGAGAGGGAGGG - Intergenic
1172223915 20:33291621-33291643 CCTGCTAAGAAGGGAAGGGGGGG - Intronic
1172640020 20:36435364-36435386 CCGGCTCAGAAGGACAGGGAAGG + Intronic
1172970749 20:38871498-38871520 TGTGGGAAGAAGGAGAGAGAAGG + Intronic
1173336135 20:42113685-42113707 AGTGGGAAGCAGGAGAGGGAAGG - Intronic
1173402933 20:42740769-42740791 CCTCCGAGGAAGGAGAGAGAGGG + Intronic
1173464663 20:43271499-43271521 CCTGAGGAGAAGTGGAGGGAGGG - Intergenic
1173648935 20:44651061-44651083 CCTGCCAGAAAGGGGAGGGAGGG - Intronic
1173768229 20:45633200-45633222 CCTGAGGAGAGGGAGAGAGATGG - Intergenic
1173790001 20:45822398-45822420 TATGGGAAGAAAGAGAGGGAGGG + Intergenic
1173802428 20:45902659-45902681 CCAGGGAAGAAGGGGAAGGAAGG + Intronic
1174218019 20:48932115-48932137 CCTGAGAAGGCGGATAGGGATGG + Intronic
1174506764 20:51022510-51022532 CCTGGGAGGAAGGAGAGTTAGGG - Intronic
1175883586 20:62274708-62274730 CCTGGGGAGAAGGAGCTGGAGGG + Intronic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1179997431 21:44980468-44980490 CCTGAGAAGAAGGGGAGGGCCGG - Intergenic
1180465811 22:15609080-15609102 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1180673862 22:17573648-17573670 CCTGCAGGGAAGGAGAGAGATGG - Intronic
1181185922 22:21103682-21103704 CCTGTGTAGAGGGAGAGAGAGGG + Intergenic
1181520325 22:23444835-23444857 CCTAAGGAGAAGGAGAGAGATGG + Intergenic
1181573027 22:23778127-23778149 CCTGCACTGAAGGAGAGGGATGG - Intronic
1182106809 22:27695533-27695555 CCTGTCAAGAAAGAAAGGGAAGG + Intergenic
1183485695 22:38086598-38086620 CCTGAGAGGAGGCAGAGGGATGG + Intronic
1183595041 22:38806315-38806337 CGTGGGGAGAGGGAGAGGGAGGG - Intergenic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1183806956 22:40219740-40219762 CCTTCGGATAAGGTGAGGGAAGG - Intronic
1183956659 22:41384449-41384471 TCTGGGAGGAAGGAGAGGGGTGG - Intronic
1184014378 22:41774900-41774922 ACTGGGCAGAAGGAGAGGGATGG - Intronic
1184142078 22:42583787-42583809 CCTGTGCAGAAGGAGAGGAAGGG - Exonic
1184959320 22:47917743-47917765 CTAGGGAGGAAGGAGAGGGAGGG - Intergenic
1185192258 22:49446401-49446423 CCTGCGGAGCTGGAGAGGGAGGG - Intronic
949354497 3:3164097-3164119 CCTGAGGAGAGGGAGAGAGATGG - Intronic
949922004 3:9010297-9010319 CCAGCGATGAAGGTGAGTGAGGG - Exonic
950549320 3:13656603-13656625 CCTGGGAAGAAGGAGACAGCCGG - Intergenic
951521277 3:23612610-23612632 TCTGTGAAAAAGGAGAGAGAGGG + Intergenic
951862962 3:27274191-27274213 CCAGGGATGAGGGAGAGGGAAGG + Intronic
952003669 3:28815798-28815820 CCTGAAGAGAAGGAGAGAGAGGG + Intergenic
952630694 3:35462517-35462539 CCTGTTAAGAAGGAGAGCCAGGG - Intergenic
952899930 3:38103793-38103815 CCTGAGGAGAGGGAGAGAGACGG + Intronic
953387271 3:42513727-42513749 CCTGAGAACAAAGACAGGGAGGG - Exonic
953636721 3:44670730-44670752 CCTGTGAGGAAGGAGCAGGATGG + Intergenic
954400370 3:50316461-50316483 CCGGCGAAAGAGGTGAGGGAAGG + Intergenic
955211157 3:56942506-56942528 CCTGAGGAGAGGGAGAGAGATGG - Intronic
955226648 3:57065755-57065777 CCTGCGGAACAGGAGAGGCAAGG + Intronic
955262731 3:57410458-57410480 TCTGAGAAGAGGGAGAGAGATGG - Intronic
955290345 3:57686771-57686793 CCTGAGGAGAGGGAGAGAGATGG - Intronic
955416613 3:58697869-58697891 CCTGAGGAGAGGGAGAGAGATGG + Intergenic
956125041 3:66003233-66003255 GCTGGTAAGAAGGAGAGGGAAGG - Intronic
956398740 3:68853505-68853527 TCTGGGAAGAAGGAGAGGATGGG + Intronic
956737626 3:72250250-72250272 CCTACAAAAAAGGAAAGGGAAGG + Intergenic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
957518661 3:81290094-81290116 TCTGAGGAGAAGGAGAGAGAGGG + Intergenic
958075684 3:88674702-88674724 CCTGAAAAGACGGAGAGAGAAGG - Intergenic
958566282 3:95815542-95815564 ACTGAGAGGCAGGAGAGGGAGGG + Intergenic
958933080 3:100228485-100228507 CCTGAGAAGAGGGAGAGAGATGG - Intergenic
959500389 3:107099885-107099907 CCAGGGAAGGAAGAGAGGGAGGG + Intergenic
960258866 3:115542032-115542054 CCTGAGGAGAGGGAGAGAGATGG + Intergenic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
961394990 3:126580415-126580437 CCTGCTCAGAAGGAGGGGGCCGG + Intronic
962060739 3:131924276-131924298 TCAGTGAAGAAGGAGTGGGAGGG + Intronic
962745697 3:138396087-138396109 CCAGTGGAGAAGGGGAGGGAAGG + Intronic
963323447 3:143835121-143835143 CCTGTGAAGAGAGAGAAGGAAGG - Intronic
963366185 3:144337473-144337495 CATGAGAGGAAGGAGGGGGAAGG - Intergenic
964195799 3:154062876-154062898 CCTGCGCAGAGACAGAGGGAGGG - Intergenic
965347732 3:167572920-167572942 CCTGAGGAGAAGCAGAGGTAGGG + Intronic
965861155 3:173152063-173152085 CCTGAAGAGAGGGAGAGGGATGG + Intergenic
966734803 3:183179968-183179990 CCTGAGGAGGGGGAGAGGGATGG + Intronic
967710786 3:192705358-192705380 CCTGAGAAGAGGGAGAAAGATGG + Intronic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
968716797 4:2166220-2166242 ACTGAGAAGAATGGGAGGGATGG - Intronic
968874417 4:3257836-3257858 CCTGCCGAGAAGCAGAAGGAAGG + Intronic
970424259 4:15931848-15931870 CCTCTGAAGAATGGGAGGGATGG - Intergenic
971242905 4:24904820-24904842 CCTGCACTGAAGAAGAGGGATGG - Intronic
971563913 4:28115488-28115510 CATGGGAAGAGAGAGAGGGAGGG - Intergenic
971823821 4:31595494-31595516 CCTGAGAAGAAGGAAAAAGAGGG - Intergenic
971830838 4:31692612-31692634 CCAGAGAAGAGGGAGAGAGATGG - Intergenic
972281727 4:37608136-37608158 CCTGAGGAGAGGGAGAGAGACGG - Intronic
972383713 4:38543339-38543361 CCTGAGGAGAAGGAGGGAGATGG + Intergenic
973636252 4:52863681-52863703 CCAGCAGAGAAGGAGAGGGGTGG - Intronic
974160147 4:58128384-58128406 CTTGAGAGGAAAGAGAGGGAGGG - Intergenic
975475711 4:74821165-74821187 CCTGGGAAGAAGGTGAGAGCAGG - Intergenic
975964103 4:79948746-79948768 AATGCAAAGAAGGAGAAGGAAGG + Intronic
976203470 4:82602081-82602103 CCTCCATAGAAGGAAAGGGAAGG - Intergenic
976415329 4:84767331-84767353 CCTGAGAAGAGTGAGAGAGATGG - Intronic
977024660 4:91802129-91802151 CCTCAGGAGAAGGAGAGGGATGG - Intergenic
977069750 4:92370302-92370324 ACTGAGAAGAGGGAGAGAGATGG - Intronic
977915732 4:102590682-102590704 CCTGAGGAGAGGGAGAGAGATGG - Intronic
978304147 4:107303808-107303830 CCTGAGGAGAAGGAGAGAGATGG + Intergenic
979523033 4:121690040-121690062 CCAGAGGAGAAGGAAAGGGAAGG + Intronic
981455468 4:144948206-144948228 CCTGAGAAGAAGGAGTGGCCTGG - Intergenic
982439101 4:155414043-155414065 CCTGAGCAGAGGGAGAGAGATGG + Intergenic
983290244 4:165793591-165793613 CCTGAGGAGAGGGAGAGAGATGG + Intergenic
983615795 4:169702973-169702995 CCTGAGAAGAGGGAGAGACAGGG + Intronic
983963244 4:173779396-173779418 CCTGAGAAGAGGGAGAGACATGG - Intergenic
984274655 4:177595535-177595557 CCTGCAAAGAATAAGAGGGAAGG - Intergenic
984577784 4:181472043-181472065 CCTGGGAGAAAGGAGAGAGAAGG + Intergenic
984632311 4:182073867-182073889 TCTGTGAACAAAGAGAGGGATGG - Intergenic
984637136 4:182123517-182123539 CCTGAGGAGAGGGAGAGAGATGG + Intergenic
984952525 4:185018025-185018047 CCCGCGAAGAGGGAGCAGGAGGG + Intergenic
985088080 4:186334854-186334876 CCTGAGAAAAGGGAGAGAGATGG - Intergenic
985311104 4:188600417-188600439 CCTGAGGAGAAGGACAGAGATGG + Intergenic
986408401 5:7450012-7450034 CCTGAGAAGAGGGAGGGAGATGG - Intronic
986822349 5:11481595-11481617 CCTGGAGAGAGGGAGAGGGAGGG + Intronic
987178174 5:15338347-15338369 ATTGGGTAGAAGGAGAGGGAGGG - Intergenic
987242348 5:16013457-16013479 ACTGAGAAGAGGGAGAGAGATGG + Intergenic
987726660 5:21709404-21709426 CCTGAGGAGAAGGAAAGAGATGG - Intergenic
987827781 5:23055844-23055866 GCTGAGAATAAGGAGAGTGAAGG + Intergenic
987935537 5:24459099-24459121 CCTGACAAGAGGGAGAGAGATGG + Intergenic
988278688 5:29115416-29115438 CCCGAGAAGAGGGAGAGAGATGG + Intergenic
988655522 5:33207307-33207329 CCTGAGGAGAGGGAGAGAGAAGG - Intergenic
988821579 5:34891475-34891497 TCTGTGAAGAAGGGGAAGGAAGG - Intronic
990481581 5:56216317-56216339 CCTGAGGAGAGGGAGAGAGATGG - Intronic
991137918 5:63205064-63205086 CGTGGGTAGAAGGAGAGCGATGG + Intergenic
992751565 5:79867362-79867384 CTTGGGAAGAAGGAGAAGAATGG - Intergenic
993400460 5:87443498-87443520 CCTGAGAAGAGGGAGAGAGATGG + Intergenic
994020048 5:95012770-95012792 CCTGAGGAGAAGGAGAGAGATGG - Intronic
994255377 5:97587249-97587271 CCTGCTAAGAAGGAGGCGGAAGG + Intergenic
995135414 5:108674884-108674906 CCTGTGAAGAGAGAGAAGGAAGG - Intergenic
995938152 5:117544601-117544623 CCTGGGTAGTAGGAGATGGAAGG - Intergenic
996354897 5:122584918-122584940 CCAGCCTAGAAGAAGAGGGAGGG + Intergenic
997253247 5:132407613-132407635 CCTGTGAAAGAGAAGAGGGAAGG + Intergenic
997566648 5:134892813-134892835 CCTGAGGAGAGGGAGAGAGATGG + Intronic
997577980 5:134997415-134997437 CATGAAGAGAAGGAGAGGGAGGG - Intronic
998025474 5:138811930-138811952 CGTGGGGAGAGGGAGAGGGAGGG + Intronic
1000129271 5:158279744-158279766 CCTGAGGAGATGGAGAGAGATGG - Intergenic
1000217766 5:159180096-159180118 GTAGGGAAGAAGGAGAGGGAGGG + Intronic
1000274193 5:159718393-159718415 CCAGGGATGAAGGAGTGGGAAGG + Intergenic
1000389260 5:160706008-160706030 CCCACGAAGAGGGAGAGAGATGG + Intronic
1001191551 5:169637203-169637225 CCGGCGAGGGAGGAGAGGGCGGG + Intergenic
1001548670 5:172586704-172586726 CCTGCTAAGAAAGAGAACGAGGG - Intergenic
1001718861 5:173840177-173840199 TCTGAGGAGAAGGAGAGGGCAGG + Intergenic
1001926915 5:175644246-175644268 CCAGCAAAGAAGGAGAAGAAAGG + Intergenic
1001960689 5:175878886-175878908 CCTACGAGGAAGGGGTGGGAAGG - Exonic
1002534703 5:179869834-179869856 CCTGTGGAGAAGGCCAGGGAGGG + Exonic
1002899507 6:1399256-1399278 ACGGAGAAGAAAGAGAGGGAGGG + Intergenic
1003302137 6:4893323-4893345 CCTGAGCAGATGGAGAGGAAGGG - Intronic
1003949059 6:11101495-11101517 CTTCCGAAGGAGGAGATGGAAGG + Intronic
1003984645 6:11423652-11423674 CTTGTGAAGAAAGAGGGGGAGGG + Intergenic
1004226063 6:13785332-13785354 CCTGCTCAGGAGGAGAGGAAAGG - Intergenic
1006014367 6:31068128-31068150 CGTGGGGAGAGGGAGAGGGAGGG + Intergenic
1006137782 6:31906419-31906441 CCTCCGAGGTAGGAGGGGGAGGG - Intronic
1006394489 6:33778204-33778226 ACTGCACAGAAGGGGAGGGAAGG + Intronic
1006428473 6:33980638-33980660 CCTGAGAGTAAGGAGAGGCAGGG + Intergenic
1006806773 6:36793961-36793983 CCGGGAAAGAAGGGGAGGGAAGG + Intronic
1007520929 6:42451627-42451649 CATGGGGAGGAGGAGAGGGAGGG - Intronic
1007616852 6:43184917-43184939 CCAGGGAAGAAGGAAAGGAATGG + Intronic
1007651338 6:43424621-43424643 CGTGGGGAGAGGGAGAGGGAGGG - Intergenic
1007685288 6:43663578-43663600 CCTGAGGAGAGGGAGAGGGCTGG + Intronic
1007877069 6:45116213-45116235 TGTGAGAAGAAGGAGAGGAAGGG - Intronic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1010736911 6:79453489-79453511 TCTGAGAAGAAGGAGAGGAAGGG - Intergenic
1011587907 6:88946664-88946686 CGTGGGGAGAGGGAGAGGGAGGG - Intronic
1012472983 6:99591207-99591229 CCTGAGAGGACGGAAAGGGAAGG - Intergenic
1012564890 6:100636429-100636451 CCTGAGGAGAAGGAAAGAGATGG - Intronic
1012992670 6:105941908-105941930 AGTGAGAAAAAGGAGAGGGAGGG + Intergenic
1013190739 6:107802728-107802750 CGTGGGGAGAGGGAGAGGGAGGG - Intronic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1013414214 6:109910210-109910232 CCTGAGAAGAACAGGAGGGAAGG - Intergenic
1013729753 6:113151186-113151208 CCTGGGCAGAAGGAGAGAGAAGG + Intergenic
1014741400 6:125151602-125151624 CCTAAGAAGAGGGAGAGAGATGG - Intronic
1015906634 6:138123648-138123670 GCAGAGAAGATGGAGAGGGATGG - Intergenic
1015922700 6:138281463-138281485 ACTGCAAGGCAGGAGAGGGAGGG - Intronic
1016486299 6:144543295-144543317 CCTGGGAAGCAGGTGGGGGATGG + Intronic
1016616938 6:146061057-146061079 CCTGTGGAGAGGGAGAGAGATGG + Intronic
1017117499 6:150992431-150992453 CATGGGAAGAAGTAGAGGGGTGG + Intronic
1017694419 6:157000188-157000210 CCTGGGAGGCTGGAGAGGGAGGG + Intronic
1017735384 6:157358187-157358209 ACTGCAAAGATTGAGAGGGAGGG - Intergenic
1017971478 6:159315767-159315789 CCTGCGGGGAGGGAGAGGGAAGG - Intergenic
1018149796 6:160926972-160926994 TCTGCGAGGAGGGAAAGGGACGG - Intergenic
1018205608 6:161434917-161434939 TCTGGGAGGAAGGAGAGGGGAGG + Intronic
1019155271 6:170034288-170034310 CCTGGAGAGAAGGGGAGGGAAGG + Intergenic
1019375125 7:686430-686452 ACTGGGAAGATGGAGAGAGAAGG + Intronic
1019508222 7:1404113-1404135 CCTGGGAACACGGAGAGGGGAGG - Intergenic
1019590917 7:1831393-1831415 CCTAAGGAGAAGGAGAGAGATGG - Intronic
1019943981 7:4312212-4312234 CCAGAGCAGAAGCAGAGGGAGGG - Intergenic
1020129052 7:5549180-5549202 AGAGGGAAGAAGGAGAGGGAAGG + Intronic
1021469172 7:20981661-20981683 GATGAGAAGAAGGGGAGGGAGGG - Intergenic
1023160405 7:37291932-37291954 CGTGGGCAGAGGGAGAGGGAGGG - Intronic
1023167707 7:37359184-37359206 CCTGCAAGGAAGGAGTAGGAAGG - Intronic
1024953628 7:54892345-54892367 CCTGGGATGGAGGAGATGGAGGG - Intergenic
1026775035 7:73226069-73226091 CCTGCCAGGTGGGAGAGGGAAGG + Intergenic
1027015891 7:74779440-74779462 CCTGCCAGGTGGGAGAGGGAAGG + Intronic
1027072138 7:75166497-75166519 CCTGCCAGGTGGGAGAGGGAAGG - Intergenic
1027874536 7:83751569-83751591 CCTGCTAAGCAGGAAAGAGAAGG - Intergenic
1028033811 7:85953166-85953188 CTTGAGAAGAAGGAGAGAAAAGG - Intergenic
1028178308 7:87683540-87683562 CCTGAGGAGAAAGAGAGAGATGG + Intronic
1028695969 7:93712959-93712981 CCTGGGAAGAAGGAGAGAGATGG - Intronic
1029580877 7:101436011-101436033 CCCGCTAAGGAGGAGAGGCAGGG - Intronic
1030706504 7:112698039-112698061 CGTGGGAAGAGGGAGAGGGAGGG + Intergenic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1031878373 7:127167739-127167761 TCTGAGAAGAAGGAGGGAGATGG - Intronic
1032948716 7:136882440-136882462 GCTGAGAAGAAGGAGGGGGAAGG - Intronic
1032993065 7:137415156-137415178 CCTGCGTTGAAGGACAAGGAAGG + Intronic
1033241599 7:139684246-139684268 CCCGAGAAGAAGGAGAGAGATGG - Intronic
1033273491 7:139953726-139953748 CCTGCGCCTAAGGACAGGGATGG + Intronic
1033292866 7:140102909-140102931 CCTCTGGAGAATGAGAGGGATGG - Intronic
1033356871 7:140607279-140607301 CTTGGGAACAAGGAGAGGAAGGG + Intronic
1033393853 7:140955465-140955487 CCCAAGAAGAAGGAGAGAGATGG - Intergenic
1033520822 7:142158702-142158724 CCTGTGGAGAAGAAAAGGGAGGG + Intronic
1033971832 7:147050658-147050680 CCTGGGAAGAATGAGAGTGAGGG - Intronic
1034261805 7:149761540-149761562 CCCGGGGAGAAGGAGAGAGAAGG - Intergenic
1034551711 7:151824851-151824873 ACTCAGAAGAAAGAGAGGGAAGG - Intronic
1035021270 7:155802397-155802419 GCTGAGAAGCAGGAGATGGAAGG + Exonic
1035072681 7:156156868-156156890 CCTGGGAAGAAGGAGTGAGTTGG - Intergenic
1035555691 8:565630-565652 CCTGAGAAGAAGGAGTGGCGTGG - Intergenic
1035704428 8:1664316-1664338 CCTGGGAAGCAGGAGTAGGACGG - Intronic
1036530773 8:9584326-9584348 ACTGCAAAGAAGTAGAAGGAAGG - Intronic
1037435621 8:18860152-18860174 CCCGAGAAGAGGGAGAGAGAGGG + Intronic
1038130294 8:24723249-24723271 CCTGAGGAAAGGGAGAGGGATGG - Intergenic
1039192301 8:34990483-34990505 CCTGAAAAGAGGGAGAGAGAGGG - Intergenic
1039819509 8:41123669-41123691 CCAGGGCAGAAGGAGAGGAAGGG - Intergenic
1039856137 8:41416020-41416042 CCTGCTGAGAAAGAGAAGGAAGG + Intergenic
1039862961 8:41475012-41475034 CCAGTGATGAGGGAGAGGGAAGG - Intergenic
1040552016 8:48445069-48445091 CAAGCAAAGAAGGAGAGAGACGG + Intergenic
1041392412 8:57358781-57358803 CCAGAGAAGAAAGAGAGGGAAGG - Intergenic
1041600449 8:59711435-59711457 CATGTGAAGAAGCAGAGAGAAGG + Intergenic
1042882412 8:73508358-73508380 CCTGAGGAGATGGAGAGAGATGG + Intronic
1042906375 8:73776402-73776424 CCTGTGAAGACTGAGAGGGTAGG + Intronic
1043687921 8:83111422-83111444 CCTGAAGAGAAGGAGAGAGATGG + Intergenic
1044337282 8:91002132-91002154 CCTTGGAAGAATGAGAGAGAAGG - Intronic
1045195486 8:99926594-99926616 CGTGGGGAGAGGGAGAGGGAGGG - Intergenic
1045664864 8:104473457-104473479 CCTTAGAAGAAGGAGACTGAGGG - Intergenic
1046289088 8:112133912-112133934 CATGTGAAGAATGAGAGGTAAGG + Intergenic
1046571754 8:115974932-115974954 CCTGAGAAGAAGGAGAGAGATGG + Intergenic
1047009896 8:120660881-120660903 CCTGAGGAGAGGGAGAGAGATGG + Intronic
1047486561 8:125336190-125336212 CCAGGGAAGAAGGAAAGGAAAGG + Intronic
1048517449 8:135123800-135123822 CAGGAGAAGAAGGAAAGGGAAGG - Intergenic
1049206733 8:141367086-141367108 CCAGCCAAGCAGGAGTGGGAAGG - Intronic
1049391146 8:142372349-142372371 CCAGCGAAGGATGAGTGGGAGGG + Intronic
1049391332 8:142373136-142373158 CATGAGAAGAAAGAGAGGAAGGG + Intronic
1050203517 9:3174477-3174499 ACTTCGAAGAAGAAGAGGTATGG - Intergenic
1050792585 9:9493011-9493033 CCTGAGGAGAGGGAGAGTGATGG - Intronic
1050978371 9:11972730-11972752 CTTGGAAAGAAGGAGATGGATGG - Intergenic
1051064383 9:13084833-13084855 CCTGAGAAGAGGGAGCGAGATGG - Intergenic
1051663230 9:19444677-19444699 CCTGGAGAGAAGGAGAGGGTGGG + Intronic
1051840457 9:21391951-21391973 GCTGCGAAGCAGGAGGAGGAAGG + Intergenic
1051967939 9:22851796-22851818 CATGAGAAGAGGGAGAGAGATGG + Intergenic
1053580548 9:39399494-39399516 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1053845044 9:42227568-42227590 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1054102135 9:60958299-60958321 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1054584224 9:66948564-66948586 ACTGAGAAGAAGGAGAAGGAGGG + Intergenic
1055150680 9:72995261-72995283 CTTGAGGAGAAGGAGAGAGATGG - Intronic
1055402411 9:75938292-75938314 CCTGGGGAGAGGGAGAGAGATGG + Intronic
1055581500 9:77711192-77711214 CCTTCAGAGAAGGAGGGGGAGGG - Intergenic
1056244483 9:84680665-84680687 CAGGAGCAGAAGGAGAGGGAGGG - Intronic
1056531629 9:87493156-87493178 CATGAGATGAAGGAGAAGGAAGG - Intergenic
1056856015 9:90130302-90130324 CATATGAAGGAGGAGAGGGAAGG + Intergenic
1057430194 9:94987068-94987090 CATGGGAAGAAGGATAGGAAAGG - Intronic
1057487228 9:95495082-95495104 CCTGCACAGATGCAGAGGGAAGG - Intronic
1058735333 9:107888940-107888962 CCTGGGCAGAAGGAGAGGGCTGG - Intergenic
1059168818 9:112104860-112104882 TCTACAAAGAAGGAGAGGGAAGG + Intronic
1061043738 9:128153484-128153506 CCTTCGAGGAAGGGGAGGGGCGG + Intergenic
1061293875 9:129666744-129666766 CTTGGTAAGAAGGGGAGGGACGG + Intronic
1061449046 9:130658971-130658993 CCAGGGAAGACGGACAGGGAGGG + Intergenic
1061537843 9:131260555-131260577 ACTGAGAAAAAGGAGAGGCAAGG + Exonic
1062164555 9:135100984-135101006 CCTGGGAAGAGGGAGGAGGAAGG - Intronic
1062182262 9:135196758-135196780 AGTGGGAAGAAGAAGAGGGAAGG - Intergenic
1185545488 X:940707-940729 CCTGTGAGGACAGAGAGGGAAGG + Intergenic
1186163282 X:6800902-6800924 TCAGCGAAGATGGAGAGGAAGGG - Intergenic
1186859139 X:13653779-13653801 CCTGAGAAGAACGAGAGGAAAGG - Intronic
1187485085 X:19695575-19695597 CCTACCAAGCAGGAGAGGGGCGG - Intronic
1188291445 X:28393610-28393632 CCTGAGGAGAAGGAGAGAGATGG + Intergenic
1188448216 X:30279978-30280000 CCTGAGAAGAGGGAGCGAGATGG - Intergenic
1189300125 X:39946513-39946535 CATGAGAAGGAGGAAAGGGAAGG - Intergenic
1190486606 X:50932491-50932513 CCTGAGAAGAGGAAGAGAGATGG - Intergenic
1191717062 X:64200937-64200959 GCTGAGCAGATGGAGAGGGAGGG + Intronic
1192513317 X:71739526-71739548 GCTGGGAAGTAGGAGAGGCATGG - Intergenic
1192513380 X:71741987-71742009 GCTGGGAAGTAGGAGAGGCATGG + Intergenic
1193186104 X:78514588-78514610 CCTGGGAAGGGAGAGAGGGAGGG + Intergenic
1195208461 X:102626750-102626772 CCTATGAAGAATGAGGGGGAAGG - Intergenic
1195543616 X:106090054-106090076 CATGGAAAGGAGGAGAGGGAAGG - Intergenic
1195614425 X:106901384-106901406 CTTGTGAAGCAGGAGAGGGGAGG - Intronic
1195619176 X:106935953-106935975 CCTGAGAAGTTGGAGAGGGAAGG + Intronic
1195658785 X:107358658-107358680 GAAGTGAAGAAGGAGAGGGAGGG + Intergenic
1195710189 X:107767224-107767246 CCTTCGAGGAAGGATGGGGAAGG + Intronic
1196599227 X:117583037-117583059 CCAGAGCAGAAGGAGAGGGGAGG - Intergenic
1197231361 X:124007180-124007202 TCTACAAAAAAGGAGAGGGAGGG - Intronic
1198281416 X:135146519-135146541 CCTGAGGAGAAGGAGAGAGATGG + Intergenic
1198289543 X:135225997-135226019 CCTGAGGAGAAGGAGAGAGATGG - Intergenic
1199196635 X:145039536-145039558 CCAGAGAAGAGGGAGAGAGATGG - Intergenic
1199577600 X:149328402-149328424 CCTGAGTAGAAGGAGAGAGATGG - Intergenic
1201462839 Y:14246460-14246482 CCTGCTAAGAAGAATAGTGATGG - Intergenic