ID: 1149651600

View in Genome Browser
Species Human (GRCh38)
Location 17:58279519-58279541
Sequence GCACCTGTTGTTGCACATCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149651593_1149651600 -7 Left 1149651593 17:58279503-58279525 CCACCCCCAGCCAGCCGCACCTG 0: 1
1: 0
2: 6
3: 94
4: 1001
Right 1149651600 17:58279519-58279541 GCACCTGTTGTTGCACATCCCGG 0: 1
1: 0
2: 0
3: 16
4: 140
1149651590_1149651600 7 Left 1149651590 17:58279489-58279511 CCCGGTTCCTGCAGCCACCCCCA 0: 1
1: 2
2: 9
3: 65
4: 475
Right 1149651600 17:58279519-58279541 GCACCTGTTGTTGCACATCCCGG 0: 1
1: 0
2: 0
3: 16
4: 140
1149651592_1149651600 0 Left 1149651592 17:58279496-58279518 CCTGCAGCCACCCCCAGCCAGCC 0: 1
1: 0
2: 8
3: 131
4: 816
Right 1149651600 17:58279519-58279541 GCACCTGTTGTTGCACATCCCGG 0: 1
1: 0
2: 0
3: 16
4: 140
1149651594_1149651600 -10 Left 1149651594 17:58279506-58279528 CCCCCAGCCAGCCGCACCTGTTG 0: 1
1: 0
2: 1
3: 26
4: 185
Right 1149651600 17:58279519-58279541 GCACCTGTTGTTGCACATCCCGG 0: 1
1: 0
2: 0
3: 16
4: 140
1149651591_1149651600 6 Left 1149651591 17:58279490-58279512 CCGGTTCCTGCAGCCACCCCCAG 0: 1
1: 0
2: 4
3: 59
4: 544
Right 1149651600 17:58279519-58279541 GCACCTGTTGTTGCACATCCCGG 0: 1
1: 0
2: 0
3: 16
4: 140
1149651587_1149651600 25 Left 1149651587 17:58279471-58279493 CCGGGACGCCTCTCTGAGCCCGG 0: 1
1: 0
2: 1
3: 11
4: 159
Right 1149651600 17:58279519-58279541 GCACCTGTTGTTGCACATCCCGG 0: 1
1: 0
2: 0
3: 16
4: 140
1149651589_1149651600 17 Left 1149651589 17:58279479-58279501 CCTCTCTGAGCCCGGTTCCTGCA 0: 1
1: 0
2: 1
3: 29
4: 276
Right 1149651600 17:58279519-58279541 GCACCTGTTGTTGCACATCCCGG 0: 1
1: 0
2: 0
3: 16
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149651600 Original CRISPR GCACCTGTTGTTGCACATCC CGG Exonic
902225712 1:14995277-14995299 GCATCTGCTGCTCCACATCCCGG + Intronic
904428590 1:30447417-30447439 GCACCTGCCCTTGCACTTCCAGG + Intergenic
904613554 1:31738084-31738106 GCACCTGCAGATGCACATTCAGG + Intronic
904642366 1:31939986-31940008 CCACCTGGTGGTGAACATCCTGG - Intronic
907585407 1:55612470-55612492 CCACATGCTGTTGCACATGCTGG - Intergenic
909899764 1:81118308-81118330 GCACCTGTTGATGGACATTTGGG + Intergenic
911898518 1:103470615-103470637 ACATCTGTCTTTGCACATCCAGG + Intergenic
914950325 1:152108377-152108399 GCAGCTGTTGTTGGCCCTCCTGG + Exonic
914950371 1:152108734-152108756 GCAGCTGTTGTTCCTCCTCCAGG + Exonic
918221817 1:182442364-182442386 GAACCAATTGTGGCACATCCAGG - Intergenic
919375475 1:196788314-196788336 CCATCTGCTGTTGCATATCCTGG - Exonic
919385152 1:196912838-196912860 CCATCTGCTGTTGCATATCCTGG - Exonic
1065722295 10:28638615-28638637 CCACCTGTTGTTAGACATCAAGG + Intergenic
1069684829 10:70311183-70311205 GTTCTTGTTGTTGGACATCCAGG + Intronic
1071360053 10:84837674-84837696 GAACCTGTTGGTGCAGTTCCAGG - Intergenic
1073175382 10:101553194-101553216 GTTACTGTTGTTGCTCATCCTGG - Exonic
1074474729 10:113760255-113760277 TCACCTGTTGATGAACATCAGGG + Intronic
1076526149 10:131113429-131113451 GCACCAGATGTTACTCATCCGGG + Intronic
1077424630 11:2468786-2468808 GCACCTGTTGATGGACATGTGGG + Intronic
1082271162 11:50170528-50170550 GCACCTGTGGTTGCACCTCGGGG + Intergenic
1082271174 11:50170582-50170604 GCACCTGTGGCTGCACCTCCAGG + Intergenic
1082712988 11:56577299-56577321 GCAAATGTTCTTGGACATCCTGG + Exonic
1082861424 11:57860358-57860380 TCACCTGTTGTAGAACACCCAGG - Intergenic
1084364864 11:68691315-68691337 CCACCTGTTATTGCATGTCCAGG + Intergenic
1088705834 11:112463968-112463990 TCATCTGTTGTTGGACATCTGGG + Intergenic
1093436870 12:19145643-19145665 ACTCCTGTTGTTGGACATCGAGG + Intronic
1105052961 12:133071178-133071200 GCACCTGTTGGTGGACATTTGGG + Intergenic
1105435084 13:20369803-20369825 TCACCTGTTGATGGACATCTGGG - Intergenic
1106630161 13:31463352-31463374 GCACCTGTAGTTCCAGATACTGG - Intergenic
1108044668 13:46372286-46372308 GCGGCTGTTGCTGCACATCCTGG + Exonic
1108056196 13:46487790-46487812 TCACCTGTTGGTGCACATTTGGG - Intergenic
1111820522 13:93208134-93208156 GCACATGTTCTTGGACCTCCAGG - Intergenic
1114441707 14:22753381-22753403 CCACCTGTTCTTGTACATCAAGG + Intergenic
1115351764 14:32403112-32403134 GAACCTGTGGATGCACATCAAGG + Intronic
1115930974 14:38494172-38494194 TCACCTGTTGTTGGACATTTAGG + Intergenic
1117818532 14:59623370-59623392 GGACCTGTTGTTTCACTTCCTGG - Intronic
1120591237 14:86375129-86375151 GCACCTGTTGCTCCATCTCCTGG + Intergenic
1125253107 15:37729291-37729313 TCACCTGTTATTGGACATCTAGG + Intergenic
1125638980 15:41213954-41213976 CAACCTGTTGTTGACCATCCTGG + Intronic
1128340000 15:66815407-66815429 GTTCCTGTTGCTCCACATCCTGG - Intergenic
1129098221 15:73232258-73232280 ACATCTGTGGTTGCACACCCTGG - Intronic
1132548939 16:546436-546458 GCACCTGTTCTTCCACGCCCAGG + Intronic
1136247829 16:28985453-28985475 GCTCCTGCTGCTGCCCATCCTGG + Exonic
1137514597 16:49132288-49132310 GCACCTCTTCTTGCAGATTCAGG + Intergenic
1137726282 16:50658892-50658914 GCTCCTGTTGCTCCACATGCTGG - Intergenic
1137966384 16:52937808-52937830 GTTCCTGTTGCTTCACATCCTGG - Intergenic
1139948748 16:70659130-70659152 GACCCTGTTGTTGCATATCGTGG + Intronic
1140773172 16:78224564-78224586 TCCCCTGTTGTTGGACATACAGG + Intronic
1141712082 16:85705546-85705568 GCGCATGTTGTCGCACATCATGG + Intronic
1142128210 16:88420564-88420586 GCGCCTGTCGTTCCACATCCTGG - Intergenic
1143876561 17:9995666-9995688 TCACCTGTTTTTGCAGATCCTGG - Intronic
1144698905 17:17323903-17323925 GCTCTTGTTGTTGCACAGGCTGG + Intronic
1146205291 17:30899432-30899454 GCACCTGATGCTGCCCATCCTGG + Exonic
1147431462 17:40373678-40373700 TCACCTGTTGATGGACATCTGGG - Intergenic
1149651600 17:58279519-58279541 GCACCTGTTGTTGCACATCCCGG + Exonic
1152365249 17:79851959-79851981 GCAGCTGCTGCTGCACATCTCGG + Intergenic
1152749722 17:82057105-82057127 TCACATGTTGGTGCTCATCCGGG - Exonic
1152940021 17:83164100-83164122 GCTCCTGTTGCTACACATCCTGG + Intergenic
1153658875 18:7308864-7308886 GCACCTGATCTTGGACTTCCAGG + Intergenic
1153878074 18:9394149-9394171 TCATCTGTTGTTGGACATCTAGG - Intronic
1154056974 18:11022176-11022198 GCACCTTCTCATGCACATCCAGG + Intronic
1154167276 18:12025502-12025524 GTTCCTGTTGCTCCACATCCTGG + Intronic
1156658055 18:39310662-39310684 ACACCTCCTGTTGCACATCCTGG + Intergenic
1158704901 18:59783556-59783578 GCACCTGCTGTTCCTCTTCCTGG - Intergenic
1159609276 18:70508473-70508495 GCACCAGTTGTGGCTCATCCAGG + Intergenic
1160710519 19:549091-549113 GCGGCTGTTGTTACACATGCGGG - Exonic
1160765242 19:804684-804706 TCACCTGGTGCAGCACATCCAGG - Exonic
1163101050 19:15096789-15096811 GCACCTGTTGTTACACATTGTGG - Intergenic
1164455011 19:28399643-28399665 GCACCTGCTGATGCACATGCAGG + Intergenic
1165371449 19:35409021-35409043 GCAGAAGTTGTTGAACATCCTGG - Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
927619552 2:24638375-24638397 TCATCTGTTGTTGGACACCCAGG + Intronic
929610815 2:43269477-43269499 GCACCTGCTTTTGCACATCATGG + Intronic
929637089 2:43534710-43534732 TCATCTGTTGTTGGACACCCAGG + Intronic
932689466 2:73900122-73900144 GCACCTGCAATCGCACATCCTGG + Intronic
935923480 2:108041173-108041195 GCACTTGTAGTTCCACATCTTGG + Intergenic
938750607 2:134325870-134325892 GCCCATGTTGTTGCATAACCTGG + Intronic
940285676 2:152031185-152031207 GCACCTAATATTGTACATCCTGG + Intronic
940730311 2:157381805-157381827 TCATCTGTTGTTGAACATCTAGG - Intergenic
944269416 2:197764285-197764307 TCATCTGTTGTTGGACACCCAGG - Intronic
944772062 2:202924736-202924758 GCTGCTGCTGTTGCCCATCCAGG - Intronic
945813100 2:214571911-214571933 GCACCTGTTGTCCCAGATACTGG - Intronic
945897028 2:215495023-215495045 ATTCCTGTTGTTCCACATCCTGG - Intergenic
1168924647 20:1569447-1569469 GCACCTGCAGTTGCACATTGAGG - Intronic
1169352900 20:4883817-4883839 CCATCTCTTGTTGCAGATCCAGG - Exonic
1170815747 20:19712744-19712766 GCTCCTGTTGATGGACATCTGGG - Intronic
1173811817 20:45960465-45960487 GCACCTGCTCACGCACATCCAGG - Exonic
1176179342 20:63742114-63742136 GCCCCTGTTGCTGCAGAGCCCGG + Exonic
1180138923 21:45879109-45879131 GCACCTGTGGTTGCAGCTGCTGG - Intronic
1184049132 22:41991333-41991355 GGACCTGAAGTTGCACCTCCTGG + Intronic
1185132744 22:49049064-49049086 GCACCTGTTCCTGCCCATGCAGG + Intergenic
952628134 3:35431599-35431621 GTTCCTGTTGCTCCACATCCTGG + Intergenic
954318308 3:49813248-49813270 GGACCTGCTGTTGGACTTCCAGG - Exonic
954326198 3:49865535-49865557 TCACCTGTTGTTGGACATTTAGG - Intronic
954800966 3:53186642-53186664 GGACCTGATGTACCACATCCAGG + Exonic
954932089 3:54292923-54292945 TCATCTGTTGATGCACATTCGGG - Intronic
956868438 3:73392165-73392187 GCACCTGCTGTTGCTCCACCTGG - Intronic
957898559 3:86455766-86455788 GATCCTGTTTCTGCACATCCTGG - Intergenic
963093867 3:141514557-141514579 GCTCCAGTTGTTCCACATCTTGG - Intronic
967813039 3:193776303-193776325 GTACCTGTTGTTTCGCATCCAGG + Intergenic
970381942 4:15517303-15517325 GCATCTTTTTTTACACATCCAGG + Intronic
975412675 4:74072882-74072904 TTATCTGTTGTTGCACATACTGG - Intergenic
977564186 4:98565015-98565037 TCAGCTGTTGTAGCACTTCCAGG - Intronic
978605725 4:110476804-110476826 GTACCTGTGGCTGCACCTCCGGG + Exonic
981075506 4:140587395-140587417 GCGTGTGTTGCTGCACATCCTGG + Intergenic
981478184 4:145209314-145209336 GTACCTGTTGCTGCTCATTCTGG + Intergenic
982236072 4:153252298-153252320 GTTCCTGTTCTTGCACATCCTGG + Intronic
984234182 4:177136436-177136458 GCACCTGTGGTTCCAGCTCCTGG + Intergenic
986294905 5:6429918-6429940 GCATTTGTTGTTGGACATCTAGG + Intergenic
992699922 5:79331663-79331685 TCACCTGTTGATGGACATCTGGG - Intergenic
993471973 5:88317323-88317345 TCACCTGTTGTTGGACACCTAGG + Intergenic
994357366 5:98808933-98808955 GCATCTGTTGTTGTACAACTAGG - Intergenic
996764537 5:127022683-127022705 GTACCTGTTTCTGCATATCCTGG - Intronic
998681553 5:144473499-144473521 GCACCTGTTGCAGCCCACCCTGG + Intronic
999532002 5:152474031-152474053 GAAGCTGATGTTGCCCATCCTGG + Intergenic
1000198672 5:158986214-158986236 GCACCCGTTGTTGCAGACCAAGG - Intronic
1002007072 5:176243943-176243965 TCACCTGTTGCTTGACATCCTGG - Intronic
1002014638 5:176310402-176310424 GTACCTGTTGTAGGACATCTGGG - Intronic
1002219311 5:177666690-177666712 TCACCTGTTGCTTGACATCCTGG + Intergenic
1008672472 6:53785546-53785568 TCATCTGTTGTTGGACATCTAGG - Intergenic
1011305703 6:85923977-85923999 TCACCTGTTGATGGACATCAGGG + Intergenic
1012925980 6:105268265-105268287 GCTCCTGTTGGTCCACATTCTGG - Intergenic
1013834193 6:114313433-114313455 TCACCTGTTGTTGGACATTTGGG - Intronic
1016261719 6:142179466-142179488 GCCCCTGTTGGTGGACATCAGGG - Intronic
1019385827 7:755603-755625 GCACCTGTGGTTCCAGCTCCCGG + Intronic
1023663123 7:42491162-42491184 GCACCTGTTGAGGCACAGCTTGG + Intergenic
1023980434 7:45066703-45066725 GCACCCGTGGTAGCACTTCCTGG + Intronic
1024052663 7:45638642-45638664 GTCCCTGTTGTTGGACATGCAGG + Intronic
1024488723 7:49951581-49951603 GTACCTGTTTCTTCACATCCTGG - Intronic
1024589314 7:50867547-50867569 GCGCCTGTTGCTGCCCTTCCCGG + Intergenic
1026210586 7:68300518-68300540 GGACCTGTGGTCGCACATTCAGG - Intergenic
1027197652 7:76042043-76042065 GCACCTGCAGATTCACATCCTGG - Intronic
1029271316 7:99378554-99378576 GCACCTGTAGTTCCACCTACTGG + Intronic
1034125215 7:148665436-148665458 TCACCAGTTGTTGGACATTCGGG - Intergenic
1034427130 7:151019893-151019915 GCACCTGTGGTTGCAGCTACTGG + Intronic
1034874912 7:154716569-154716591 GCACCTGCTGTCCCACATCCAGG - Intronic
1035194895 7:157209629-157209651 ACACCTGATATTGCACATCATGG - Intronic
1038231236 8:25702458-25702480 GCACCTGTGGTGGAAGATCCAGG - Intergenic
1038303546 8:26378285-26378307 GCACCTGTAGTTCCACCTACTGG + Intergenic
1041904869 8:63021465-63021487 GCACCTGCTGTGCGACATCCTGG + Intronic
1042046524 8:64658715-64658737 GCTCCTCTGGCTGCACATCCAGG + Intronic
1042300726 8:67277695-67277717 GCTTCTGTTTTGGCACATCCTGG - Intronic
1043088461 8:75867498-75867520 TCACCTGTTGATGGACATCTGGG + Intergenic
1054886637 9:70205756-70205778 TCACATGTTGTTGCACATGAAGG - Intronic
1057174040 9:92982378-92982400 TCATCTGTTGTTGGACACCCAGG + Intronic
1058268040 9:102932180-102932202 GCTCCTGTTGCTTCAGATCCTGG - Intergenic
1185598821 X:1325234-1325256 GCACCTGTAGTTCCACCTACTGG + Intergenic
1185610744 X:1392539-1392561 GCACCACATGTCGCACATCCCGG - Exonic
1185942109 X:4333386-4333408 GCACATGTTGTTGTACACCATGG + Intergenic
1186463770 X:9768551-9768573 GCACCTGTAGTTGCAGCTACTGG + Intronic
1189749365 X:44203711-44203733 GCACCTGTAGTTCCAGATACTGG - Intronic
1190211004 X:48447822-48447844 GCAGGTGTTGTTCCAGATCCAGG - Intergenic
1191175228 X:57492869-57492891 TCACCTGTTGTTGCACACTTAGG - Intergenic
1196078307 X:111602029-111602051 TCACCTGTTGATGGACATCTGGG + Intergenic
1197258390 X:124288926-124288948 TCATCTGTTGTTGGACATCTAGG + Intronic
1198123493 X:133619430-133619452 GCATCTGTTGTTGGACATTTTGG - Intronic
1200314937 X:155122598-155122620 GTACCTGTTGTAGGACATCTGGG - Exonic