ID: 1149651684

View in Genome Browser
Species Human (GRCh38)
Location 17:58279920-58279942
Sequence AGCCACCAGGACGGCGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149651684_1149651693 4 Left 1149651684 17:58279920-58279942 CCCTCACCGCCGTCCTGGTGGCT 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1149651693 17:58279947-58279969 CCGGCTGCTTGAAGTAGGATAGG 0: 1
1: 0
2: 1
3: 3
4: 69
1149651684_1149651690 -1 Left 1149651684 17:58279920-58279942 CCCTCACCGCCGTCCTGGTGGCT 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1149651690 17:58279942-58279964 TGCCACCGGCTGCTTGAAGTAGG 0: 1
1: 0
2: 2
3: 13
4: 96
1149651684_1149651697 20 Left 1149651684 17:58279920-58279942 CCCTCACCGCCGTCCTGGTGGCT 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1149651697 17:58279963-58279985 GGATAGGAGTTCCATGGGGCTGG 0: 1
1: 0
2: 2
3: 18
4: 172
1149651684_1149651696 16 Left 1149651684 17:58279920-58279942 CCCTCACCGCCGTCCTGGTGGCT 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1149651696 17:58279959-58279981 AGTAGGATAGGAGTTCCATGGGG 0: 1
1: 0
2: 1
3: 17
4: 183
1149651684_1149651695 15 Left 1149651684 17:58279920-58279942 CCCTCACCGCCGTCCTGGTGGCT 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1149651695 17:58279958-58279980 AAGTAGGATAGGAGTTCCATGGG 0: 1
1: 0
2: 1
3: 11
4: 123
1149651684_1149651694 14 Left 1149651684 17:58279920-58279942 CCCTCACCGCCGTCCTGGTGGCT 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1149651694 17:58279957-58279979 GAAGTAGGATAGGAGTTCCATGG 0: 1
1: 0
2: 1
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149651684 Original CRISPR AGCCACCAGGACGGCGGTGA GGG (reversed) Exonic
900242447 1:1623522-1623544 GGCCAGCAGGACGGCGGCGAGGG + Exonic
901361086 1:8701261-8701283 AGGCACCGGGATGGGGGTGAGGG + Intronic
903017101 1:20368363-20368385 AGCTGCCAGGACGGGGGTGGAGG - Intergenic
905485420 1:38292567-38292589 AGCCAGCTGGAGGGTGGTGAAGG - Intergenic
913996113 1:143652964-143652986 CGCCTCCGGGACGGCGGAGACGG + Intergenic
921877929 1:220220216-220220238 AGCCACCACAACGACGATGATGG - Intronic
1064808793 10:19168762-19168784 AGCCACCAGCAGGGGGATGAAGG - Intronic
1065487613 10:26249910-26249932 CACCACCAGGAGGGCGGAGAAGG + Intronic
1067755146 10:48999649-48999671 ACACACCAGGAAGGCGGTGAGGG + Intergenic
1069799168 10:71071582-71071604 AGCGGCCTGGACGGGGGTGAAGG + Intergenic
1071554018 10:86588451-86588473 AGCCACTAAAATGGCGGTGACGG + Intergenic
1072737571 10:97889322-97889344 AGCAACCAGGTTGGCGGTGGGGG + Intronic
1073425300 10:103452214-103452236 GGCCTCCAGGAGGGCGGTGCAGG + Exonic
1074284844 10:112088450-112088472 AGCCACCAGGACAGCCCTGGTGG + Intergenic
1074529667 10:114288604-114288626 AGCCAGCAGGAAGGGGGAGAGGG + Intronic
1083421728 11:62556972-62556994 AAACACCAGGAAGGTGGTGAAGG + Intergenic
1083988530 11:66232669-66232691 AGCCAGGTGGACAGCGGTGAGGG - Intronic
1084594021 11:70106525-70106547 AGCCAGCAGGAGGTCGGTGCAGG + Intronic
1085698352 11:78724831-78724853 AGCCATCAGGAAGGAGGTCAAGG - Intronic
1086454891 11:86951577-86951599 AGCCACCACGAACCCGGTGAGGG + Exonic
1090255562 11:125281304-125281326 AGCCACCAGGAAGGCATTGAGGG - Intronic
1096653752 12:53075607-53075629 AGCCAACAGGACAGCCCTGATGG + Intronic
1098937130 12:76492841-76492863 ACAGACCAGGAGGGCGGTGATGG - Intronic
1103537180 12:121641111-121641133 AGCCACCAGCACTGTGGTGCAGG - Exonic
1104887947 12:132122454-132122476 ACCCACCAGGACCGCGGGGCTGG - Intronic
1104975124 12:132548775-132548797 GGGCACCTGGACGGGGGTGAGGG + Intronic
1110322651 13:74177457-74177479 AGCCTGGAGGACGACGGTGATGG + Intergenic
1113811850 13:113147510-113147532 AGCCCCCAGGGCCGTGGTGAGGG + Intronic
1113852835 13:113427806-113427828 AGCCACCAGGCCTGTGCTGATGG - Intronic
1117491341 14:56250903-56250925 AGAAACCAGGAAGGAGGTGAGGG + Intronic
1122517765 14:102320306-102320328 AGCCCCCAGCAGGGCTGTGAAGG - Intronic
1122697153 14:103561776-103561798 AGCGACCGGGACAGCGCTGAAGG + Intronic
1122947718 14:105020816-105020838 AGCGCCCAGGAGGGCGGCGAGGG + Intronic
1123739777 15:23225789-23225811 AGCCCCCAGGAGGCCGGTGCGGG + Intergenic
1127730241 15:61794404-61794426 AGCCACCAGGCCAGCAGAGATGG + Intergenic
1130561201 15:84960624-84960646 AGCCACCTGGATGTGGGTGATGG + Intergenic
1131347608 15:91665281-91665303 AGCCACCTGGAAGGCGGTGGGGG - Intergenic
1132757063 16:1490660-1490682 AGCCACCAGGACAGCGACGCTGG + Intergenic
1132800516 16:1750019-1750041 CGAGATCAGGACGGCGGTGAGGG + Intronic
1135164656 16:20128495-20128517 AGCTACCAGGAAGGCTGAGATGG - Intergenic
1136403547 16:30030875-30030897 AGCCACCAGGCAGGTGGGGAGGG + Exonic
1136545643 16:30953255-30953277 AGCCACCAGCACGGTGGTGCAGG - Exonic
1138926344 16:61596090-61596112 AGCCATCAGGACAGCAGTAATGG + Intergenic
1139553407 16:67689727-67689749 ATCCACCAGGGTGGTGGTGATGG - Intronic
1139598258 16:67970274-67970296 AGCCACCAGGCCGGCCTTGGAGG - Intergenic
1139921555 16:70463719-70463741 AGCCACCAGCAGGGCGTTGAGGG - Exonic
1143516408 17:7421327-7421349 AGCCACAAGAACGGTGGGGAGGG + Exonic
1143620908 17:8079811-8079833 AGCCACCATGTCGTCTGTGACGG + Exonic
1147585949 17:41654177-41654199 AGCCACCAGGAACGGGGTGTGGG - Intergenic
1147690784 17:42313144-42313166 AGCCACCAGCCCGGAGGTAAGGG - Intergenic
1147794807 17:43034737-43034759 AACCACCAGGAGGGCTGTTAGGG + Intergenic
1149651684 17:58279920-58279942 AGCCACCAGGACGGCGGTGAGGG - Exonic
1149779109 17:59382224-59382246 GGCCACCAGGACAGCCCTGAGGG + Intronic
1149850775 17:60032345-60032367 TGCAACCAGGCCGGCTGTGAAGG - Intergenic
1149859391 17:60114179-60114201 TGCAACCAGGCCGGCTGTGAAGG + Intergenic
1153029815 18:703196-703218 ATCCACCAAGACAGCGGTGTGGG + Intronic
1155205659 18:23555828-23555850 AGCCCCCAGGACAGCAGTAAGGG + Intronic
1161067147 19:2244271-2244293 AACCACCAGGAAGGTGGTGTCGG + Intronic
1161124794 19:2549767-2549789 AGCCAGCAGGCCGGGGGTGAGGG + Intronic
1161510020 19:4665069-4665091 GGCCACCAGGAGGGCGGGGCAGG - Intronic
1161587423 19:5113215-5113237 AGCCCCCAGGATGGCGGCGCGGG - Intronic
1162364944 19:10242878-10242900 AGCAACCAGGACAGGCGTGAAGG - Intergenic
1162960805 19:14125252-14125274 AGACACCAGGACGGCTATGATGG - Intronic
1163783132 19:19260994-19261016 TGCCACGAAGACGTCGGTGAAGG + Exonic
1165436441 19:35797767-35797789 AGCCACCAGGACTGGGGTGTGGG - Intergenic
1167072321 19:47228210-47228232 ACCCCCCAGGGCGGCGGTGACGG + Exonic
1168557213 19:57353161-57353183 AGGCACCTGGACGGCAGTGGTGG + Intronic
925426543 2:3753394-3753416 AGTGACCAGGAGGGAGGTGAAGG + Intronic
926123391 2:10256716-10256738 TGCCACCAGGCCAGCGGTGGAGG - Intergenic
927802720 2:26116263-26116285 AGCTACCAGGAAGGCTGAGATGG - Intronic
928398921 2:30964233-30964255 AGCCACCATGGCGGTGGGGAAGG + Intronic
929533133 2:42764585-42764607 GGCCACCAGCAGGGCGGTGGAGG - Intergenic
929899185 2:45986665-45986687 AGGCACGAGGAGGGTGGTGAGGG + Intronic
936921990 2:117698252-117698274 AGCCAGCAGAAAGGAGGTGAAGG - Intergenic
1169404712 20:5314061-5314083 GGCCACCAGGAAGTCGGAGATGG + Exonic
1170736695 20:19019036-19019058 AGACACCAGGGGTGCGGTGATGG + Intergenic
1171180069 20:23085360-23085382 TGCCACCAGGACTGCTTTGAAGG - Exonic
1171810217 20:29741197-29741219 AGGAACCAGGACCGCGGTGGTGG + Intergenic
1171849804 20:30300373-30300395 AGCGTCCAGGGCGGCGCTGATGG - Intergenic
1173736713 20:45366984-45367006 AGCCACCAGGTCAGCGCCGAGGG - Exonic
1174158007 20:48529024-48529046 AGCCACCATCACGGAGGTGGTGG + Intergenic
1175326846 20:58135498-58135520 AGCCAGCAGGGAGGCGGTGGGGG + Intergenic
1176032104 20:63017604-63017626 AGCCCCCAGGACAGAGGTCAAGG + Intergenic
1176546175 21:8201212-8201234 AGCCACCAAGGCGGTGGTGGGGG - Intergenic
1176565126 21:8384258-8384280 AGCCACCAAGGCGGTGGTGGGGG - Intergenic
1179571436 21:42280980-42281002 AGGCACCAGGGCTGGGGTGAGGG + Intronic
1179613506 21:42567042-42567064 ACTCACCAGGTCGGCGGAGACGG - Exonic
1180187101 21:46145411-46145433 ACTCACCAGGTAGGCGGTGAAGG + Exonic
1181023506 22:20115285-20115307 AGCCACCAAGCAGGTGGTGAAGG - Exonic
1183976735 22:41516602-41516624 AGCCACTAGGACGGAGGTATGGG - Intronic
1184728849 22:46362220-46362242 GGCCACCTGGGAGGCGGTGAGGG + Exonic
1185095770 22:48805159-48805181 AGCCCCCATGAGGGCAGTGATGG + Intronic
1185371471 22:50462817-50462839 AGCCACCAGGAAGGGGGGGCTGG + Intronic
1203251047 22_KI270733v1_random:117449-117471 AGCCACCAAGGCGGTGGTGGGGG - Intergenic
952820750 3:37483692-37483714 AGCCTCCAGGACAGAGGTGCTGG + Intronic
954113040 3:48446527-48446549 AGCCACCAGCGCGGCGGAGCTGG + Intergenic
957937981 3:86968770-86968792 AGCCAGCAGGAGGGTGGTGATGG + Exonic
960006337 3:112784977-112784999 AGCCACCTGGCCCGTGGTGATGG + Intronic
960672678 3:120167857-120167879 AGCCCCCAGAGCGGCGGTCACGG - Exonic
969622118 4:8283888-8283910 AGCCAGCAGGGAGGCGGTGCTGG - Intronic
975286548 4:72628202-72628224 AGACAACAGGATGGCTGTGAAGG - Intergenic
980464207 4:133152146-133152168 AACCACCAGGGTGGCGGTGGAGG - Exonic
980570837 4:134617905-134617927 AGCCACCCGGGAGGCTGTGACGG + Intergenic
982338856 4:154272466-154272488 AGGCACCAGGTGGGAGGTGATGG + Intronic
986416514 5:7534254-7534276 AGCCACCAGCATGGGTGTGATGG - Intronic
988710351 5:33768115-33768137 AGCCAACAGGACTGCTGTGCTGG + Intronic
992773204 5:80068430-80068452 AGCCAGCAGCAGGGAGGTGAAGG + Intronic
998152636 5:139765827-139765849 AGCCACGACGGCGGCGGTGGCGG - Intergenic
1002399984 5:178986325-178986347 AGCCACCATGAGGAAGGTGATGG + Exonic
1002929767 6:1625026-1625048 AGCCACCAGCCCCGCGGGGAAGG + Intronic
1007077946 6:39079686-39079708 AGTCACCTGGAAGGAGGTGAAGG - Exonic
1007245981 6:40463034-40463056 AGCCAGCAGGAAGGAGATGAGGG - Intronic
1013646583 6:112148268-112148290 AGCCAACAGGACGACGATGGAGG - Exonic
1018682404 6:166275319-166275341 AGCCAACAGGACGCTGGGGAAGG - Intergenic
1019825748 7:3282870-3282892 AGCCACCAGTACTGGGGTGCAGG - Intergenic
1022466428 7:30655702-30655724 CGCCCCCAGGAAGGCAGTGAAGG - Exonic
1025683392 7:63697338-63697360 AGCCACTAGGGAGGCTGTGATGG - Intergenic
1028165595 7:87534800-87534822 AGCTACCAGGAAGGCTGAGAAGG + Intronic
1033641362 7:143265224-143265246 AGACAGCAGGAAGGCGGTGCGGG - Exonic
1035335733 7:158126182-158126204 AGCCCCCAGGACAGCGGCGGCGG + Intronic
1035606274 8:931670-931692 GGCCACCAGGACGACGGGAAGGG - Intergenic
1045306431 8:100960568-100960590 AGCCACCGTGCCGGCGGTGCTGG + Intergenic
1046012935 8:108572528-108572550 TGCCACCAGCACAGCGGTGCTGG + Intergenic
1049521216 8:143092342-143092364 AGACACCAGGACGGGGTGGAAGG + Intergenic
1054157549 9:61651101-61651123 AGCGTCCAGGGCGGCGCTGATGG + Intergenic
1054175852 9:61875003-61875025 AGCGTCCAGGGCGGCGCTGATGG - Intergenic
1054477323 9:65582106-65582128 AGCGTCCAGGGCGGCGCTGATGG + Intergenic
1054661687 9:67705805-67705827 AGCGTCCAGGGCGGCGCTGATGG + Intergenic
1058547675 9:106078073-106078095 AGCCATTGGGACGGGGGTGAGGG - Intergenic
1060224271 9:121781817-121781839 AGCCACCAGGAGGGCAGTGGGGG + Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060545778 9:124458246-124458268 CGCCACCTGGAGGGCTGTGAGGG + Intronic
1062346959 9:136119289-136119311 AGGCTCCAGGAGGGCGGGGAAGG + Intergenic
1062707836 9:137955018-137955040 GGTCACCATGACGGCTGTGAAGG + Intronic
1203467452 Un_GL000220v1:100716-100738 AGCCACCAAGGCGGTGGTGGGGG - Intergenic
1187224586 X:17363091-17363113 AGCCACCATGCCGGCAGTGGTGG - Intergenic
1190702236 X:52997580-52997602 AGTCAGCAGGACGGCAGTCAAGG - Intergenic
1195031218 X:100929241-100929263 AGGCACCGGGACGGCGGGGGCGG + Intronic
1196707297 X:118727541-118727563 AGCCTCCAGGGCGGCGGAGCCGG + Intergenic
1200235976 X:154467882-154467904 GGCCACCAGCACGGCTGTGATGG - Exonic