ID: 1149651839

View in Genome Browser
Species Human (GRCh38)
Location 17:58280586-58280608
Sequence CCACCTTGGGAACTGTTACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149651830_1149651839 0 Left 1149651830 17:58280563-58280585 CCACCCCAACACACCATCTTCTC 0: 1
1: 0
2: 1
3: 40
4: 456
Right 1149651839 17:58280586-58280608 CCACCTTGGGAACTGTTACCTGG 0: 1
1: 0
2: 2
3: 11
4: 89
1149651833_1149651839 -5 Left 1149651833 17:58280568-58280590 CCAACACACCATCTTCTCCCACC 0: 1
1: 0
2: 6
3: 53
4: 576
Right 1149651839 17:58280586-58280608 CCACCTTGGGAACTGTTACCTGG 0: 1
1: 0
2: 2
3: 11
4: 89
1149651831_1149651839 -3 Left 1149651831 17:58280566-58280588 CCCCAACACACCATCTTCTCCCA 0: 1
1: 0
2: 4
3: 38
4: 335
Right 1149651839 17:58280586-58280608 CCACCTTGGGAACTGTTACCTGG 0: 1
1: 0
2: 2
3: 11
4: 89
1149651832_1149651839 -4 Left 1149651832 17:58280567-58280589 CCCAACACACCATCTTCTCCCAC 0: 1
1: 0
2: 2
3: 47
4: 1121
Right 1149651839 17:58280586-58280608 CCACCTTGGGAACTGTTACCTGG 0: 1
1: 0
2: 2
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149651839 Original CRISPR CCACCTTGGGAACTGTTACC TGG Exonic
900102576 1:968146-968168 CCAGCGTGGGAACTGATGCCGGG - Intronic
903873930 1:26459137-26459159 CAACTTTGGGAACTGATAACAGG + Intronic
905223296 1:36463787-36463809 CCACCTTAGGAACTCCTACCTGG + Exonic
909845183 1:80384727-80384749 CCACATTGGTAACTGAGACCTGG + Intergenic
912500557 1:110119330-110119352 ACACCTGGGGAATTGTTACTTGG + Intergenic
915632295 1:157161826-157161848 CCACCTTGGGCACTGGTCTCAGG - Intergenic
924742883 1:246807220-246807242 CCAATTTGGGAAGTGTTATCAGG - Intergenic
1067736265 10:48853515-48853537 CCACCATGTGAACTCTCACCTGG + Intronic
1069727105 10:70587172-70587194 CCACCTTGGCACATGTTCCCAGG + Intergenic
1074799587 10:116986371-116986393 CCTCCTTGGGAACCGGTACCTGG + Intronic
1076212632 10:128660623-128660645 CCACCTGGGGAGCTGATCCCTGG + Intergenic
1078874698 11:15381118-15381140 CTACCTTGGGAAATAGTACCTGG + Intergenic
1083876741 11:65528105-65528127 CAACCTTGGGAACTCTTGCTGGG + Intronic
1084270273 11:68025794-68025816 CCAACTTGGGACATGTTTCCTGG - Intronic
1088039460 11:105360295-105360317 CCCCCTTGGAAGTTGTTACCTGG + Intergenic
1090924683 11:131239137-131239159 CCACCTAGGGCACTGCTACATGG + Intergenic
1091017549 11:132066280-132066302 CCACCTGAGGAACTGTTCCAAGG + Intronic
1097137839 12:56874314-56874336 CCAGCTTGGAAACTGTTTACTGG - Intergenic
1097340723 12:58434868-58434890 CCACCCTGGTAACTGTGAACTGG + Intergenic
1098531776 12:71549996-71550018 TAACGTTGGGAACTGATACCTGG + Intronic
1100921488 12:99493379-99493401 ACACCTAGGGAAGTGTTACAAGG + Intronic
1104613231 12:130247063-130247085 CCACAATGGGAATTGTTACTAGG - Intergenic
1104992274 12:132632567-132632589 CCACCTGGGGGACTGGCACCGGG + Intronic
1107400778 13:40066833-40066855 CCAGCTCGGGGCCTGTTACCTGG - Intergenic
1108315196 13:49230158-49230180 CCAACTTAGGAACTGCTACTGGG - Intergenic
1113567065 13:111325504-111325526 CCCCCTTGGCAGCTGTGACCTGG + Intronic
1116763682 14:49045374-49045396 CCACACTGGCAACTGTAACCCGG - Intergenic
1123032485 14:105458513-105458535 CCTCTCTGGGAACTGCTACCGGG - Intronic
1123961618 15:25408251-25408273 CAAGCTTGGGAACTGTTGCTAGG - Intronic
1128158799 15:65409602-65409624 CCGCCTTGGAAACTCTTCCCTGG + Intronic
1129336365 15:74854372-74854394 TCCCCTTGGGATCTGTGACCGGG - Intronic
1130080437 15:80728113-80728135 CCACCTTGTAAACTGTTGCCAGG + Intronic
1134812067 16:17176257-17176279 CCACTTGTGGAACTGTCACCCGG + Intronic
1135487550 16:22879367-22879389 CTGCCTTCGGAACTGTTACTGGG + Intronic
1135924022 16:26676423-26676445 CCCCCTTGGTAAGTGTTAGCAGG + Intergenic
1136009260 16:27352369-27352391 CCACCTCTGTAACTGTGACCAGG - Intronic
1141375783 16:83528910-83528932 TCACCTTGAGAAATGTCACCAGG + Intronic
1143757580 17:9078286-9078308 CCACCCAGGGAACTGCTGCCTGG - Intronic
1147239113 17:39079006-39079028 CCACCTTGAGAAGAGTTTCCAGG + Intronic
1147999256 17:44378330-44378352 CCACCCTGGGAACAGTACCCGGG - Intronic
1149651839 17:58280586-58280608 CCACCTTGGGAACTGTTACCTGG + Exonic
1150054664 17:62003036-62003058 ACACATTGGCAAATGTTACCTGG + Intronic
1151583412 17:74993053-74993075 CCCCCTTGGAAACTGTTACATGG - Intronic
1156405077 18:36775795-36775817 ACACCGTGAGAACTGTCACCAGG + Intronic
1157813316 18:50713370-50713392 CCACCTTGGAAAGTGGAACCTGG + Intronic
1159373389 18:67559280-67559302 CCTCCTTGGGAACTGGTGCTGGG - Intergenic
1166981558 19:46634782-46634804 CCACCCTCGCACCTGTTACCGGG - Intergenic
926762295 2:16288904-16288926 CTACCTTGAGACCTGTTGCCAGG - Intergenic
936038590 2:109130900-109130922 CCACCTTGTGAACAGTTACCAGG + Intronic
939076824 2:137612917-137612939 CCACCTGGGTGACTGTTACAAGG - Intronic
942448146 2:176092170-176092192 CTACCTTGTGCACTGGTACCCGG - Intergenic
946414307 2:219531929-219531951 CCACCTTGGGGACTGGGGCCTGG + Intronic
947049349 2:226024575-226024597 CCTCCTTGGAAACTCTTAACTGG + Intergenic
948260238 2:236599043-236599065 CCATTTTGGGAACTGTTTCTCGG + Intergenic
1169688631 20:8305519-8305541 ACACCTTGGGGTCTGTAACCAGG + Intronic
1173163979 20:40673327-40673349 CCACCTTGGGAACTGCTTTATGG - Intergenic
1176117512 20:63439504-63439526 CCACCTAGGGAACTGTGCCCAGG + Intronic
1177166578 21:17611902-17611924 CCACCTTGGGAACGTCTATCAGG - Intronic
1180660929 22:17466547-17466569 CCATCTTGGGGACAGATACCAGG - Intronic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
950273724 3:11640691-11640713 CCTCCTTGGTAACTGCTTCCTGG - Intronic
950953079 3:17022006-17022028 CCACCTAGAGAACTGTTAGGGGG + Intronic
952313867 3:32215387-32215409 CCACCTTGGGGACAGTTGCCTGG - Intergenic
952376581 3:32772733-32772755 TGACCTTGGGAACTCTTACAAGG + Intronic
960995393 3:123336887-123336909 CCACCTGGGGAGCTCTTACCTGG + Intronic
961270162 3:125682164-125682186 CTTCCGTGGGAACTGTCACCAGG - Intergenic
964731950 3:159876963-159876985 CCTCCTTGGGGATTATTACCTGG + Intronic
966223055 3:177569582-177569604 TTACCTAGGGAACTTTTACCAGG - Intergenic
967249323 3:187520709-187520731 CCACCTTGTTAACTGCTATCTGG + Intergenic
968932773 4:3590793-3590815 CCACCTTGGGAGCTGCAGCCTGG + Intergenic
970175770 4:13338071-13338093 CCTCCTTGGTAACTGAGACCAGG - Intergenic
970691705 4:18628533-18628555 CCACCTTGGAAACTGTTGGGAGG - Intergenic
973274052 4:48290536-48290558 CCTGCTTGGCAACTGTTAGCTGG + Intergenic
975434350 4:74334282-74334304 CCACCTTGGGCACTGGTGTCTGG + Intergenic
976693446 4:87893436-87893458 CCTCCTTGGTAACTGAGACCAGG - Intergenic
978374756 4:108062855-108062877 CTCCTTTGAGAACTGTTACCAGG + Intronic
986508020 5:8473261-8473283 CCACCTTGGGTACTGGCATCTGG + Intergenic
987524517 5:19030400-19030422 CCACCTTCGGGACTGTGCCCAGG - Intergenic
989519249 5:42381762-42381784 CCAGCTGGGGAACTGGTACATGG - Intergenic
997932555 5:138084265-138084287 CTACCTTGGGACCTGTTATCAGG - Exonic
1002291127 5:178201622-178201644 CCACATTGGGGATTGTTTCCAGG - Intergenic
1002441670 5:179267527-179267549 CATCCTGGGGAACTGCTACCAGG - Intronic
1007249312 6:40484835-40484857 CCACCTGGGCAACTCTCACCTGG - Intronic
1007780637 6:44252132-44252154 CCTCCTTGGTAACTGAGACCAGG - Exonic
1014963853 6:127722154-127722176 CCACTGTGGGAACTGTTTCCAGG - Intronic
1018653409 6:166009961-166009983 CCACTTTGAGAACTGTCACTGGG + Intergenic
1020456483 7:8379404-8379426 CCACAATGCAAACTGTTACCAGG - Intergenic
1024518943 7:50285685-50285707 CCAACTTGAGATCTGTTATCAGG + Intergenic
1025115698 7:56256138-56256160 CCACCTTGGGCACTGGCATCTGG - Intergenic
1026119244 7:67522286-67522308 CCACCTTGGGACATGTCATCAGG + Intergenic
1028132438 7:87191960-87191982 CCACCTTTGGAACTTTTTACTGG + Intronic
1034398215 7:150843369-150843391 CCTCCTTGGGAACAGTTTCCAGG - Intronic
1039731265 8:40281059-40281081 CCTCCGTGGGAACCGGTACCAGG - Intergenic
1042820267 8:72922884-72922906 CCACCTTGGGACCCATTATCAGG - Intronic
1045424630 8:102052605-102052627 CCATTTTGGAAACTGTTACCAGG - Intronic
1046714247 8:117549830-117549852 AAAACTTGGGAAATGTTACCAGG + Intergenic
1048378561 8:133844340-133844362 CCACCTTAGAGACTGTTTCCTGG - Intergenic
1049208165 8:141372983-141373005 TCACCTGGGGAACTGTGACAAGG + Intergenic
1049832451 8:144710718-144710740 CGACCTTGGCAAGTGTCACCTGG - Intergenic
1055825509 9:80319198-80319220 CCACCCTGGGGTCTCTTACCGGG + Intergenic
1061446416 9:130640696-130640718 CCACCTTGGAAGCAGGTACCTGG - Intergenic
1185842046 X:3400786-3400808 CCACCTTGGGCAATGTTCTCAGG + Intergenic
1198397178 X:136231816-136231838 TCACCTTGGGAACTGTTTCCAGG + Exonic