ID: 1149654029

View in Genome Browser
Species Human (GRCh38)
Location 17:58300997-58301019
Sequence CTGGGGTTGTGGAGGAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149654029_1149654041 18 Left 1149654029 17:58300997-58301019 CCCATCTTCCTCCACAACCCCAG No data
Right 1149654041 17:58301038-58301060 GACCCTGTGACCACGGGCTCAGG No data
1149654029_1149654040 12 Left 1149654029 17:58300997-58301019 CCCATCTTCCTCCACAACCCCAG No data
Right 1149654040 17:58301032-58301054 ATATCTGACCCTGTGACCACGGG No data
1149654029_1149654039 11 Left 1149654029 17:58300997-58301019 CCCATCTTCCTCCACAACCCCAG No data
Right 1149654039 17:58301031-58301053 AATATCTGACCCTGTGACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149654029 Original CRISPR CTGGGGTTGTGGAGGAAGAT GGG (reversed) Intergenic
No off target data available for this crispr