ID: 1149654654

View in Genome Browser
Species Human (GRCh38)
Location 17:58303814-58303836
Sequence TACTTGGGGGATAAAAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149654654_1149654664 27 Left 1149654654 17:58303814-58303836 CCTCCCCTTTTATCCCCCAAGTA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 1149654664 17:58303864-58303886 ATGCATCTGATCACCCTAACAGG 0: 1
1: 0
2: 0
3: 3
4: 61
1149654654_1149654662 -5 Left 1149654654 17:58303814-58303836 CCTCCCCTTTTATCCCCCAAGTA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 1149654662 17:58303832-58303854 AAGTAGAGAAAACTGAGAGTTGG 0: 1
1: 2
2: 3
3: 50
4: 577
1149654654_1149654663 -2 Left 1149654654 17:58303814-58303836 CCTCCCCTTTTATCCCCCAAGTA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 1149654663 17:58303835-58303857 TAGAGAAAACTGAGAGTTGGAGG 0: 1
1: 0
2: 8
3: 34
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149654654 Original CRISPR TACTTGGGGGATAAAAGGGG AGG (reversed) Intronic
902614576 1:17616763-17616785 GACTTGGGGGATGAAAGGTCAGG + Intronic
903619667 1:24688830-24688852 CACTTGCAGGATAAAAGGTGGGG - Intergenic
905103897 1:35550809-35550831 TACTCGGGGGCTAAGATGGGAGG - Intronic
905188788 1:36216674-36216696 TACTTGGGGGCTAAGGTGGGAGG + Intergenic
906263942 1:44414332-44414354 TATTTGGAGAAAAAAAGGGGCGG - Intronic
908136561 1:61139254-61139276 TACTCTGAGGATAAAAGTGGAGG + Intronic
909488257 1:76198144-76198166 TACTTGGGGGCTGAAGTGGGAGG - Intronic
910530043 1:88225518-88225540 TACTAGAGGGATAAAGGGGCTGG - Intergenic
910964672 1:92796509-92796531 TACTTGGGGGCTGAGATGGGAGG - Intergenic
912956432 1:114156877-114156899 TACATGAGGGAGAAAAGAGGAGG + Intergenic
914914461 1:151810359-151810381 TAATTTGGGGGTAAAAGGAGTGG - Intronic
915966975 1:160317434-160317456 GACTTGGGGGATAAGAAGGAAGG + Intronic
916145300 1:161733768-161733790 TAGTTGTGGGAAAAATGGGGTGG - Intergenic
918293578 1:183133578-183133600 GACTTGGGGGAGAGACGGGGTGG - Intronic
920113159 1:203601175-203601197 GACTTGGGGGATGGATGGGGAGG - Intergenic
920726458 1:208439850-208439872 GACTTGGGGGAAAAAGTGGGAGG - Intergenic
920829514 1:209451795-209451817 TACTTGTGGGTTAAAGTGGGGGG - Intergenic
921896251 1:220404611-220404633 TATTTGGGGGATAAACAGGGTGG + Intergenic
924826686 1:247546991-247547013 TACTTGGGGGATGAGGAGGGAGG + Intronic
924948932 1:248865127-248865149 TACTTGGGGGTTGAGATGGGAGG - Intergenic
1063258498 10:4356162-4356184 TGCTTTGGGGATAAGAGGAGAGG + Intergenic
1065039069 10:21672335-21672357 TACTTGGGAGACAAAGGTGGAGG - Intronic
1065792021 10:29269116-29269138 TATTTGTGGAATAAAAAGGGTGG - Intergenic
1068466424 10:57398993-57399015 TACTTGGAAGATGAAAAGGGAGG + Intergenic
1068654173 10:59557584-59557606 TCCTTGGGGGAAAAAAGGAGAGG + Intergenic
1069139234 10:64803057-64803079 CAATTGGGTGATAACAGGGGTGG + Intergenic
1072192327 10:93086181-93086203 TAATTGGGGGAGAATAGAGGCGG + Intergenic
1075073349 10:119333647-119333669 TACTTAGGTGCTCAAAGGGGTGG + Intronic
1077439323 11:2560639-2560661 TACTTGGGGTGTGGAAGGGGAGG - Intronic
1077448692 11:2620009-2620031 TACTTGGGGGAGGAATGGAGAGG - Intronic
1077493942 11:2876503-2876525 TACTTGGGGGCTGAGATGGGAGG - Intergenic
1078141263 11:8694676-8694698 TATTTGGGGGAAAAAATGGATGG + Intronic
1079642417 11:22823540-22823562 GACCTGGGGGTTAGAAGGGGAGG - Intronic
1080883802 11:36347124-36347146 TACCTTGGGGAGAAAAAGGGTGG + Intronic
1082104954 11:48211476-48211498 CACTTGGGGGTCCAAAGGGGTGG + Intergenic
1084075243 11:66770105-66770127 TCCTTGGTGGATACAAGGGAGGG - Intronic
1084295561 11:68211719-68211741 TACGGGGTGGAGAAAAGGGGTGG + Intronic
1085839921 11:79999992-80000014 TACTGGGAGGATGAAAGGTGGGG - Intergenic
1086616149 11:88822816-88822838 AAATTGGGCGACAAAAGGGGAGG - Intronic
1086909308 11:92453727-92453749 TACTTGGGGGAAAAAACGATGGG - Intronic
1088918681 11:114245998-114246020 GGCTTGGGGGATGAAAGGTGAGG - Intronic
1088965648 11:114718602-114718624 TAATTGTGGGATAAAAGCTGAGG + Intergenic
1090698123 11:129269160-129269182 TACTTGGGGGCTAAGGTGGGAGG + Intronic
1090977645 11:131690749-131690771 TCCTTGGGGAACAAAATGGGAGG + Intronic
1091528297 12:1328659-1328681 TAACTGAGGGAGAAAAGGGGAGG - Intronic
1093280055 12:17182680-17182702 TATTTGGGGGAAAAGAGAGGCGG + Intergenic
1093905846 12:24691115-24691137 TACTTGGGGGGAGAAAGGGGAGG + Intergenic
1095202399 12:39399628-39399650 TACTTGGGGGAGAGAAGATGTGG - Intronic
1095707806 12:45256626-45256648 TACTTGGGCTATACAAAGGGTGG - Intronic
1096288875 12:50324049-50324071 CCATTGGGGGATAATAGGGGTGG - Intergenic
1096534299 12:52261323-52261345 TATATTGGTGATAAAAGGGGCGG - Intronic
1096651415 12:53063723-53063745 TCCTAGGGGGATAAAGGGTGGGG - Exonic
1097160117 12:57040164-57040186 TATTTGGGGGATGAAGTGGGAGG - Intronic
1097989070 12:65815503-65815525 TACTTTGGGGATAGGCGGGGAGG + Intergenic
1101568956 12:105935649-105935671 TACTTGGAAGATAAAGGGAGAGG - Intergenic
1102828584 12:115973026-115973048 TATTTGGGGGAAAAAAAGTGTGG - Intronic
1103189072 12:118985109-118985131 TACTTGGGGGAGAAATGGGTAGG - Intronic
1104443135 12:128811498-128811520 TACCTGGGGGCTAAAGGGGAGGG + Intronic
1106605608 13:31225751-31225773 AAGATGGGGGAAAAAAGGGGTGG - Intronic
1107780364 13:43895211-43895233 TTCTTGTGGAATAAAAAGGGAGG + Intergenic
1107810574 13:44196336-44196358 TACTTAGGGGACTAAAAGGGAGG - Intergenic
1109226327 13:59700244-59700266 TAATTGCTGGATAAAAGGGAAGG - Intronic
1109709550 13:66144168-66144190 TACTTGTGGGTTAAAGTGGGGGG + Intergenic
1110627329 13:77666064-77666086 TGCTTGGGGGATGAAGCGGGAGG - Intergenic
1111194903 13:84861743-84861765 TACTTGGGAGTCAAAAAGGGAGG + Intergenic
1111962294 13:94824888-94824910 GAGTTGGGGGATAAAAAGGAAGG - Intergenic
1112970779 13:105259337-105259359 TATTTGGGGGAAAAAAAGGGGGG - Intergenic
1113375388 13:109760665-109760687 TAAGTGGAGGAGAAAAGGGGAGG - Intronic
1119866614 14:77980095-77980117 TATTTGTGGAATAAAAGTGGGGG - Intergenic
1121778602 14:96607309-96607331 TGCTTGGGGGGTATATGGGGGGG + Intergenic
1124203703 15:27699551-27699573 TACATGTGGGAGAAAAGAGGAGG + Intergenic
1126870329 15:52980473-52980495 TATTTGGAGGATAAAATGTGAGG + Intergenic
1132015013 15:98307766-98307788 TTATTGTGGGATAAAAGGTGGGG + Intergenic
1132855516 16:2042955-2042977 TGCTGGGGGGAGAAAGGGGGAGG - Intronic
1133384045 16:5354498-5354520 TGCTTGGGGGTTAAATGAGGTGG + Intergenic
1136108539 16:28049763-28049785 TTCTTGGGGGAGTACAGGGGAGG - Intronic
1138664967 16:58558520-58558542 TGATTGGGGGTTGAAAGGGGTGG + Exonic
1140772101 16:78214475-78214497 GACTTGGAGGATGACAGGGGTGG - Intronic
1141685840 16:85569459-85569481 TACTTGGGTGGTAAATGTGGAGG + Intergenic
1141946452 16:87313623-87313645 TACTTGGGGGGTGAGGGGGGAGG + Intronic
1144425016 17:15133491-15133513 TACTTGGGTGTAAAAAGGTGGGG + Intergenic
1144774866 17:17780368-17780390 TTCTTGGGAGAAAAAAAGGGTGG - Intronic
1145245231 17:21264811-21264833 AACTTGTGGGTTAAAAGTGGGGG - Intergenic
1145391491 17:22459384-22459406 ACCTTGGGGGATGAAAGGGTAGG + Intergenic
1146241426 17:31231724-31231746 TATTTGGGGGAAAAAAAAGGAGG - Intronic
1146282982 17:31557513-31557535 TCCTGGGGGGATGAAAGGGCAGG - Intergenic
1146318052 17:31824366-31824388 TACTTGGGGGCTGAGATGGGAGG - Intergenic
1148041760 17:44712975-44712997 TACTGGGGAGATAAAAGGAAAGG - Intronic
1148326419 17:46785827-46785849 TTCTTTGGGGAGAAAAGGGAAGG + Intronic
1148970066 17:51472070-51472092 TACTTTGTGGCTAAGAGGGGAGG + Intergenic
1149654654 17:58303814-58303836 TACTTGGGGGATAAAAGGGGAGG - Intronic
1149684883 17:58529561-58529583 TCCTTGGGGGTTAACAGGAGAGG - Intronic
1149914644 17:60597943-60597965 TACTTGGGGGCTAAAGTTGGAGG + Intergenic
1152972579 18:178127-178149 TACTTGGGGGCTAAAATGGGAGG - Intronic
1155517941 18:26641575-26641597 TAACTTGGGGATAAGAGGGGTGG - Intronic
1157679893 18:49596819-49596841 CACTTGAGGGATATGAGGGGGGG - Exonic
1157720525 18:49920470-49920492 TAGTTGGGGGATAAAAGGAAAGG - Intronic
1162743607 19:12786851-12786873 TAATTGGGGGAGAAATGTGGTGG - Intronic
1162937107 19:13986808-13986830 TACTTGGGGGAGCCCAGGGGAGG + Intronic
1164691328 19:30212934-30212956 TTCCTGGGGGAGAAAGGGGGAGG - Intergenic
1166634764 19:44440831-44440853 TACTTGGGGGTTGAAGTGGGAGG - Intronic
1167401591 19:49275152-49275174 GACTTGGGGGATAAGAAGGAAGG + Intergenic
926052459 2:9753781-9753803 CACCTGGGGAAGAAAAGGGGGGG - Intergenic
929353099 2:40984438-40984460 TACTTGGGGGCTGAAGTGGGAGG + Intergenic
930280854 2:49367865-49367887 GACTTGGGGGAATAAAGAGGTGG - Intergenic
930744063 2:54862860-54862882 CCCTTGGGGGATAACAGGAGAGG + Intronic
930869307 2:56153889-56153911 CATTTGGGGGAGAAAAGGGAAGG + Intergenic
931995961 2:67839425-67839447 AATTAGGGGGAGAAAAGGGGAGG - Intergenic
932973841 2:76576696-76576718 AAAGTGGGGGATAAAAGAGGAGG + Intergenic
937313306 2:120915372-120915394 CACTTGGGGGAAAAACGTGGGGG - Intronic
937581963 2:123498352-123498374 TCATTGGGCAATAAAAGGGGTGG + Intergenic
940816492 2:158302905-158302927 AACTTGGGGGATCAAAGAGCAGG + Intronic
943282729 2:185958118-185958140 TACTTGGGGGAAATAGTGGGAGG - Intergenic
943613804 2:190068211-190068233 TATTTGGGGGATGGAAGGGTAGG - Intronic
943681369 2:190771488-190771510 GACTTGGGGGAGAGAAGGAGAGG - Intergenic
944697989 2:202220063-202220085 GACTTGGGGGATAAGAAGGAAGG - Exonic
946200059 2:218065995-218066017 GACTTGGGGGACAAGGGGGGTGG + Intronic
946836035 2:223773594-223773616 TACAAGGGGGAAAAAAGGGAGGG + Intronic
948284615 2:236773968-236773990 TATCATGGGGATAAAAGGGGTGG + Intergenic
948354845 2:237369944-237369966 TACTTGGAGGATAAGGAGGGAGG - Intronic
948397385 2:237656062-237656084 TAATTGGGGAATAAAAGGTAAGG + Intronic
1173763665 20:45587031-45587053 TACTTGTGGGTTAAGATGGGGGG + Intergenic
1175853217 20:62104768-62104790 TACTTGGGGGCTACTAGGGATGG + Intergenic
1179547777 21:42124207-42124229 TGCTTGGGGGACAAGAGGAGGGG + Intronic
1180658966 22:17449174-17449196 TAAATGGGGGATAAAAGAGGTGG - Intronic
1183282859 22:36942001-36942023 TATTAGGGGGATGAAAGGGAGGG + Intergenic
1184378960 22:44133089-44133111 TCCTGGGGGGAAAAAAGGAGGGG - Intronic
1185313108 22:50167524-50167546 TACTTGGGGGGTCAAGGTGGGGG + Intergenic
949333355 3:2946813-2946835 TACATGGGGGCTAAGAAGGGAGG - Intronic
949565564 3:5241813-5241835 TACTTGGAGGCTGAGAGGGGAGG - Intergenic
950092535 3:10306125-10306147 CATTTGGGTGATAAAATGGGGGG - Intronic
952865364 3:37851674-37851696 TAATTGCTGGATAAAGGGGGTGG + Intergenic
953434376 3:42866980-42867002 TACTTGGGGGCTTAGATGGGAGG - Exonic
954362088 3:50127284-50127306 TATTTAGGGGATAAATGGAGGGG - Intergenic
954452660 3:50580092-50580114 TACATGGGGGAGAAATGGGTGGG - Intronic
955226485 3:57064430-57064452 TACTTGGGGGCTGAGATGGGAGG - Intronic
955300887 3:57777474-57777496 TACTTGGGGGCTAAGACGGGAGG + Intronic
955713186 3:61801415-61801437 TACTTGGGGGCTGAAGTGGGAGG - Intronic
956263793 3:67375638-67375660 TCATTGGGGAAGAAAAGGGGAGG - Intronic
957675151 3:83356008-83356030 AAGTTGGGAGATACAAGGGGAGG + Intergenic
958975445 3:100662268-100662290 AAAATGGGAGATAAAAGGGGAGG + Intronic
960170417 3:114454454-114454476 TTGTTGGGGGGTAAGAGGGGCGG - Intronic
960619848 3:119627226-119627248 AAATTGGGGGAAAAACGGGGAGG + Intronic
962858197 3:139369542-139369564 TACCTGGGAGAAAAAAGGGAAGG + Exonic
964984774 3:162725358-162725380 TACTTGTGGGTTAAGATGGGGGG + Intergenic
965468613 3:169063041-169063063 TACTTGGGGGCTAACGTGGGAGG - Intergenic
965717325 3:171619735-171619757 TTGGTGGGGGATAAATGGGGAGG - Intronic
966063556 3:175788200-175788222 TACTTGGGGGCTAAGTTGGGAGG - Intronic
967885259 3:194329487-194329509 GACTTGGGGGCTGAATGGGGGGG - Intergenic
968263695 3:197345462-197345484 TCCTGGGGAGAAAAAAGGGGAGG - Intergenic
968821481 4:2855807-2855829 TACTTGGGGGCTGAAGTGGGAGG - Intronic
970026845 4:11633113-11633135 TACATGGGGAATAAAAGATGAGG - Intergenic
970598406 4:17620809-17620831 TACTGGGGGGCTGAAATGGGAGG - Intronic
972379278 4:38504000-38504022 AATTTGGGGGATTAAAGAGGAGG - Intergenic
972447074 4:39154526-39154548 TACTTGGGGGCTGAGATGGGAGG + Intergenic
972773485 4:42220027-42220049 TACTTGGAGGCTAAGATGGGAGG - Intergenic
974388514 4:61233934-61233956 TACTTGGGGGATAGAGAGGATGG + Intronic
975808275 4:78136493-78136515 AACTTGGGGCATGCAAGGGGAGG + Intronic
976908230 4:90266911-90266933 GACTTGGGGGCTATAAGGAGAGG + Intronic
977225238 4:94386316-94386338 AAGTGGGGAGATAAAAGGGGAGG + Intergenic
978742498 4:112153010-112153032 TAGTTGAGGGAAATAAGGGGAGG - Intronic
980196615 4:129597036-129597058 TACTTTGGGCATATAAGAGGAGG + Intergenic
980904043 4:138930727-138930749 AAGTTGGGGGATACAAGAGGAGG - Intergenic
981542630 4:145861522-145861544 TACTTGGGGCACAAACGGAGAGG - Intronic
983541851 4:168919672-168919694 TCCTCAGGGGCTAAAAGGGGAGG - Intronic
984390252 4:179121982-179122004 TTCTTGAGGGATAAAAAGGAAGG + Intergenic
989487241 5:42005829-42005851 TGCTTGGGTGATAGAAGAGGAGG - Intergenic
989660027 5:43788978-43789000 TACTTGTGGGTTAAAGAGGGGGG - Intergenic
992208542 5:74454712-74454734 TACTTGGGGGAAAAAATGCTGGG + Intergenic
992875365 5:81049223-81049245 GGCTTGGGGAATAAAGGGGGAGG - Intronic
993339742 5:86708702-86708724 TAATTGGGGGAAAAAAGGGTGGG + Intergenic
994316624 5:98340286-98340308 AAGTTGGGGGACAAAAGAGGGGG - Intergenic
994445851 5:99872654-99872676 GACTTGGGGGAAAGAATGGGAGG + Intergenic
995977151 5:118053220-118053242 TACCTGAGGGATCAAAGGGAAGG + Intergenic
1001118688 5:168960857-168960879 TACTTAAGGAATAAAAGTGGGGG + Intronic
1001129253 5:169050012-169050034 TACTTAGAGGAGAAATGGGGAGG - Intronic
1002814392 6:665770-665792 TACTTGGGGGGAAGAGGGGGAGG + Intronic
1003667285 6:8123119-8123141 TTTTTGGGGGAGATAAGGGGAGG + Intergenic
1004644950 6:17551945-17551967 TACTTAGGGGAAAAAATGTGAGG + Intronic
1004996902 6:21202413-21202435 TACTTGGGGGATAGTATGGGTGG + Intronic
1006079375 6:31556459-31556481 CACTTGGGGGATAGAAGAAGGGG - Intronic
1006565690 6:34954952-34954974 TACTTGAAGGATGAAGGGGGAGG - Intronic
1006709967 6:36059878-36059900 TGCATGGGCGATAAAAGAGGAGG - Intronic
1007050320 6:38821670-38821692 TACTTGGAGGCTGAAAGGGGAGG - Intronic
1007174651 6:39887623-39887645 TGCCTGGGGGACAAAGGGGGTGG + Intronic
1007322536 6:41038116-41038138 TACTTGGGGAAAAGAAGGGGTGG - Intronic
1011682019 6:89792503-89792525 TACGTGGGGGGTAAAGAGGGAGG + Intronic
1011786646 6:90854031-90854053 TAATTGGGGTATAAAGGGAGAGG - Intergenic
1012130276 6:95482130-95482152 TAGAAGGGGGATAAAGGGGGAGG + Intergenic
1012245434 6:96920807-96920829 TATTTGAGAGAGAAAAGGGGAGG - Intergenic
1012898913 6:104984103-104984125 TACTTGTAGAATAAAAGGTGTGG - Intronic
1013123425 6:107160455-107160477 TACTTGGGGGCTGAGATGGGAGG - Intronic
1013676743 6:112472539-112472561 TACTTTCGGGATGAAGGGGGAGG + Intergenic
1014439965 6:121462693-121462715 TACTCGGGGGCTAAAGTGGGAGG - Intergenic
1014454760 6:121623273-121623295 TACTTGTGGGTTAAGGGGGGTGG + Intergenic
1015188597 6:130447361-130447383 TATTTGGGAGATAAGAGAGGAGG + Intergenic
1017081232 6:150670876-150670898 GACTTGGGGGAAAGAATGGGAGG - Intronic
1020355467 7:7271067-7271089 TCCTTTGGGGAAAAAAAGGGTGG - Intergenic
1025238327 7:57250397-57250419 TACTTGGGTGAAGAACGGGGAGG - Intergenic
1027433010 7:78133913-78133935 GACTGTGGGGAAAAAAGGGGGGG - Intronic
1027539707 7:79452837-79452859 GACTTGGGGGCTAAAGGGAGGGG - Intronic
1028543630 7:91973270-91973292 TACTTGGGGGCTGAAGTGGGAGG + Intronic
1029707213 7:102282347-102282369 AAGTTGGGGGAGAAGAGGGGTGG + Intronic
1031234659 7:119159310-119159332 GACTTGGGGGAAAGAATGGGAGG - Intergenic
1031777447 7:125920448-125920470 TACTTGTGGGATAAAGTGGGAGG - Intergenic
1032734344 7:134677194-134677216 GGGTTGTGGGATAAAAGGGGTGG - Intronic
1033732177 7:144190811-144190833 TACTTGGGGGCTGAGATGGGAGG + Intronic
1033743027 7:144289396-144289418 TACTTGGGGGCTGAGATGGGAGG + Intergenic
1034343084 7:150370248-150370270 TACTGGGGCAATAGAAGGGGAGG - Intronic
1036031686 8:4980793-4980815 TACTTGGGGGCTGACACGGGAGG + Intronic
1037987361 8:23298399-23298421 GACTTGGGGAACAAAAGGGAAGG - Intronic
1043633070 8:82361459-82361481 TACTTGGCAGATAATAGTGGTGG + Intergenic
1043682151 8:83041540-83041562 TAATTGGGAGATAGAATGGGAGG + Intergenic
1044523943 8:93230281-93230303 GACTTGGGGAAAAAAAGTGGAGG - Intergenic
1045228177 8:100272644-100272666 TACTTGGGAGATTGAAGTGGAGG - Intronic
1049177663 8:141203568-141203590 CAATAGGGGGAGAAAAGGGGGGG + Intergenic
1050981173 9:12017927-12017949 TACTTGAGGGATGAATGTGGGGG + Intergenic
1051680917 9:19607228-19607250 TACTTGGGGGACCAAAGGATGGG - Intronic
1052326371 9:27220281-27220303 TATTAGGTGAATAAAAGGGGAGG - Intronic
1052590527 9:30487881-30487903 TACTTGGGAGAAATAAAGGGAGG - Intergenic
1053283014 9:36833552-36833574 GACTTGGGAGAAAACAGGGGTGG - Exonic
1055005003 9:71496352-71496374 AACTTGGGTTATAAAGGGGGTGG - Intergenic
1055344217 9:75317547-75317569 TATGTAGGGGAAAAAAGGGGGGG - Intergenic
1055695587 9:78880472-78880494 TATTTGGGGGAAAAATGGAGAGG + Intergenic
1058880921 9:109285486-109285508 TACTTGGGGGACATATGGGAGGG - Intronic
1059761072 9:117338295-117338317 TATTTGGGGGATTAAAAGGTTGG - Intronic
1062532112 9:137006590-137006612 CACATGGGGGACAACAGGGGAGG - Intergenic
1187771583 X:22704645-22704667 TACTTTGGGGAAAAAAGGAAAGG - Intergenic
1188486388 X:30686855-30686877 TACTTGGTGTAGATAAGGGGAGG + Intronic
1189404508 X:40708032-40708054 TGCTTGAGGGATTAAAGGGGAGG + Intronic
1189972032 X:46427554-46427576 TCCTTGAGGGGTGAAAGGGGTGG - Intergenic
1190020134 X:46866848-46866870 TACTGGGGTGATAAGTGGGGTGG - Intronic
1191678552 X:63817175-63817197 TACTTAGGTGAACAAAGGGGAGG + Intergenic
1194225635 X:91253641-91253663 GACTTGGGGGAAAGTAGGGGAGG - Intergenic