ID: 1149655644

View in Genome Browser
Species Human (GRCh38)
Location 17:58308465-58308487
Sequence GCTGCTGGTGGGCAGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 365}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149655631_1149655644 21 Left 1149655631 17:58308421-58308443 CCGGCCCCACCTCTGCTGATGGA 0: 1
1: 0
2: 7
3: 35
4: 313
Right 1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 365
1149655633_1149655644 17 Left 1149655633 17:58308425-58308447 CCCCACCTCTGCTGATGGAGGCA 0: 1
1: 0
2: 1
3: 22
4: 245
Right 1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 365
1149655635_1149655644 15 Left 1149655635 17:58308427-58308449 CCACCTCTGCTGATGGAGGCAGG 0: 1
1: 0
2: 6
3: 49
4: 421
Right 1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 365
1149655627_1149655644 30 Left 1149655627 17:58308412-58308434 CCCGGAGGCCCGGCCCCACCTCT 0: 1
1: 0
2: 8
3: 61
4: 518
Right 1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 365
1149655634_1149655644 16 Left 1149655634 17:58308426-58308448 CCCACCTCTGCTGATGGAGGCAG 0: 1
1: 0
2: 3
3: 20
4: 252
Right 1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 365
1149655629_1149655644 22 Left 1149655629 17:58308420-58308442 CCCGGCCCCACCTCTGCTGATGG 0: 1
1: 0
2: 7
3: 46
4: 486
Right 1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 365
1149655637_1149655644 12 Left 1149655637 17:58308430-58308452 CCTCTGCTGATGGAGGCAGGCAG 0: 1
1: 1
2: 1
3: 39
4: 307
Right 1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 365
1149655628_1149655644 29 Left 1149655628 17:58308413-58308435 CCGGAGGCCCGGCCCCACCTCTG 0: 1
1: 0
2: 4
3: 58
4: 489
Right 1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149655644 Original CRISPR GCTGCTGGTGGGCAGCAAGC AGG Intronic
900123267 1:1058630-1058652 GCTCCTGGAGGGCTCCAAGCAGG + Intergenic
900244183 1:1630043-1630065 GCTGCAGGTGGGCTGTGAGCTGG - Intronic
900550621 1:3252613-3252635 GGGGCTGGTGGGCAGCAGGGTGG + Intronic
900727246 1:4224809-4224831 GCTGCTGGTGGGTAGTGAGGAGG + Intergenic
900947086 1:5837142-5837164 GCTGCCGGTGGGCAGGAGGAGGG - Intergenic
901020710 1:6253951-6253973 GCTGCTGGTGGGCGGCAGCGTGG - Exonic
901381852 1:8879297-8879319 GCGGCTGGAGGGCAGCGCGCAGG - Intergenic
901616186 1:10541528-10541550 GCTGCTCGTGCGGAGCAGGCAGG + Intronic
902921117 1:19666386-19666408 CCTGCTTGCGGGCAGCTAGCAGG - Exonic
903366809 1:22810393-22810415 GCTCCTGGAGGGCAGCACGAAGG - Intronic
904200840 1:28818141-28818163 GCTGCAGGTGGGCAGAGTGCAGG + Intronic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
904622237 1:31782399-31782421 GGTTCTGGTGGGCAGCATCCAGG + Intergenic
904827299 1:33281820-33281842 GCTGCAGCAGGGCAGCAGGCAGG - Intronic
904829035 1:33295027-33295049 GCACCTGGTGGGCAGGAGGCAGG - Intronic
905340391 1:37273891-37273913 GCTGGAGCTGGGCAGCCAGCAGG - Intergenic
905622338 1:39459162-39459184 GCTGCCAGCGGGCAGAAAGCTGG - Exonic
905646129 1:39626193-39626215 GCTGCTGGTGTGCAGAGGGCAGG + Exonic
906196428 1:43933359-43933381 GCTGCTGCAGGGCAGACAGCCGG + Exonic
907284381 1:53370712-53370734 ACTGCTGCTGGGCAGCGGGCAGG - Intergenic
908553171 1:65230144-65230166 GCTGCTAGAGGGCAGCAGGGGGG - Exonic
910180130 1:84473602-84473624 GCTGTTGGTGGGAAGAAAACTGG - Intergenic
912366564 1:109138555-109138577 GCTGCTGGTGGGGAGGGAGGAGG - Intronic
912500242 1:110116885-110116907 GCTGATGGAGGGGAGCAAGTCGG - Intergenic
912510339 1:110185380-110185402 CCTGCTGGTGTGGAGCCAGCCGG - Intronic
914825296 1:151135010-151135032 TCTGAAGGTGGGCAGCAACCAGG - Intronic
915653336 1:157335925-157335947 CTTGCTGGTGGGCAGGAAGCAGG + Intergenic
915684237 1:157615582-157615604 CTTGCTGGTGGGCAAGAAGCAGG - Intergenic
916143417 1:161719620-161719642 GCTGAGGGTGGGCAGCAACTAGG + Intergenic
916992183 1:170255946-170255968 CCTGTTGGTGGACAGGAAGCTGG + Intergenic
917790243 1:178494784-178494806 GCAGCTGGTGAGCAGTAAGAGGG - Intergenic
919135121 1:193497942-193497964 GCTGCCAGTGGGGAGCTAGCAGG + Intergenic
919764927 1:201120873-201120895 GCTGCTTTTGGGCAGCAACAGGG + Intronic
920258762 1:204674590-204674612 GCTGCAGGTGGGCAGGACCCAGG - Intronic
920273945 1:204789963-204789985 GCTGCTGGTGGGTGGCAGGGAGG + Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920824350 1:209411507-209411529 TCTGCTGAGGGGAAGCAAGCTGG - Intergenic
921482027 1:215674674-215674696 GCTGCAGGTGGGAAACCAGCAGG + Exonic
922774374 1:228208069-228208091 GCTGCTGGTAGGCAGCCTGCTGG + Intronic
922842036 1:228650463-228650485 GCTGCAGGAGGGCAGCATCCTGG + Intergenic
923762542 1:236860048-236860070 GCAGCTGGGGGACAGCAAGAGGG - Intronic
1063612769 10:7576861-7576883 GAAGCTGGTGGACAGGAAGCTGG - Exonic
1063973456 10:11397261-11397283 GCTGCTGGTGGGCAGGACTAGGG - Intergenic
1067299239 10:44994056-44994078 GCTGCTGCTGGGCATTGAGCGGG - Exonic
1067817790 10:49495723-49495745 GCTCGTGGTGGAGAGCAAGCAGG - Intronic
1069813453 10:71179087-71179109 GCTGCAGGTGGGAAGCAATGAGG - Intergenic
1070801845 10:79248501-79248523 GCTGCTGCTGAGTAGCAGGCAGG + Intronic
1070919098 10:80172812-80172834 GCAGCTGGTGGGTAGCCACCTGG + Exonic
1071305292 10:84294099-84294121 GCATCTGGGGTGCAGCAAGCAGG - Intergenic
1072787358 10:98293345-98293367 GATGCTGGGGGGCAGCTAGATGG + Intergenic
1073471192 10:103723348-103723370 GGAGCTGGTGGGCAGAAGGCAGG - Intronic
1074755123 10:116618774-116618796 GCTGCTGGTGGGAATTACGCTGG + Intergenic
1076910419 10:133385346-133385368 GTTGCTGGTGGGCAGCCGGGTGG + Intronic
1077376623 11:2208278-2208300 GCAGCTGGTGGGCAGTGAGTGGG + Intergenic
1077469730 11:2751549-2751571 ACTGCTGGTGGGCACCATCCCGG + Intronic
1077502084 11:2913951-2913973 GCGGTTGGTGGGCAGGATGCAGG + Intronic
1077633740 11:3827787-3827809 CCTGCTGGTGGGCACCAAGAAGG - Exonic
1077770226 11:5210253-5210275 TCTTCTAGTGGGAAGCAAGCTGG + Intergenic
1078448488 11:11422798-11422820 GCAGCTGGTGGCAAGCAATCTGG + Intronic
1078559064 11:12354984-12355006 GCTGCTGGTGGGAGGCAGGCTGG - Intronic
1078682221 11:13487503-13487525 GCAGCTGGTGGGCCGCAAGTTGG - Intergenic
1079078683 11:17398820-17398842 GTTTGTGGTGGGCAGGAAGCAGG - Intronic
1080382728 11:31790807-31790829 AGGGCTGGTGGGCAGCATGCAGG + Exonic
1081142077 11:39513891-39513913 GCTGCAGGTTTGCAGCAAGAGGG - Intergenic
1081491637 11:43574066-43574088 GCTGCTGATGGGCTGCCAGAGGG + Intronic
1081712822 11:45228460-45228482 GCTGTTGGTGGACAGTAAGGTGG - Intronic
1081778608 11:45694397-45694419 GCTGGTGATGGGCAGGAAGGTGG - Intergenic
1083173518 11:60936173-60936195 GTGGCTGGTGGGCTCCAAGCAGG - Exonic
1083441471 11:62679227-62679249 GCTGCTGTGGGGAAGAAAGCTGG + Intergenic
1083682782 11:64359032-64359054 GCTGCCGGTGGGCGGCCGGCTGG - Intergenic
1083903855 11:65657517-65657539 GCTGATGTTGGGCAGTGAGCAGG - Intronic
1084727102 11:70949081-70949103 GCAGCTGGTTGGCAGGGAGCTGG - Intronic
1087016576 11:93559961-93559983 GCTGCGAGTGGGCAGGAAGTGGG + Intergenic
1088847985 11:113683609-113683631 GGTGCTGGAGGGAACCAAGCTGG - Intergenic
1089561615 11:119346049-119346071 GCTGCTGGTGGCCATCATCCTGG - Exonic
1090748541 11:129726485-129726507 GCTTCTGGTGGGAAGCAGGGAGG - Intergenic
1090776938 11:129974040-129974062 GCTGCTGGTGAGCTGGAGGCGGG - Intronic
1090999259 11:131894676-131894698 GCTGCTGGTGGTTTGCAATCTGG - Intronic
1091147375 11:133291456-133291478 GCTGCTGGTGGGCACCCCTCAGG + Intronic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1091362054 11:134985682-134985704 GCCTCTGATGGGCTGCAAGCTGG - Intergenic
1091362094 11:134985927-134985949 GCCTCTGATGGGCTGCAAGCTGG - Intergenic
1091797664 12:3306463-3306485 GGTCCTGGTGGGCAGGAAGCTGG - Intergenic
1091802009 12:3330338-3330360 GCTGCAGATGGGCAGCTAGGAGG + Intergenic
1092387553 12:8047860-8047882 CCTGCAGGTGGGGAGGAAGCAGG - Exonic
1093430661 12:19081507-19081529 GCCCCTTGTGGGCATCAAGCAGG + Intergenic
1093911839 12:24757114-24757136 GCCTCTGGTGTGCAGCAAGATGG - Intergenic
1095261624 12:40105424-40105446 GCTGCTGGTGTCCAGCACGGTGG - Exonic
1103090614 12:118095524-118095546 GCTGCAGGTGGCCAGTAAGTGGG - Exonic
1103921513 12:124401869-124401891 GCTGCAGGAGTGCAGCCAGCTGG - Intronic
1104013548 12:124948234-124948256 GCTGCTGGGGGCCCGAAAGCAGG + Intronic
1104720669 12:131043539-131043561 GCTGCGTGTGGGCAGGAGGCTGG + Intronic
1105502837 13:20988195-20988217 CCTGCTGCTGCGCAGCAAGTCGG - Exonic
1105657246 13:22454814-22454836 CCTGCTGGTGAGGAGGAAGCCGG - Intergenic
1105947840 13:25204493-25204515 GCTGCTGTTGTCCAGCATGCAGG - Intergenic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1106081155 13:26501214-26501236 GCTGCATGTGGGCAGCCTGCAGG - Intergenic
1107450798 13:40507269-40507291 GGTCCTGGTGGGTGGCAAGCAGG + Intergenic
1110013063 13:70363593-70363615 GGTGCTAGTGTGGAGCAAGCAGG - Intergenic
1111846272 13:93513150-93513172 GCTTCTGTTGGGAATCAAGCGGG + Intronic
1112376285 13:98844607-98844629 GCTGCTGGTGGCCAAGCAGCAGG - Intronic
1113565877 13:111319540-111319562 GCTGCTGGGGGGCTGGAGGCTGG - Intronic
1113804329 13:113104538-113104560 GATGCAGGTCAGCAGCAAGCAGG + Intergenic
1115713201 14:36073083-36073105 GCTGCTGGTGTGCGGCCTGCTGG + Intergenic
1115828669 14:37309625-37309647 GCAGCTGGTAGTCAGAAAGCGGG - Intronic
1115993923 14:39175780-39175802 GCTGCACGTGGACAGGAAGCTGG - Intronic
1116250481 14:42475498-42475520 GCTCCGGGTGGTCAGCAACCAGG - Intergenic
1118253864 14:64187944-64187966 ACAGCTGGTCTGCAGCAAGCAGG - Intronic
1118489124 14:66242266-66242288 GCTGCTGATTGGCACCAAGGAGG + Intergenic
1121062941 14:90933347-90933369 GCTGCTGATGGGGAGCTATCTGG - Intronic
1122465149 14:101928467-101928489 GCTGCGTGTGGTCAGCACGCCGG + Intergenic
1122540719 14:102496355-102496377 GTTGCCGGTGGACAGCAAACAGG + Intronic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1123048250 14:105528625-105528647 GCGCCTGGTGGGAAGCACGCGGG + Intronic
1124652527 15:31484140-31484162 GTGGCTGGTGAGCAGCAGGCCGG + Exonic
1125734897 15:41918053-41918075 GCTGCTAATGAGCAGCAAGAAGG + Intronic
1126578450 15:50220491-50220513 GCTGCTGGCGGGCTGCATGTGGG + Intronic
1127359031 15:58228798-58228820 GCTGCTGGTGGCAGGGAAGCAGG + Intronic
1127622375 15:60746333-60746355 GCTGCAACTGGGCAGCAAGCTGG - Intronic
1127845463 15:62866570-62866592 GCTGCTGTGGGTCAGCAATCAGG + Intergenic
1127869667 15:63060862-63060884 GCTGCAGGTGGCCCGTAAGCTGG + Exonic
1128107984 15:65058443-65058465 CCTGCTGCTGGGCAACAAGCTGG - Exonic
1128468257 15:67930555-67930577 CCTGCTGATGGGGAACAAGCTGG + Intergenic
1129605351 15:77022295-77022317 TCAGCTGGTGGGCAGGCAGCAGG + Intronic
1131630584 15:94172998-94173020 GTTGCTAGGGGGCAGAAAGCAGG + Intergenic
1132173474 15:99688213-99688235 TCTGCTGTTGGACTGCAAGCTGG + Intronic
1132762625 16:1518187-1518209 GCTGCTAGTGAGCAGCACTCAGG + Intronic
1132809733 16:1791799-1791821 GGTGCTGGCGGGCAACAGGCTGG - Exonic
1134102537 16:11462168-11462190 ACGGCAGGTGGGCAGCAAGCTGG - Exonic
1135861568 16:26060460-26060482 GCTGTTGGAGAGCAGGAAGCAGG - Intronic
1136496740 16:30649856-30649878 GCTGTTGGTGGGGAGGAAGTGGG - Intergenic
1136612247 16:31373258-31373280 CCTGCTGGTGGGGAGTAACCTGG + Exonic
1137272959 16:46914848-46914870 GCTGCTGGTGTGCAGTAATGGGG + Intronic
1137715284 16:50594772-50594794 GCTGCTGGTGGGGAGCACATAGG + Intronic
1138174093 16:54880479-54880501 GCTGCTGGTGTTCTGGAAGCAGG - Intergenic
1138340265 16:56284620-56284642 GCTGCTGGGGGGCAGCTGGGAGG - Intronic
1138646481 16:58429195-58429217 GCAGCTGGAGGGCAGTGAGCGGG - Intergenic
1139489270 16:67278061-67278083 GGTGCTGGTGGGCAGCAGAAGGG + Exonic
1141703106 16:85651393-85651415 GGGGCTGGGGGGCAGCCAGCAGG - Intronic
1142266057 16:89064396-89064418 GCAGCCGGTGGGCAGCAGTCTGG - Intergenic
1142291091 16:89193864-89193886 GGGGCTGGTGGGCAGCACTCGGG - Exonic
1143033975 17:3983928-3983950 GCTGCTGGCAGGGAGCATGCTGG + Intergenic
1143057621 17:4173981-4174003 GGTCCTGCTGGGCAGCAAGATGG + Exonic
1143121098 17:4607403-4607425 GATGGTGATGGGCCGCAAGCCGG + Exonic
1144623398 17:16832397-16832419 GCTTCTGGTGGGCAGTGAGAAGG - Intergenic
1144883034 17:18440319-18440341 GCTTCTGGTGGGCAGTGAGAAGG + Intergenic
1144884793 17:18450567-18450589 GCTTCTGGTGGGCAGTGAGAAGG + Intergenic
1145147431 17:20493810-20493832 GCTTCTGGTGGGCAGTGAGAAGG - Intergenic
1145149198 17:20504067-20504089 GCTTCTGGTGGGCAGTGAGAAGG - Intergenic
1145777777 17:27541202-27541224 GGTGCTGGTGAGCTGGAAGCTGG + Intronic
1146652656 17:34616178-34616200 GCTGCTGGGAGTCAGCAGGCAGG + Intronic
1146884140 17:36459689-36459711 GATGCTGGTGAGCGGCAAGCAGG - Intergenic
1147398451 17:40163683-40163705 GAAGCTGGTGGGCAGCATGGTGG + Exonic
1147573606 17:41586486-41586508 GCTTCTGGTGGGCAGTGAGAAGG - Exonic
1147577723 17:41612334-41612356 GCTTCTGGTGGGCAGTGAGAAGG - Exonic
1147746379 17:42697309-42697331 GCTGTTGGTGGACAGCCAGTTGG + Exonic
1147845265 17:43400122-43400144 GCTGGTGCTGGCCAACAAGCAGG + Exonic
1148127690 17:45245389-45245411 GCTGCTGGCAGACAGCAAGACGG + Exonic
1148960035 17:51385174-51385196 GCTGCTGCTGCGTAGTAAGCTGG + Intergenic
1149609167 17:57947126-57947148 TCTCCTGGTGACCAGCAAGCTGG - Intronic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1151805315 17:76401229-76401251 TCTGCAGGTGGGCAGCCAGCGGG - Intronic
1152732015 17:81977242-81977264 GCTGCTGGAGTGGAGGAAGCCGG + Intronic
1152744736 17:82033481-82033503 CCTCCTGGTGGGCACCAAGCTGG + Exonic
1152746081 17:82039983-82040005 GCTGCTGGCAGGCAGAAAGCAGG - Intergenic
1152753959 17:82079208-82079230 GCTGCTGGAGGGCAGCGGCCTGG - Exonic
1153874754 18:9359186-9359208 GCTGCTGGTTGGTTGGAAGCTGG + Intronic
1155077414 18:22371961-22371983 GGTGCTGGTGTGCAGCCAGTAGG + Intergenic
1155229283 18:23757366-23757388 GCTGCTGGAGAGCGCCAAGCAGG - Intronic
1156181635 18:34612043-34612065 GCTGCAGTTGAGCAGCAAGTGGG - Intronic
1156364076 18:36409246-36409268 GCTGCTGGTCTGAAGCATGCAGG + Intronic
1156399035 18:36724387-36724409 TCAGCTGGTGGGCAGCTACCTGG - Intronic
1159529870 18:69641798-69641820 GCTGCTTGTGCACAGCAAGATGG - Intronic
1160233553 18:77067647-77067669 GCTGCTGGTGGGTAGCACCAGGG - Intronic
1160256257 18:77250716-77250738 CGTGCTGGCGCGCAGCAAGCCGG + Exonic
1160966965 19:1750898-1750920 GCTGGTGGGGAGAAGCAAGCTGG + Intergenic
1161055914 19:2190562-2190584 GCAGCTGGTGGGGAGGAAGGCGG + Intronic
1161379928 19:3959512-3959534 GCTGTTGTTGGGCGGCAAGCTGG + Exonic
1162559037 19:11405322-11405344 GCAGCTGGGGGGCAGTGAGCCGG - Exonic
1163157352 19:15446686-15446708 GCACCTGGTGGGGAGCAACCAGG - Intronic
1163582614 19:18147478-18147500 GCGGCTGGTGTGCAGCACGGAGG - Exonic
1163648126 19:18501830-18501852 TCTGCGGGTGGGCAGGAAGGAGG + Intronic
1163720528 19:18896233-18896255 GCGGCTGGGGGGCGGCCAGCGGG + Intronic
1163799599 19:19356558-19356580 GCTGCTGAGGGGCAGGAAGCGGG + Exonic
1164088674 19:21928365-21928387 GATGCCTGTGGGCAGAAAGCAGG - Intergenic
1164098444 19:22032732-22032754 GCTGCCTGTGGGCAGCATGAAGG + Intergenic
1164684983 19:30160681-30160703 GCTGCAGGCGGGGAGAAAGCCGG - Intergenic
1167125521 19:47545770-47545792 GCTGCTGGGGGGCGGCTGGCCGG + Exonic
1167468851 19:49664484-49664506 ACTGATGGTGGGGCGCAAGCAGG - Intronic
1168699524 19:58428469-58428491 ACTTCTGGTGGCCACCAAGCAGG - Intergenic
1202652607 1_KI270707v1_random:20569-20591 GCTGTTGGTGGGAGGCAAGAGGG - Intergenic
925216938 2:2104731-2104753 GATGCTGGTGGGAATAAAGCAGG - Intronic
927704841 2:25290752-25290774 GCTGCAGGTGGGCTGCAGCCTGG - Intronic
929581097 2:43082250-43082272 GCGGCAGGTGGTCACCAAGCGGG + Intergenic
932292326 2:70593024-70593046 GCTGCTGGTTGACAGGAAACAGG - Intergenic
933981605 2:87555253-87555275 GCTGCAGCTGGGCAGGATGCGGG + Intergenic
934692285 2:96370905-96370927 GCTGTTGGGGGGCAGTAAGGCGG + Intronic
935091478 2:99898902-99898924 GCTGCTGGTGGGGAGGAGGCAGG - Intronic
935583014 2:104775058-104775080 GGACCTGGTGGGCAGCTAGCTGG + Intergenic
935848009 2:107187659-107187681 GCTGCAGTTGGGGAGGAAGCAGG - Intergenic
936981054 2:118265729-118265751 GCTGCTGATGCACAACAAGCAGG - Intergenic
937089278 2:119195153-119195175 GCTGCAGGTGGACAAAAAGCAGG + Intergenic
938288826 2:130138828-130138850 GCTGAGGGTGGGCACTAAGCTGG + Intergenic
938467707 2:131534103-131534125 GCTGAGGGTGGGCAGTAAGCTGG - Intergenic
940044403 2:149393609-149393631 GCCCCTTGTGGGCAGCCAGCAGG + Intronic
945322644 2:208443242-208443264 CCTGCTGGAGGGGAGCAGGCTGG + Intronic
946054385 2:216888167-216888189 GCTGCAGCTGGGCTGCTAGCTGG + Intergenic
946860991 2:224000269-224000291 GGTGCTGGTGGCCAGGAAGAGGG + Intronic
947073681 2:226318836-226318858 GCTGCAGGTGGGGAACAAACTGG + Intergenic
947463985 2:230325450-230325472 ACTGCTCTTGGGCAGCAAGCAGG - Intergenic
947472909 2:230414611-230414633 GCTGCCTCTGGGCAGCAGGCAGG - Intergenic
947669562 2:231927607-231927629 GCTGCTGCTGAGCAGGACGCAGG + Intergenic
947826123 2:233107192-233107214 GCTGCTGGTGGGTAGGCAGGGGG + Intronic
948047021 2:234952401-234952423 GGTGCTGGTGGGCAGGGACCCGG + Intronic
948385325 2:237577289-237577311 GATGCTGGTGGGCAACAAGACGG - Exonic
948615949 2:239199097-239199119 GGTGGTGGGGGGCAGGAAGCAGG - Intronic
948710366 2:239821486-239821508 GCTGGTGGATGGCAGAAAGCCGG - Intergenic
948994567 2:241571926-241571948 GCCCCTGGGGGGCAGCAGGCAGG + Intronic
949007231 2:241656558-241656580 GGGGCTGGTGGGGAGCAGGCAGG - Intronic
949077706 2:242071647-242071669 GGTGCAGATGTGCAGCAAGCAGG + Intergenic
1172273466 20:33667362-33667384 CCTGCTGGTGGGCGGCCTGCGGG + Exonic
1172772539 20:37389884-37389906 TCATCAGGTGGGCAGCAAGCAGG - Intronic
1174295108 20:49540172-49540194 GGTGCTGGGGAGCAGCAAGGAGG + Intronic
1174501044 20:50984818-50984840 GCTGCTCTGGGGAAGCAAGCTGG - Intergenic
1176000215 20:62828289-62828311 GCTGAGGGTGGGCACCCAGCAGG - Intronic
1176025165 20:62981995-62982017 CCTGCTGGGGGGCAGTGAGCAGG + Intergenic
1176057355 20:63155741-63155763 GCTGCTGGTGGGAAGTAGGTGGG - Intergenic
1176599544 21:8779085-8779107 GCTGTTGGTGGGAGGCAAGAAGG + Intergenic
1178200359 21:30396262-30396284 GCAGCTGGTGGGCTCCCAGCAGG - Exonic
1178735273 21:35143552-35143574 ACTACTGGTGAGAAGCAAGCTGG + Intronic
1179396568 21:41045649-41045671 GCTTCAGGTGTACAGCAAGCAGG + Intergenic
1179841677 21:44080011-44080033 GCTGCTGGTCTGCAGGTAGCTGG - Exonic
1180418891 22:12795821-12795843 GCTGTTGGTGGGAGGCAAGAGGG - Intergenic
1180800309 22:18628595-18628617 GCTGCTGCTGGGCACCATGGAGG - Intergenic
1180851543 22:19024159-19024181 GCTGCTGCTGGGCACCATGGAGG - Intergenic
1181221407 22:21366671-21366693 GCTGCTGCTGGGCACCATGGAGG + Intergenic
1181307124 22:21923181-21923203 GCTGCTGGAGGGCGGGAACCAGG - Exonic
1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG + Intergenic
1181618400 22:24070934-24070956 ACTGCTGATGGGCATCGAGCAGG + Exonic
1181672080 22:24430379-24430401 GAGGCTGGTGGGCAGCAGGAAGG + Intronic
1181695018 22:24588639-24588661 GCTGAGGGTGGGCAGGCAGCCGG - Intronic
1181742875 22:24935423-24935445 GCTGATGATGGGCAGGAGGCTGG + Exonic
1183332983 22:37231327-37231349 CATCCTGGTGGGCACCAAGCTGG - Exonic
1183491568 22:38119501-38119523 GCTGCTTGGGGGCAGCAAAGGGG + Intronic
1183780337 22:39995153-39995175 GCTGCTGGGCGGCGGCGAGCAGG + Exonic
1183782926 22:40010134-40010156 GCCGGGGGTGGGCAGCCAGCTGG + Intronic
1183986811 22:41574714-41574736 GATGCTGGCGGGCAGGAAGAGGG - Exonic
1184355135 22:43974726-43974748 CCTGCTGGAGGACAGCAGGCTGG - Intronic
1184648556 22:45909115-45909137 GCTGCAGGGGGGCAGCCAGGTGG - Intergenic
1184648564 22:45909143-45909165 GCTGCAGGGGGGCAGCCAGGTGG - Intergenic
1184648572 22:45909171-45909193 GCTGCAGGGGGGCAGCCAGGTGG - Intergenic
1184761493 22:46547265-46547287 GCAGCTGGAGGGCAGCAGGAAGG + Intergenic
1184781717 22:46652932-46652954 GTCGCTGGTGGGCAGGAGGCAGG + Intronic
1184871064 22:47238753-47238775 GCAGCTGGTGGGAGGGAAGCAGG - Intergenic
1185241828 22:49750862-49750884 GGGGCTGGTGGGGAGGAAGCTGG - Intergenic
949319250 3:2790350-2790372 CCTGATGGAAGGCAGCAAGCTGG - Intronic
949908112 3:8875915-8875937 GGTTCAGGTAGGCAGCAAGCAGG - Intronic
951708385 3:25566554-25566576 GCTGCAGCTGGGCACCAAGTTGG - Intronic
953698744 3:45179897-45179919 GCTGTTGGGGGGCAGCCAGAGGG + Intergenic
953749959 3:45601437-45601459 GCTGCTGGGGTGCGGCAGGCAGG - Intronic
953851688 3:46469818-46469840 TCTGCTGAAGGGCAGCAGGCAGG + Intronic
954451782 3:50575676-50575698 GGGGATGGTGGGCAGCAAGTGGG - Intronic
954779992 3:53051727-53051749 TCTGCAGGTGGGCATCAACCTGG + Intronic
957215747 3:77317709-77317731 GCTGCTGGGGGGCTGCTAGGGGG + Intronic
957215776 3:77317778-77317800 GCTGCTGGGGGGCTGCTAGGGGG + Intronic
957215797 3:77317824-77317846 GCTGCTGGGGGGCTGCTAGGGGG + Intronic
957215830 3:77317903-77317925 GCTGCTGGGGGGCTGCTAGGGGG + Intronic
957625755 3:82650527-82650549 GCTCTTGGTGGGCTGGAAGCAGG + Intergenic
960166555 3:114409302-114409324 GCTACAGGTGGAAAGCAAGCAGG + Intronic
961039062 3:123664141-123664163 ACTGCTGGTGGAGAACAAGCTGG - Exonic
961244621 3:125440617-125440639 CCTGCAGGTGGGCAGGATGCAGG + Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
961819739 3:129569897-129569919 GCAGCTGGGGGGCAGCGAGACGG - Exonic
961933076 3:130554467-130554489 GGTGCTGGTGGGCACGAGGCTGG + Intergenic
962251631 3:133839522-133839544 CATGCTGGTGGGCAACAAGACGG - Exonic
963067388 3:141274378-141274400 GCAGATGGGGGTCAGCAAGCTGG - Intronic
963635851 3:147794717-147794739 TCTGCTCCTGTGCAGCAAGCAGG + Intergenic
963733137 3:148991686-148991708 GCGGCGGCTGGGCAGGAAGCCGG - Intronic
964119035 3:153163026-153163048 GATCCTGGTGGGCAACAAGGTGG + Exonic
964743580 3:159990726-159990748 GAAGCTGGTGGGCAGCAGGAGGG - Intronic
965893126 3:173539259-173539281 GGTGCTGGTGGGGAGAAAGAAGG + Intronic
966277983 3:178198726-178198748 GCTGCTGGTGGCCAGGAAAGGGG + Intergenic
966834442 3:184038434-184038456 CCTGATGGTGGGCAGCCTGCTGG + Exonic
966840543 3:184083777-184083799 CCTGGTGGTGGGCAGCCTGCTGG + Intergenic
966843233 3:184106153-184106175 CCTGATGGTGGGCAGCCTGCTGG + Exonic
968602564 4:1517262-1517284 GCTGCTGGTGGGCGGAGGGCTGG - Intergenic
969068166 4:4507177-4507199 GCTGCTGCTGAGCATCAAGAGGG - Intronic
969489163 4:7489208-7489230 GGTGCTGGGTGGCAGGAAGCTGG + Intronic
969612750 4:8236325-8236347 GCTGCGGCTGTGCAACAAGCTGG + Exonic
969868304 4:10089611-10089633 CCTGCAGGTGGGCAGCAAGAGGG - Intronic
970236057 4:13959191-13959213 TCTGCAGGAGGGCAGCAACCAGG - Intergenic
970386389 4:15561070-15561092 ACAGCTGGTGGGCAGAGAGCTGG + Intronic
973362896 4:49181456-49181478 GCTGTTGGTGGGAGGCAAGAGGG + Intergenic
973398203 4:49615398-49615420 GCTGTTGGTGGGAGGCAAGAGGG - Intergenic
973796950 4:54437083-54437105 GCTGGTGGAGGGCAGGAAGAAGG + Intergenic
974963953 4:68736927-68736949 GCTGCTAGTGGGAAGCACTCTGG - Intergenic
975444797 4:74450045-74450067 GCTGCTTGTGGGAGGTAAGCGGG - Intronic
977824342 4:101512498-101512520 GCTGGTGATGGTGAGCAAGCAGG - Intronic
981002337 4:139839883-139839905 GCTGCTGGTGGCCAGCAGTGGGG + Intronic
984639330 4:182144710-182144732 GCTGCTGCCGGGGAGCGAGCCGG + Intronic
985519249 5:363664-363686 GCTGGTGGTGGGCAGAGACCTGG - Intronic
985570163 5:640523-640545 GCTGCTGCTGCTCAGCAAGGCGG - Exonic
985745932 5:1647744-1647766 GATGCTGGTGGGCACCAAGCAGG - Intergenic
988492631 5:31717764-31717786 GCTGCTGGTGGGCATCTGGGAGG + Intronic
989010149 5:36862216-36862238 GCTGGTGTTGGGCTGCAAGGTGG + Intergenic
993363416 5:87005424-87005446 GCTCCTGATGGACAGCCAGCTGG + Intergenic
995833556 5:116378638-116378660 TCTGCTCGGGGGCAGCAAGCAGG + Intronic
996760426 5:126981148-126981170 ACTTCTGATGGGCAGCAAGTTGG + Intronic
997413392 5:133707237-133707259 ACTGCTGGTGGGCAGGATCCTGG - Intergenic
997690171 5:135822977-135822999 GCTTCTGGTGAGCAGGAACCAGG - Intergenic
998447619 5:142210886-142210908 GAGGCTGGTGGACAGAAAGCGGG + Intergenic
998657280 5:144195411-144195433 GGTGCTGGATGGTAGCAAGCAGG - Intronic
999178816 5:149654303-149654325 GGTGCAGGGGGGCAGGAAGCAGG + Intergenic
1002017214 5:176334518-176334540 GCTACTGGGGGGTTGCAAGCTGG - Intronic
1002608904 5:180400936-180400958 GCTACTGTTGAGCAGCAAGAAGG - Intergenic
1002650650 5:180690662-180690684 GCAGGTGGTGAGCAGCCAGCTGG + Intergenic
1002912925 6:1504969-1504991 GAAGCTGGTGGGGAGCAAGGAGG + Intergenic
1003322253 6:5062637-5062659 GCTGCAGGTGAGCTGCCAGCTGG + Intergenic
1003444119 6:6169297-6169319 GCTGCTGGTGTGCAGACCGCAGG - Intronic
1003554499 6:7127796-7127818 TCTGCAGGTGAGCAGCGAGCTGG - Intronic
1003995700 6:11537867-11537889 GGTGCTGATGGGCAGCCGGCAGG - Intergenic
1005051249 6:21685843-21685865 GCAGAGGGTGAGCAGCAAGCAGG + Intergenic
1005494325 6:26375442-26375464 GCTGCTGGCAGGGAGGAAGCAGG + Intronic
1005498812 6:26412339-26412361 GCTGCTGGCAGGGAGGAAGCAGG + Intronic
1005503572 6:26450887-26450909 GCTGCTGGCAGGGAGGAAGCAGG + Intronic
1006334062 6:33411236-33411258 GCTGGTGGGGGGCAGGGAGCCGG + Intronic
1006437330 6:34032850-34032872 GCTGCTGGCAGGCAGCCAGGGGG + Intronic
1007113142 6:39325152-39325174 GCTGCTGGTGGAAAGCTAGGAGG - Intergenic
1007655729 6:43450040-43450062 GCTGCTGCAGAGCAGCCAGCAGG + Exonic
1008981651 6:57490250-57490272 CCTGGTGGTAGGCAGCAAACTGG + Intronic
1009169724 6:60383073-60383095 CCTGGTGGTAGGCAGCAAACTGG + Intergenic
1013637097 6:112039259-112039281 GCTGCTCGTGGGCGCCAAGAAGG - Intergenic
1018079309 6:160245316-160245338 GCTGACGGTGGGCAGCAATGTGG - Intronic
1018509307 6:164507730-164507752 GGTGCTGATGGGCAGCCAACAGG - Intergenic
1018669502 6:166167489-166167511 GCTGCAGGCGGGCAGCGAGAAGG - Exonic
1018911908 6:168106129-168106151 TCGCCTGGTGGGCATCAAGCAGG - Intergenic
1019062109 6:169263892-169263914 CATGCTGGTGGGCAAGAAGCCGG - Intergenic
1019069657 6:169333232-169333254 GCTGCTGGTGGGTAGAAAACAGG - Intergenic
1019354030 7:569740-569762 GCACCTGGTGGACAGCAGGCAGG + Intronic
1019534558 7:1522053-1522075 GCTGCTGGCGTGGAGTAAGCGGG - Intergenic
1021210105 7:17839917-17839939 GCTGCTGTTGGGCGGTAACCCGG + Exonic
1021403982 7:20242896-20242918 TCTGATAATGGGCAGCAAGCAGG - Intergenic
1022028165 7:26467764-26467786 GGAGCTGGTGGGCAGGAAGCAGG - Intergenic
1022109515 7:27219900-27219922 GCTGAGGGTGGGCAGCAAGGAGG + Intergenic
1022582214 7:31566571-31566593 GCTGCTGGTAGGAAGGAGGCAGG + Intronic
1023670467 7:42570998-42571020 GCTGCTGGTGGAGATGAAGCTGG - Intergenic
1023736609 7:43241200-43241222 GCTGAAGGTGGGCTGCGAGCAGG + Intronic
1023996785 7:45163446-45163468 GCTGCTGGTGTCCAGGAAGGAGG + Intronic
1024417271 7:49121337-49121359 GCTGCAGCTGGGTACCAAGCAGG - Intergenic
1024439446 7:49398954-49398976 GAGGCTGGTGGGAAGCAAACAGG + Intergenic
1025212574 7:57028688-57028710 GCTGGGGGTGGGCAGGAAGGAGG - Intergenic
1025659379 7:63548139-63548161 GCTGGGGGTGGGCAGGAAGGAGG + Intergenic
1027858003 7:83537482-83537504 GCATCTGGTGGGCAGAAATCAGG + Intronic
1028449816 7:90968959-90968981 GCTGCTCGAGGGCAGGAACCAGG - Intronic
1028737473 7:94233571-94233593 GCTGCTGTGGGGCTGAAAGCTGG + Intergenic
1029710942 7:102299583-102299605 GCTGCTGGAGTGCTGCATGCAGG + Intronic
1032645246 7:133816853-133816875 GCAGGTGGTGAGCAGCCAGCTGG - Intronic
1033201531 7:139376816-139376838 GATGCTGGTGGGGAGCTAGTAGG + Intronic
1037584758 8:20268768-20268790 GCTGCTGGTGGGTTGGGAGCAGG + Intronic
1038312193 8:26453235-26453257 CCTTCAGGTGGGCAGCATGCTGG + Intronic
1040981559 8:53250957-53250979 GCTGCTGTTGGGGGGCAGGCAGG + Exonic
1041201481 8:55454542-55454564 GCTGCTGATGGGCAGGGAGTCGG + Intronic
1041465913 8:58157582-58157604 CCTGCAGGTGGGCAGAAAGATGG - Intronic
1048238071 8:132712198-132712220 GAGGCTGGTGGGCAGGAAACAGG + Intronic
1049007233 8:139863332-139863354 GCTGCAGCTGGGCAGCGGGCAGG - Intronic
1049643280 8:143725084-143725106 GATGCTGGGAGGCAGCGAGCAGG + Exonic
1049681804 8:143922161-143922183 GCGGCTGGTGGCCAGCATGGAGG - Exonic
1051725284 9:20082589-20082611 GCTGCTGACAGGCAGCCAGCTGG - Intergenic
1052245764 9:26332157-26332179 GATCCTGGTGGGCAGTAAGTGGG - Intergenic
1052954233 9:34240963-34240985 GCCTCTTGTGGGCAGCAACCTGG - Intronic
1052954294 9:34241390-34241412 GATGCTGTTGTGCTGCAAGCTGG - Exonic
1055788664 9:79898409-79898431 GTTGCTGTAGGGCAGGAAGCTGG - Intergenic
1056465366 9:86848535-86848557 GGGGCTGGAGGACAGCAAGCTGG - Intergenic
1057753261 9:97809438-97809460 GCTCCTGGAGGGCAGGAAGCTGG - Intergenic
1059935589 9:119307126-119307148 GCATCTCGTGGGTAGCAAGCAGG - Intronic
1060047014 9:120349287-120349309 GCTGGTGGGTGGCAGCGAGCTGG - Intergenic
1060105442 9:120870077-120870099 GCTGCTGGTGCCCACCAAGATGG + Intronic
1061012302 9:127962897-127962919 GGTGGTGGTGGGCAGTAAGGAGG - Intronic
1061193796 9:129096604-129096626 GCTGCTGGAGGGCAGGAAACTGG + Intronic
1061406487 9:130395341-130395363 GCTGCAGGTGGGCGCCAGGCAGG + Intronic
1061728902 9:132598044-132598066 GGTTCCGGTGGTCAGCAAGCAGG + Intronic
1061925939 9:133806109-133806131 GATGGTGGGGGGCAGCACGCTGG - Exonic
1061950910 9:133935390-133935412 GCTCCTTGTGGTCAACAAGCTGG + Intronic
1188892314 X:35625945-35625967 GCGGCTGGTGGGGAGCATGGCGG + Intergenic
1189010501 X:37042375-37042397 CTTGCTTCTGGGCAGCAAGCTGG - Intergenic
1190094481 X:47467576-47467598 GCTGCTGGGGCGAGGCAAGCAGG + Exonic
1190296469 X:49030412-49030434 GCTGCTGATGGGGAGCATTCTGG + Exonic
1192465522 X:71352748-71352770 TCTGCTGGTAGGCACCAAGAGGG + Intergenic
1192552049 X:72062439-72062461 ACAGCTGGTGGGAAGCAAACTGG + Intergenic
1193021289 X:76796721-76796743 GGTGGTGGGGGGCAGCTAGCTGG - Intergenic
1195995739 X:110729989-110730011 GTTTCTGGAGGGCAGAAAGCAGG + Intronic
1199082767 X:143595108-143595130 GCTGCTGTTGGGTAGTATGCTGG - Intergenic
1199816621 X:151403118-151403140 CATGCTGGAGGACAGCAAGCTGG + Intronic