ID: 1149656302

View in Genome Browser
Species Human (GRCh38)
Location 17:58311142-58311164
Sequence CACCTGCAGCAGCTGCAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 0, 2: 19, 3: 87, 4: 684}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149656294_1149656302 23 Left 1149656294 17:58311096-58311118 CCGACTCCCCGTGGGGCGACATG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG 0: 1
1: 0
2: 19
3: 87
4: 684
1149656299_1149656302 -10 Left 1149656299 17:58311129-58311151 CCACCTCACGACACACCTGCAGC 0: 1
1: 0
2: 1
3: 19
4: 203
Right 1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG 0: 1
1: 0
2: 19
3: 87
4: 684
1149656296_1149656302 17 Left 1149656296 17:58311102-58311124 CCCCGTGGGGCGACATGGTGCGC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG 0: 1
1: 0
2: 19
3: 87
4: 684
1149656298_1149656302 15 Left 1149656298 17:58311104-58311126 CCGTGGGGCGACATGGTGCGCAC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG 0: 1
1: 0
2: 19
3: 87
4: 684
1149656293_1149656302 26 Left 1149656293 17:58311093-58311115 CCGCCGACTCCCCGTGGGGCGAC 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG 0: 1
1: 0
2: 19
3: 87
4: 684
1149656297_1149656302 16 Left 1149656297 17:58311103-58311125 CCCGTGGGGCGACATGGTGCGCA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG 0: 1
1: 0
2: 19
3: 87
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149656302 Original CRISPR CACCTGCAGCAGCTGCAGCT GGG Exonic
900435609 1:2629255-2629277 ACCCTGCAGCAGGTGCAGCGGGG + Intronic
900637505 1:3673098-3673120 CACCGGCTGCCGCTGCAACTGGG + Intronic
901050053 1:6421462-6421484 CGCCTGCAGCATCTGCATCTTGG + Intronic
901325226 1:8361299-8361321 GGCCTGCAGCATCTGCTGCTGGG + Exonic
901766157 1:11501455-11501477 CAGCTGCAGCAGCTGCATCTCGG + Exonic
901787787 1:11636116-11636138 CACCTGCAGCAGCTGCCTTAGGG - Intergenic
901790376 1:11650683-11650705 CACGCGCAGCAGCAGCGGCTCGG + Exonic
902150763 1:14441380-14441402 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
902511086 1:16967470-16967492 CTCCTGCAGCCCCTGCGGCTGGG - Intronic
902618114 1:17634906-17634928 CACCTCCACCACCTGCACCTGGG - Exonic
903296484 1:22346589-22346611 CAGCTGCAGCAGCAGAAGCTGGG - Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903579013 1:24357293-24357315 CACCTGGAGCACCTACAGCATGG - Exonic
903976765 1:27155058-27155080 GACCAGGAGGAGCTGCAGCTGGG - Intronic
904028862 1:27521553-27521575 CATCAGCAGCAGCAGCAGCAGGG - Intergenic
904093089 1:27958783-27958805 CATCAGCAGCAGCGGGAGCTGGG - Exonic
904109277 1:28112747-28112769 GACCTGCAGCAACAGCATCTGGG - Intergenic
904286526 1:29456237-29456259 CACCTGCAGCAGCTCCAGCCAGG - Intergenic
904826428 1:33276502-33276524 CCCCGGCACCTGCTGCAGCTTGG - Exonic
905206780 1:36347112-36347134 CTCCAGCAGAAGCGGCAGCTGGG + Intronic
905792698 1:40798807-40798829 CACGGGCAGCAGCTGCAGCCAGG - Intronic
906003730 1:42449913-42449935 CAGCTGCAGCAGCGGCAGGTAGG - Exonic
906544540 1:46611994-46612016 CACCAGCCGCACCTGTAGCTGGG - Intronic
906814501 1:48865156-48865178 CACCAGGAGCTGCAGCAGCTAGG - Intronic
906928853 1:50148687-50148709 TACCTGCAGCCTCTGCTGCTGGG + Intronic
907153066 1:52306776-52306798 CACCTGGTCCAGCTGCAGCCTGG + Intronic
907306150 1:53514169-53514191 CACCTCCAGCCACTGCAGCTGGG - Intronic
907486499 1:54781636-54781658 GCCGCGCAGCAGCTGCAGCTCGG + Exonic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
908537477 1:65091635-65091657 CACCTGCAGCACCTGCTACAGGG - Intergenic
908574945 1:65449565-65449587 CAGCTGCAGCAGCTCCACCAGGG - Intronic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908959625 1:69680116-69680138 CAGCAGCAGCAGCAGCATCTGGG + Intronic
910367946 1:86486695-86486717 TACCTGCAGCAGCTTCAGGAGGG + Exonic
910408524 1:86915065-86915087 CACCGCCAGCAGCTGCAACTTGG - Exonic
910547209 1:88432246-88432268 CACCCCCAGCAGTGGCAGCTTGG + Intergenic
910758167 1:90712405-90712427 CACCAGGGGCCGCTGCAGCTGGG + Exonic
911973176 1:104462416-104462438 AACCTGCAGCACCTGAAGCCTGG - Intergenic
912032798 1:105270776-105270798 CAAATGCAGAAGCTGCAGCAAGG + Intergenic
915348947 1:155212822-155212844 CAGATGGAGCAGCTGGAGCTGGG + Intronic
915352134 1:155233448-155233470 CAGATGGAGCAGCTGGAGCTGGG + Intergenic
915355997 1:155255435-155255457 GACCTGCGGCAGCCGGAGCTCGG - Intronic
915670155 1:157482328-157482350 CACCTTCTGCATCTTCAGCTTGG - Intergenic
916741187 1:167648651-167648673 CCGCTGGAGCAGCTGCAGATAGG + Intronic
916966273 1:169945506-169945528 CATCTGGAGCAGCTGCTGCAGGG - Intronic
918097168 1:181345109-181345131 CCCCTGCCTCAGCTGCAGCCTGG + Intergenic
918181296 1:182087619-182087641 CACCCTCAGGGGCTGCAGCTGGG - Intergenic
919012921 1:191988429-191988451 CAACCTCAGCAGCTGCAACTCGG + Intergenic
920076705 1:203342424-203342446 CAGGCGCAGCACCTGCAGCTTGG + Exonic
920104098 1:203538354-203538376 CGCCTTCAGCAGAGGCAGCTTGG - Intergenic
920869620 1:209783306-209783328 CACTTGGAGCAGGTGCTGCTTGG - Exonic
921706155 1:218324223-218324245 CCCCTGCAGCTGCTGCTGCAGGG - Intronic
921759710 1:218899000-218899022 CACCTACAGCAGGACCAGCTGGG - Intergenic
921924895 1:220703343-220703365 CCCCTGCAGCTCCTGCCGCTGGG - Intergenic
922163286 1:223094186-223094208 CACCTGCAGCAGCTGGGCCCAGG + Intergenic
922165530 1:223112799-223112821 CAGCTGCAGCTGCTGGAGCTCGG - Exonic
922562891 1:226581915-226581937 AAACTGCAGCAGCTGCAGAGAGG - Intronic
922707771 1:227798602-227798624 CATCTGCTGCAGGTCCAGCTGGG + Intergenic
922969621 1:229725120-229725142 CAGCCGCAGCAGCAGCATCTGGG - Intergenic
923790355 1:237106271-237106293 CCCCTGCACCAGCTCCCGCTGGG + Intronic
924404746 1:243730847-243730869 CGCCTGCTCCAGCTGCAGCCTGG + Intronic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
1062925923 10:1315234-1315256 CACCTGCAGCACCTGGTGCCTGG - Intronic
1063216113 10:3927084-3927106 CACCTGGCAAAGCTGCAGCTGGG + Intergenic
1064983198 10:21184597-21184619 CCCCTGCTGCTGCTGCTGCTAGG + Intergenic
1065881608 10:30042268-30042290 CACCCGCAGCACCTGCAGTGGGG + Intronic
1066188758 10:33036719-33036741 CAACTGCAGCAGCAGCCGCAGGG + Intergenic
1066996290 10:42567104-42567126 CACCTTCAGCTGCTGCAGGAAGG - Intergenic
1067499415 10:46788497-46788519 CATCTGCAGGATCTCCAGCTAGG + Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067595213 10:47551825-47551847 CATCTGCAGGATCTCCAGCTAGG - Intergenic
1067642319 10:48059908-48059930 CATCTGCAGGATCTCCAGCTAGG - Intergenic
1068676652 10:59776553-59776575 AACCTGCATCATCTGCTGCTTGG + Intergenic
1069653232 10:70066827-70066849 CACCTGGAGCAGTCTCAGCTGGG - Intronic
1069681514 10:70288839-70288861 CACCTCCAATAGCTACAGCTGGG + Intergenic
1069772975 10:70911122-70911144 CGCCTGCAGGTGCGGCAGCTGGG - Intergenic
1069951182 10:72019316-72019338 AACCTGCAGCACCTGGATCTTGG + Intergenic
1070139523 10:73728460-73728482 CATCTGCAGGATCTCCAGCTAGG - Intergenic
1070657831 10:78283366-78283388 GACCTGGAGCTGCTGCAGGTGGG + Intergenic
1070742898 10:78914067-78914089 CACCAGCAGCGGCAGCAGCCGGG - Intergenic
1070831387 10:79420082-79420104 CACCCCCAGCAGCTGCTCCTAGG + Intronic
1070886752 10:79906677-79906699 CATCTGCAGGATCTCCAGCTAGG + Intergenic
1071298128 10:84237395-84237417 CAGGTCCAGCAGCCGCAGCTTGG + Exonic
1071606160 10:86992366-86992388 CATCTGCAGGATCTCCAGCTAGG + Intergenic
1071784120 10:88880261-88880283 TTCCTGCAGCAGCGGCAGCAGGG + Exonic
1071919416 10:90332418-90332440 CAGCTGCAGAGGCTGCAGCAGGG + Intergenic
1072242442 10:93509418-93509440 GGCCAGCAGCAGCAGCAGCTAGG - Intronic
1072255211 10:93614450-93614472 CACTTGAAGCAGCTGCAGTCAGG - Intronic
1072468221 10:95687275-95687297 AACCTGCAGGAGTTGGAGCTGGG - Exonic
1073134967 10:101215417-101215439 CACCCACAGCAGCTGCTCCTGGG + Intergenic
1073942269 10:108712558-108712580 CCCCTGCAGCAGCTTCTGCCTGG + Intergenic
1074182510 10:111077029-111077051 GAGCAGCAGCAGCTCCAGCTCGG + Intergenic
1074248131 10:111714525-111714547 CACCTGCTGCAGCTGTAGGGAGG - Intergenic
1074429479 10:113381575-113381597 GAGCTGCATCAGCTGCAGGTGGG + Intergenic
1075256120 10:120927015-120927037 GTCCTGCAGCAGCTACAGCAGGG + Intergenic
1075745622 10:124725322-124725344 CACCTCCAGCAGCCCCGGCTGGG + Intronic
1075861324 10:125679226-125679248 CAGCTGCAGCTGCTGGTGCTGGG - Intronic
1076062987 10:127427958-127427980 CACCTGCAGCAGCTCCCGCTGGG - Intronic
1076346751 10:129784689-129784711 AAACTGCATCAGCTGGAGCTGGG + Intergenic
1076470797 10:130716693-130716715 CTCCTGTAGCAGCTGCTGCTGGG + Intergenic
1076741561 10:132488265-132488287 CCCCTGGAGCAGCAGGAGCTGGG + Intergenic
1076769640 10:132656001-132656023 CACCTGCAGCAGCTTCTTCAAGG + Intronic
1076814936 10:132909944-132909966 CAGCTGCTGCAGCAGCAGATTGG - Exonic
1077069617 11:662569-662591 CACCTGCAGCAACAGCAACGCGG - Intronic
1077079790 11:720162-720184 CACCTGCAGCAGCATCTCCTGGG - Exonic
1077103310 11:831635-831657 CAACAGCAGCAGCAGCAGGTGGG - Exonic
1077109087 11:854249-854271 CACCCGCAGCACCAGGAGCTTGG + Intronic
1077211369 11:1372294-1372316 CACCTGCAGCTGCTGTACCAGGG + Intergenic
1077249052 11:1552612-1552634 CACCTGCAGCTCCAGCAGGTGGG - Intergenic
1077757285 11:5046473-5046495 CACATGTAGAAGCAGCAGCTGGG - Intergenic
1077976914 11:7256292-7256314 CAGCAGCAGCAGCAGCTGCTGGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078544571 11:12237748-12237770 CAGGAGCAGCAGCAGCAGCTGGG + Intronic
1078739115 11:14050110-14050132 ATCTTGTAGCAGCTGCAGCTGGG - Intronic
1080117562 11:28637835-28637857 TGCCAGCAGCAGGTGCAGCTGGG - Intergenic
1080441196 11:32296194-32296216 CAGCTGCACCAGCTCCTGCTAGG - Intergenic
1080873110 11:36254028-36254050 GACCAGCAGCAGCAGCACCTGGG - Intergenic
1080937683 11:36881303-36881325 CAACTGCAGCTGCCACAGCTCGG - Intergenic
1081493364 11:43583398-43583420 CTGCTGCTGCAGCTGCTGCTTGG + Intronic
1082784922 11:57311498-57311520 CCTCCGGAGCAGCTGCAGCTTGG + Intronic
1082996943 11:59262393-59262415 CTCCAGCAGCAGCTGCACCCTGG - Intergenic
1083233521 11:61338014-61338036 GCCCTGCAGGAGCTGCAGGTTGG - Exonic
1083470552 11:62881214-62881236 CACCTTCAGCAGCTCCTCCTTGG - Exonic
1083789519 11:64975524-64975546 TACCAGCAGCAGCAGCACCTGGG - Intergenic
1083851310 11:65369040-65369062 CAGCAGCAGCAGCAGCATCTGGG + Intergenic
1084272843 11:68038400-68038422 CACCTGCAGCTGCAGCCGCGGGG - Intergenic
1084274019 11:68042805-68042827 GAGCTGCAGCTGGTGCAGCTGGG - Exonic
1084540516 11:69783386-69783408 CACCTGCAGCCCCAGCTGCTTGG - Intergenic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084954853 11:72685737-72685759 CAGCTGCAGCAGCTTCAGCGGGG - Intronic
1085264904 11:75231474-75231496 GAACTGCGGCAGCTGAAGCTAGG + Intergenic
1085457428 11:76672869-76672891 CACCTGCTGCAGATGCCTCTGGG + Intergenic
1086236213 11:84634071-84634093 CACTTGAGGCATCTGCAGCTTGG + Intronic
1087133852 11:94694660-94694682 CAGCTGGAGCAGCAGCAGCACGG + Intergenic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089007571 11:115105366-115105388 CAGCTGCAGCACCTGCCCCTAGG + Intergenic
1089214996 11:116829921-116829943 TACCTGGAGCAGCTGCCTCTAGG - Exonic
1089336267 11:117725920-117725942 CCCCTGCAGCCTCTCCAGCTGGG + Intronic
1089505363 11:118958614-118958636 GACCAGGAGCACCTGCAGCTTGG - Intergenic
1089530706 11:119127059-119127081 CACCTGCAGCAGCACCTGCATGG + Exonic
1089864813 11:121622555-121622577 TTCCCGCAGAAGCTGCAGCTGGG + Intronic
1090051843 11:123386808-123386830 CATCGGCAGTAGCCGCAGCTAGG + Intergenic
1090136492 11:124204472-124204494 CACCCCCAGCAGCTGCAGCCTGG - Intergenic
1090996439 11:131870055-131870077 CACCTTCAGGAGGTGAAGCTGGG + Intronic
1091035820 11:132232410-132232432 CAGCTGCAGCAGCGACAGGTGGG - Intronic
1091588894 12:1831432-1831454 AACCTGCAGCTGCTGCAGGTCGG + Exonic
1091688178 12:2578501-2578523 CACCCGCTGCTGCTGCAGCTTGG + Intronic
1091890371 12:4049095-4049117 CACCTGCAACAGTTTCACCTTGG + Intergenic
1092197085 12:6555977-6555999 CTCCTGCAGCAGGAGCAGCAGGG - Exonic
1093141868 12:15518277-15518299 CACCCACAGCTGCAGCAGCTGGG + Intronic
1095800924 12:46269282-46269304 CTCCAGCTGCAGCCGCAGCTGGG - Intronic
1096119668 12:49079949-49079971 CCCCAGCAGCTGCAGCAGCTGGG - Intergenic
1096154908 12:49336457-49336479 CACCAGCAGCAGCAGCACCATGG + Exonic
1096180698 12:49548986-49549008 CAACTGCAGCAGCAGCAGCGAGG + Exonic
1096898382 12:54848130-54848152 AACCTGCAGCAGCTGTGGCCTGG - Intronic
1097269265 12:57764398-57764420 CGCCTTCAGCAGGGGCAGCTGGG + Exonic
1097270289 12:57769843-57769865 CACCTGCAGGAGCTGCGCGTAGG + Exonic
1097707478 12:62882874-62882896 CACGTGCAGCTGCTTCTGCTTGG + Intronic
1097708715 12:62895455-62895477 CAACAGCAGCAGCAGCACCTGGG + Intronic
1098109049 12:67102370-67102392 CAGCTGCAGCTGGTGCAGCTCGG + Intergenic
1098286364 12:68911353-68911375 CTCCAGCCGCAGCTGCAGTTTGG - Intronic
1099412588 12:82349460-82349482 TTCCTTCAGCAGCTGCAGCCTGG + Intronic
1101061438 12:100976639-100976661 CAGCAGCATTAGCTGCAGCTGGG - Intronic
1102644293 12:114393853-114393875 AACCTGCACCACCAGCAGCTTGG - Intronic
1102965031 12:117119133-117119155 AGCCAGCAGCAGCAGCAGCTTGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103336527 12:120194435-120194457 CGACTTCAGCAGCTGGAGCTCGG - Intronic
1103559000 12:121782517-121782539 CACCTGCAACAGCTGCGGACAGG - Intronic
1104595341 12:130116750-130116772 CGCCTGCAGCCCCTGCAGGTGGG - Intergenic
1104886003 12:132108663-132108685 TACCTGGAGCGGCTGCTGCTGGG - Exonic
1104958496 12:132477209-132477231 AAACCGCAGCAGCTGCAGCAGGG - Intergenic
1106449996 13:29872346-29872368 CACCTGCAGTGGCTGCTGCAGGG - Intergenic
1106478359 13:30117158-30117180 CAACAGCAGCAGCAGCACCTGGG + Intergenic
1106547969 13:30746636-30746658 CCCCTGGAGAAGCTGCTGCTGGG - Intronic
1106701877 13:32237861-32237883 CAGCAGCAGCTGCTGCAGCCCGG - Exonic
1106862166 13:33921573-33921595 AAACTGCAGCATCAGCAGCTTGG + Intronic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107105352 13:36636931-36636953 CCCCTGCAGCAGCTTCTGCCTGG + Intergenic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107286846 13:38802704-38802726 AGCCTTCAGCAGCTACAGCTTGG - Intronic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108473647 13:50791392-50791414 GGCCTTCAGCAGCTGCAGGTGGG + Intronic
1108621777 13:52191954-52191976 CACCTGCATCAGAAGCACCTGGG - Intergenic
1108664966 13:52620227-52620249 CACCTGCATCAGAAGCACCTGGG + Intergenic
1108884686 13:55165402-55165424 CACCAGCAGCAGCTGCATGGTGG - Intergenic
1109184311 13:59250842-59250864 CTCCTGCAGCAGCTGAACATTGG - Intergenic
1110730933 13:78877507-78877529 CATCTGGAGCAGCTGCTGCAAGG - Intergenic
1111681261 13:91444841-91444863 CTCCTACAGCAGCTGAAACTGGG - Intronic
1112383649 13:98917866-98917888 CACCTGCAGCTGGTGCCGCCAGG - Intronic
1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG + Intergenic
1113777536 13:112956667-112956689 CAGCTGCTGCTGCTGCAGCGAGG + Intronic
1114066349 14:19062376-19062398 CCCCTGCAGCAGCAGCGGCGTGG + Intergenic
1114095919 14:19337648-19337670 CCCCTGCAGCAGCAGCGGCGTGG - Intergenic
1114407053 14:22466780-22466802 CAACAGCAGCACCTGCAGCGTGG + Intergenic
1114408958 14:22482850-22482872 CACCTACAGCAGCTGCATTCTGG + Intergenic
1114454416 14:22845924-22845946 CACCAGGAGCAGCAGCAGCACGG - Exonic
1116183878 14:41570966-41570988 CACCTGCAGGAGCTGCCACAAGG - Intergenic
1116894777 14:50305244-50305266 CTCCTGCAGCAGCTTTAGATTGG + Intronic
1117050363 14:51854307-51854329 CACCAGCAGAAGTTGGAGCTGGG - Intronic
1117081397 14:52155854-52155876 CATCTGGAGCAACTCCAGCTAGG - Intergenic
1118755738 14:68842554-68842576 CACCAGCAGCAGCTGCTCCTGGG - Intergenic
1118933949 14:70269028-70269050 AACCTGCAGCAGCTGGAGAATGG + Intergenic
1119069892 14:71572006-71572028 CACCAGCAGCAGCTGGACCTTGG - Intronic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119614398 14:76089382-76089404 CAGCTGCAGCAGCTGTTCCTGGG - Intergenic
1120017915 14:79495385-79495407 GAGATGCAGCAGCTGCAGTTGGG + Intronic
1120238226 14:81917509-81917531 CACCTCCAGCTGCTGCAGGAAGG - Intergenic
1120588434 14:86345839-86345861 ACCATGCAGCAGCAGCAGCTTGG + Intergenic
1120592414 14:86391291-86391313 CAGGTACACCAGCTGCAGCTAGG - Intergenic
1121070340 14:91013742-91013764 GACCAGCAGCAGCAGCAGCGTGG + Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121570196 14:94941463-94941485 CACCAGCAACTGCCGCAGCTGGG - Intergenic
1121825690 14:97008036-97008058 CACTGGCAGCAGGGGCAGCTGGG + Intergenic
1122235690 14:100329670-100329692 GACCTCCAGCAGCTGCTGGTGGG - Exonic
1122418453 14:101561233-101561255 CTCCGGCAGCCGCTGCCGCTGGG - Intergenic
1122618857 14:103041676-103041698 CACCGGCCGCAGCTGCAGCTTGG + Intronic
1122737807 14:103853811-103853833 GCCCTGCAGCACCTGGAGCTTGG - Intergenic
1122786478 14:104166512-104166534 CCCCGGCAGCGGCTGCAGGTGGG + Intronic
1122796026 14:104206663-104206685 CACCTCCAGCAGCTCCTGATGGG + Intergenic
1122937552 14:104967058-104967080 CCCTGGCAGCAGGTGCAGCTGGG + Intronic
1123019871 14:105392633-105392655 CACCTGCAGCCCCATCAGCTCGG - Exonic
1123176275 14:106421987-106422009 CGACTCCTGCAGCTGCAGCTGGG + Intergenic
1123469006 15:20536339-20536361 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123649052 15:22464352-22464374 CACCTGTGGCAGCAGGAGCTTGG - Exonic
1123729282 15:23131327-23131349 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123747450 15:23328809-23328831 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1124003906 15:25781040-25781062 CACCTGCCGCCGCTTCAGGTTGG + Exonic
1124279811 15:28352661-28352683 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1124302887 15:28558943-28558965 CACCTGTGGCAGCAGGAGCTTGG - Intergenic
1125728870 15:41881975-41881997 CTCCTCCAGCCGCCGCAGCTCGG + Exonic
1125729212 15:41883343-41883365 CAGCTGGAGGAGCTGCAGGTGGG - Exonic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126183650 15:45810268-45810290 CACCTCCAGCGGCCGCAGCATGG + Intergenic
1126915326 15:53460012-53460034 CATGTGCATCAGCAGCAGCTAGG + Intergenic
1127428580 15:58880435-58880457 CAGCAGCAGCAGCACCAGCTGGG + Intronic
1127676639 15:61245669-61245691 CACCATCAGCAGCAGCACCTGGG - Intergenic
1127796776 15:62445160-62445182 CACCTGCAGGTGCTGCAGCCTGG - Intronic
1128280022 15:66386969-66386991 CCCCGGCAGGAGCTGGAGCTGGG + Exonic
1128800863 15:70496080-70496102 CACCTGTAGAAGCTGCAGCTGGG - Intergenic
1130064666 15:80593861-80593883 CCCCTGCAGCCGCGGCTGCTCGG + Exonic
1130320236 15:82835497-82835519 CCCTTTCAGCAGCTGCAGCCTGG + Exonic
1130562471 15:84969421-84969443 CTTCTGGATCAGCTGCAGCTGGG + Intergenic
1130928435 15:88402421-88402443 CAGCAGCAGCAGCTCCACCTGGG - Intergenic
1131348697 15:91676651-91676673 GAGCTGCTGCAGCTGCTGCTAGG - Intergenic
1131537858 15:93252530-93252552 GACCTCCAGCAGCTCCAGGTTGG - Intergenic
1132368502 15:101276538-101276560 AACCCACAGCAGCCGCAGCTCGG + Exonic
1132809657 16:1791453-1791475 TTCCTGGAGGAGCTGCAGCTGGG - Exonic
1132858984 16:2060796-2060818 CTCCTTCAGCAGCTCCAGGTGGG + Exonic
1133703985 16:8335917-8335939 TACCAGCAACAGCTACAGCTTGG - Intergenic
1134018892 16:10907866-10907888 TACCTGAAGCGGCTGCAGCCGGG + Exonic
1134439011 16:14286327-14286349 GACCTGCAGCTGCTGGAGTTTGG + Intergenic
1136013127 16:27377562-27377584 CATCTGAAGTAGGTGCAGCTTGG - Intergenic
1136024753 16:27462291-27462313 CACCTGGAGCAACTCCAGCACGG + Exonic
1136160211 16:28415024-28415046 CACAGGTGGCAGCTGCAGCTGGG - Intergenic
1136202877 16:28700266-28700288 CACAGGTGGCAGCTGCAGCTGGG + Intronic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136589287 16:31207723-31207745 CTCCTGCAGCAGTTTCAGGTCGG + Intergenic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137775014 16:51047213-51047235 CAGAAGCAGCAGCAGCAGCTGGG + Intergenic
1138166654 16:54808118-54808140 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
1138190669 16:55011061-55011083 CAGCTGGAGCAGCTGCAGGATGG + Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139370002 16:66461157-66461179 CCCCTGTACCAGCTGCAGCAAGG - Intronic
1139476219 16:67203762-67203784 CAGCTCCAGCAGACGCAGCTTGG - Exonic
1139550052 16:67667934-67667956 CTCCTCCTGCAGCGGCAGCTTGG - Exonic
1139552560 16:67683198-67683220 CACCAGCAGCAGCATCACCTGGG - Intronic
1139582758 16:67883130-67883152 ATCCTGCAGCTGCTGCAGCAGGG + Exonic
1139630211 16:68226760-68226782 CACCTGCAAAAGCAGCACCTCGG - Exonic
1140162421 16:72511785-72511807 CTCCTGCCTCAGCTGTAGCTTGG - Intergenic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140851162 16:78935932-78935954 AAGCAGCAGCAGCAGCAGCTAGG + Intronic
1141062999 16:80892244-80892266 CAGCAGCAGCAGCCGCACCTGGG + Intergenic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141699417 16:85635619-85635641 CAACTGCAGCAGCAGGAGCTGGG - Intronic
1141702075 16:85647136-85647158 CCCCTGCCGCACCTGCAGATGGG + Intronic
1141950250 16:87335161-87335183 CACCTGCAGCCCCGGGAGCTTGG - Intronic
1142005295 16:87686921-87686943 CACCTCCTGCTGCTGCACCTTGG + Intronic
1142193362 16:88728035-88728057 AACCTGCAGCAACCACAGCTGGG + Intronic
1142287841 16:89178660-89178682 GACCAGCAGCAGCTGCAGGCCGG + Intronic
1142318839 16:89367675-89367697 AACCTGCAGCTGTTGCTGCTTGG - Intronic
1142706690 17:1699708-1699730 CCCCTGCCTCAGCTGCAGCTGGG + Intergenic
1142742153 17:1937499-1937521 CACCTGGAGGAGCTGGACCTCGG - Exonic
1142938766 17:3362948-3362970 CAGCTGGAGCTGCAGCAGCTGGG + Intergenic
1142940824 17:3378657-3378679 CATCTGGAGCAGCTGCTGCGGGG - Intergenic
1143027950 17:3951974-3951996 GACCAGCAGCAGCAGCAGCTGGG + Intronic
1143147538 17:4786311-4786333 CAGCAGCAGCGGCAGCAGCTTGG + Exonic
1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG + Exonic
1143464785 17:7129473-7129495 CACCTGCAGCAGCGCCACCCCGG + Intergenic
1143862964 17:9904717-9904739 CCTCTGCAGCAGCTGCAGCAGGG + Intronic
1143994599 17:10995825-10995847 CACCCACAGCAGCCACAGCTGGG + Intergenic
1144297170 17:13887145-13887167 CACCTGCATCAGCTCCCTCTGGG + Intergenic
1144720548 17:17466618-17466640 GATCTCCAGCAGCAGCAGCTAGG + Intergenic
1144733404 17:17541472-17541494 CACCGGCCGCAGCAGCAGCGGGG + Intronic
1145219344 17:21075544-21075566 TAACAGAAGCAGCTGCAGCTGGG + Intergenic
1146948243 17:36888689-36888711 CCCCTGGGGCAGCTGAAGCTGGG - Intergenic
1147212312 17:38878887-38878909 GACCTGCAGCAGCTGACGGTAGG + Intronic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147513867 17:41097684-41097706 CAGCTGGAGATGCTGCAGCTGGG + Exonic
1147514831 17:41105842-41105864 CAGCTGGAGATGCTGCAGCTGGG - Exonic
1147515962 17:41117885-41117907 CAGCTGGAGATGCTGCAGCTGGG + Exonic
1147517969 17:41140147-41140169 CAGCTGGAGATGCTGCAGCTGGG + Exonic
1147539184 17:41342777-41342799 CACCTGCAGCAGGCTCAGCGAGG + Intergenic
1147582922 17:41637006-41637028 CCCCGGCAGCGGCAGCAGCTTGG + Intergenic
1147947523 17:44088391-44088413 AAGCAGCAGCAGCTACAGCTGGG - Exonic
1148262457 17:46194868-46194890 CCCCTGCAACATCTGCACCTAGG + Intronic
1148400609 17:47356896-47356918 CCCCGACAGCAGCTGCAGCAAGG - Intronic
1148622351 17:49043974-49043996 CACCTGCACCATCTCCTGCTCGG - Exonic
1149640599 17:58200058-58200080 GACATGAAGCAGCTGGAGCTGGG - Intronic
1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG + Exonic
1149689727 17:58565142-58565164 CATTTGCAGCAGCTGCTTCTGGG + Intronic
1151088405 17:71407480-71407502 CACCTGCACCAGCCCCAGTTTGG - Intergenic
1151227040 17:72655351-72655373 CACCTGCATCAGCTCCAGAGTGG + Intronic
1151557200 17:74852555-74852577 CACCTGCAGCTGCTGCTCCAGGG + Exonic
1151624253 17:75266815-75266837 GATCTCCAGCAGCAGCAGCTGGG + Exonic
1151747340 17:76018583-76018605 ACCCTGCAGCAGCTGCACCTGGG + Exonic
1151979344 17:77499397-77499419 CATCAGCAGCACCTGCAGCCCGG - Exonic
1152068639 17:78124614-78124636 CACCAGCAGCAGCAGCAGGAGGG + Exonic
1152361989 17:79837093-79837115 ACGCTGCAGCTGCTGCAGCTGGG - Intronic
1152469302 17:80482081-80482103 AGCCTGCAGCAGCTGCAGCCAGG + Intergenic
1152559089 17:81068921-81068943 AGCCTGGAGCAGCTGGAGCTCGG - Intronic
1152735728 17:81995972-81995994 CACCTGCAGGAGGAGCAGCCAGG - Exonic
1153075509 18:1157482-1157504 CACCCCCAGCAGTGGCAGCTTGG + Intergenic
1153273733 18:3348379-3348401 CAACTCCAGCAGCCCCAGCTGGG - Intergenic
1154219517 18:12440100-12440122 CAGGTGCAGCAGCTGCAGTGAGG - Intergenic
1154979346 18:21489715-21489737 CACCAGCAGCAGCAGCACCTGGG - Intronic
1156076341 18:33283097-33283119 CTGCTGCAGCTGCTGCACCTCGG + Intronic
1156254215 18:35379489-35379511 GACCTTCACCAGCTGCAGCCTGG - Intergenic
1157870595 18:51226930-51226952 GACCTGCATCAGCTGCCTCTTGG - Intergenic
1157921948 18:51722178-51722200 CAGCTGACTCAGCTGCAGCTGGG - Intergenic
1160099467 18:75906511-75906533 GACGTGGAGCAGCTGCTGCTGGG - Intergenic
1160778828 19:868899-868921 CACCTGCGGAGGCTGCACCTTGG - Exonic
1160985715 19:1837646-1837668 TGCCTGCAGCAGCGGCACCTGGG + Intronic
1161032020 19:2061914-2061936 CACCTGCGGAAACTGAAGCTCGG - Intergenic
1161185967 19:2921031-2921053 GACCTGCTGCAGCAGGAGCTAGG - Intergenic
1161471998 19:4462465-4462487 CACCTGCAGCTTCAGCTGCTTGG + Intergenic
1161931837 19:7345764-7345786 GCCCTGCAGGAGCTCCAGCTGGG - Intergenic
1162078700 19:8206046-8206068 CAACTGCAGAAGGTGCAGCCTGG + Intronic
1162328043 19:10010308-10010330 CCCCGGCAGAAGCTGCAGCGCGG + Exonic
1162336171 19:10061880-10061902 CTCATGCAGAAGCTGGAGCTGGG + Intergenic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162589137 19:11579111-11579133 CACGGACTGCAGCTGCAGCTGGG + Intronic
1162722904 19:12673015-12673037 CACCTGCACCTGCTTCAGCCGGG + Exonic
1162740533 19:12771170-12771192 CTCCTGCAACTGCTCCAGCTGGG + Exonic
1163162327 19:15472019-15472041 AAGCTGCTGCAGCTGCCGCTGGG - Exonic
1165078500 19:33294151-33294173 CACCTGCGGCTCCTGCAGCTTGG + Intergenic
1165833020 19:38738465-38738487 CAGCCGCAGCAGCCGCACCTTGG + Exonic
1165903943 19:39181987-39182009 CACCAGCATCTGATGCAGCTGGG - Intronic
1165973964 19:39658116-39658138 GACCTGCAGCAACTGCATGTGGG + Intronic
1166072688 19:40396102-40396124 CACTTTCGGCAGCTGCACCTCGG + Exonic
1166218853 19:41353012-41353034 CAGCGGCAGCAGCCGCAGCCCGG + Exonic
1167093767 19:47362509-47362531 CTCCTGCAGCCGTTGCAGCTTGG - Exonic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167638282 19:50667484-50667506 CACGTGCAGCGGCAGCCGCTCGG + Exonic
1167842486 19:52133442-52133464 CACGTGCAGGAGGTGCAGCCTGG + Intronic
1168393952 19:56032678-56032700 CACCTGCGGCAGCTGGACCTGGG + Exonic
1168524677 19:57079274-57079296 CACCTGCGGCAGCTGCTCCATGG - Intergenic
1168665719 19:58203466-58203488 CTCCTGCCTCAGCCGCAGCTGGG - Intronic
925354389 2:3227770-3227792 CAGCTGGAGCAGCAGCAGCTGGG - Intronic
925377764 2:3400464-3400486 CACCTGAGGCAGGGGCAGCTGGG - Intronic
925986729 2:9222445-9222467 CACCAGCAGAAACAGCAGCTTGG - Intronic
926130209 2:10298249-10298271 TTCCTGCTGCAGCTGCTGCTGGG + Intergenic
926134287 2:10325769-10325791 CACCTGCAGCAGGTGCTCCCGGG - Intronic
926143474 2:10382777-10382799 CACACTCAGCAGCTGCAGCCGGG - Intronic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
928683677 2:33727473-33727495 CACCTTCAGCAGCCCCAGCTCGG + Intergenic
929454789 2:42058059-42058081 CATGTGCAGCAGCAGCAGCAGGG - Exonic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604364 2:43225376-43225398 CACCTGCAGCAGCAGCAGAAGGG - Exonic
930028883 2:47046326-47046348 CACCTGCTCCAGCTTCACCTTGG - Exonic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
931252847 2:60549593-60549615 CACGTGCAGCAGCGGCCGCGGGG + Intronic
931282309 2:60804876-60804898 CACCTGGAGCGGCTGCAGCAGGG - Intergenic
931495451 2:62801974-62801996 CAACTGCATCAGCAGCACCTGGG - Intronic
931684969 2:64785027-64785049 CACCAGGAGCAGCTGCACCAAGG + Intergenic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932621422 2:73266604-73266626 GAACTGCTGCAGCCGCAGCTTGG + Exonic
935855129 2:107265307-107265329 CACCTGCAGTCCCTGCAACTCGG + Intergenic
936349995 2:111705317-111705339 AGCCTTCAGCACCTGCAGCTGGG + Intergenic
936400277 2:112159715-112159737 CAGCTGCAGCAGCTGCTGAAGGG + Exonic
936558210 2:113514267-113514289 GAGCTGAAGCAGCTGCAGCAGGG + Intergenic
936712065 2:115142886-115142908 CACCACCAGCAGCAGCAGCAAGG - Intronic
936781624 2:116039827-116039849 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
937083876 2:119158225-119158247 CGCCTGCAGCAGCAGCGGCACGG + Exonic
937303023 2:120854860-120854882 CAGCAGCAGCAGCAGCATCTGGG - Intronic
937438605 2:121898578-121898600 CACCCCCATCAGCTGCAGATGGG + Intergenic
938209841 2:129458379-129458401 TAACTGCAGCAGCTGCAAATGGG + Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938483743 2:131682512-131682534 CCCCTGCAGCAGCAGCAGCGTGG + Intergenic
938801011 2:134763354-134763376 GCCCAGCAGCAGCTGCGGCTCGG - Intergenic
942552210 2:177131135-177131157 AACCGTCAGCAGCTGCAGCTTGG - Intergenic
943186668 2:184615822-184615844 CACTGGAAGCAGCTGCAGCAGGG + Intronic
943425802 2:187732132-187732154 GATCTGCAGCAGCAGCAGCAGGG + Intergenic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
945022995 2:205592882-205592904 CACCTGCAGCAGATGCCCCATGG + Intronic
945298301 2:208192628-208192650 CAGCTGCAGCAGCCTCAGCTGGG - Intergenic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947701759 2:232240242-232240264 CTCCTGGAGCAGGTGGAGCTAGG - Intronic
947912502 2:233810714-233810736 CAGGAGCAGAAGCTGCAGCTTGG + Intronic
947912911 2:233813262-233813284 CAGCAGCAGCAGCTTCACCTTGG - Intronic
948289759 2:236816393-236816415 CACCAGCCGCAGCTCCTGCTGGG - Intergenic
948454421 2:238098164-238098186 CCTCAGCAGCAGCTGCAGCTCGG + Intronic
948841391 2:240651333-240651355 CACCTGCAGCACGGCCAGCTGGG - Intergenic
948925219 2:241091895-241091917 CACCTTCAGGAACTGCAGCTTGG - Exonic
948987129 2:241532632-241532654 CTCCTGCAGAAGCTGCAGCTTGG + Intergenic
1169110637 20:3031026-3031048 TTCCCTCAGCAGCTGCAGCTTGG + Intronic
1169198178 20:3694417-3694439 CCCGTGGAGCAGCCGCAGCTGGG + Exonic
1169687205 20:8288698-8288720 CACCTTCAGCATCTGCAGGATGG + Intronic
1169926343 20:10788283-10788305 CACCAGCTTCAGCAGCAGCTGGG - Intergenic
1170150524 20:13221793-13221815 CCCCAGCAGCAGCAGCAGCTCGG - Exonic
1170330200 20:15201049-15201071 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1170765920 20:19290050-19290072 CACCAGCAGCAGCAGCCCCTGGG + Intronic
1170986763 20:21266095-21266117 CATCTGCAGCACATGCAGCAAGG + Intergenic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172441931 20:34971936-34971958 CAGCCCCACCAGCTGCAGCTGGG - Intergenic
1172565820 20:35929561-35929583 TGCCTGCAGCAGCTGCCTCTGGG + Intronic
1172961852 20:38805713-38805735 CCGCTGGAGCAGCTGCGGCTCGG + Exonic
1172970930 20:38872620-38872642 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1173459362 20:43230564-43230586 CACCTGCAGTAGCAGCTACTCGG + Intergenic
1173643652 20:44620294-44620316 CACCTTCAGCCTCTGCAGGTAGG - Exonic
1173895290 20:46546181-46546203 GACCTGCAGCAGCAGCAGCCAGG + Exonic
1174241989 20:49143896-49143918 CACCTGATGCACCTGCAGCTGGG + Intronic
1174532176 20:51222690-51222712 CAGCTGCACCTGCTGGAGCTGGG - Intergenic
1174532179 20:51222692-51222714 CAGCTCCAGCAGGTGCAGCTGGG + Intergenic
1174716128 20:52760955-52760977 CACCAGAAACAGCAGCAGCTGGG - Intergenic
1174734998 20:52957392-52957414 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175312347 20:58020499-58020521 CAGCTCCAGAGGCTGCAGCTGGG - Intergenic
1175381754 20:58568599-58568621 CTCCTGCAGCAGCACCAGCAGGG - Intergenic
1175493595 20:59396113-59396135 CTCCTCCTGCAGCTGCTGCTGGG - Intergenic
1175504002 20:59469368-59469390 CACCTTCAGCTGCTGGTGCTGGG - Intergenic
1175900769 20:62359107-62359129 CACCTGTAGCACCTGCAGCGTGG + Intronic
1175911048 20:62405765-62405787 CACCTGCAGGGGCTGCCTCTGGG + Intronic
1175963622 20:62649251-62649273 CTCCTGTGACAGCTGCAGCTGGG - Intronic
1176002034 20:62836543-62836565 CACGTGCACCGGCTGCAGCGGGG + Intronic
1176267781 20:64219791-64219813 CTGCTGCAGCTGCTGCTGCTGGG - Exonic
1176308186 21:5135330-5135352 CACCTGCCGCAGCTGCAGCGAGG - Intronic
1176688203 21:9873618-9873640 CATGTGCACCAGCTGCAGCAGGG - Intergenic
1177037292 21:16060179-16060201 CACCTGGTCCAGCTGCAGCAGGG - Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1178396134 21:32245527-32245549 CACCAGAGGAAGCTGCAGCTGGG + Intergenic
1178447898 21:32662102-32662124 AACCTGCAGCTGCTGAAACTTGG + Intronic
1178992500 21:37367297-37367319 CGCCGGCAGCAGCCGCCGCTCGG + Intronic
1179119174 21:38527291-38527313 CAGCAGCCTCAGCTGCAGCTGGG + Intronic
1179161684 21:38904609-38904631 CACCTGGACCACCTGCAACTTGG + Intergenic
1179449466 21:41458613-41458635 GTCCTGCAGGAGCTGCAGCATGG - Exonic
1179478959 21:41665863-41665885 GACCTGAAGCAGGTGCTGCTAGG - Intergenic
1179678799 21:43003226-43003248 GACCTGCACCAGCAGCAGCAAGG + Intronic
1179718167 21:43300816-43300838 CAGCTTCCGCACCTGCAGCTGGG - Intergenic
1179848874 21:44126702-44126724 CACCTGCCGCAGCTGCAGCGAGG + Intronic
1179967156 21:44813859-44813881 CACCTCGGGCAGCTGCATCTGGG + Exonic
1180127286 21:45801119-45801141 CACCTGCAGCACCCACAGCCTGG + Intronic
1180167680 21:46038463-46038485 GGCCTGCAGAAGCTGCATCTCGG + Intergenic
1180484827 22:15784967-15784989 CCCCTGCAGCAGCAGCGGCGTGG + Intergenic
1180672484 22:17564187-17564209 GATCTGCAGAAACTGCAGCTTGG + Intronic
1180799784 22:18626355-18626377 CACCTTGAGAAGCTGCAGCTGGG - Intergenic
1181104296 22:20564450-20564472 CACCTGCTGGAGCTGCAGCTGGG - Exonic
1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181617878 22:24067162-24067184 CACCTGCAGAAGAAGCAGCTGGG - Exonic
1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181912637 22:26252062-26252084 CACAGGCAGCAGCAGCACCTGGG + Intronic
1182053001 22:27327635-27327657 CACCTGCTGCGCCTGCAGCCTGG - Intergenic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182204579 22:28610410-28610432 CACCAGCAGAAGCTGCAGAACGG - Intronic
1182281048 22:29217851-29217873 CACCAGCAGGAGAAGCAGCTTGG - Intronic
1182439337 22:30353236-30353258 CACCTGCAGGGGCTGCTCCTGGG + Intronic
1182524288 22:30906041-30906063 GCCGGGCAGCAGCTGCAGCTCGG + Exonic
1183256108 22:36763432-36763454 TAGCTGCAGCTGATGCAGCTGGG - Intronic
1183448666 22:37877912-37877934 CACCTTCAGCTGCTGCAGGAAGG - Exonic
1183510488 22:38231748-38231770 CTCCTGCCGCAGCAGTAGCTGGG - Intronic
1183618589 22:38959799-38959821 TTCCTGCAGCTGCTGCTGCTTGG + Intronic
1183623793 22:38989723-38989745 TTCCTGCAGCTGCTGCTGCTTGG + Intronic
1183648153 22:39138633-39138655 TACCTGCAGCAGAAGCCGCTTGG + Exonic
1183664537 22:39239733-39239755 TACCTGCTGCAGCTGGCGCTGGG - Intronic
1183949906 22:41347151-41347173 CACCAGCAGCAGCTGGTGCTGGG - Intronic
1184268869 22:43366159-43366181 AACCTTCCTCAGCTGCAGCTTGG + Intergenic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184510382 22:44929938-44929960 CCCCTGCAGCACCTGCAACCAGG + Intronic
1184530090 22:45049831-45049853 CACCTGCAGAGCCTGCAGCGGGG + Intergenic
1184580519 22:45413541-45413563 CACAAGCAGCAGCTCCAGGTGGG + Exonic
1184660609 22:45963945-45963967 CACCTCCAGGAGCTGCAGCCTGG + Intronic
1184871261 22:47239954-47239976 CACCTGCAGCGGCTGGGGCAGGG - Intergenic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185053306 22:48564919-48564941 GAGGTGCAGAAGCTGCAGCTGGG + Intronic
1185322717 22:50209308-50209330 CCCCTGGAGCAGCTGCAGCCAGG + Intronic
1185418043 22:50720691-50720713 CACCTGCAGCTGCTTCACCAGGG - Intergenic
949105922 3:199029-199051 CACCTGCAGATGTTGCAGTTGGG + Intronic
949625127 3:5857153-5857175 CTCCTGCCTCAGCTTCAGCTGGG - Intergenic
949918798 3:8985596-8985618 GTCCAGCAGCAGCAGCAGCTCGG - Exonic
949951509 3:9232818-9232840 CACCTGCAGCAGAATCACCTTGG - Intronic
950435676 3:12978321-12978343 CAGCAGCAGCAGCCTCAGCTGGG + Intronic
951100608 3:18684124-18684146 CAGCTGGAGCTGGTGCAGCTGGG - Intergenic
951749535 3:26018971-26018993 CTGCTACAGCAGCTGCTGCTGGG + Intergenic
951770441 3:26250230-26250252 CACCTGCAGCTGCTGCTGCTCGG + Intergenic
951924062 3:27887873-27887895 CACCTGCAGCAGAACCGGCTAGG + Intergenic
952178028 3:30888171-30888193 CAGATGCAGAAACTGCAGCTAGG + Intronic
952572846 3:34737933-34737955 CACCTGCAGGATGTGCAGGTTGG - Intergenic
953024536 3:39137287-39137309 GCCCTGCAGCAGCCGCAGCTGGG - Exonic
953832314 3:46310905-46310927 CATCTCCAGCAGCTGCAGCCTGG + Intergenic
953929322 3:46998107-46998129 CACCTGCTCCATCAGCAGCTGGG - Exonic
953930180 3:47002078-47002100 CAGCTGCTGCAGCTGCAAGTGGG - Exonic
954224020 3:49171470-49171492 CACATGCCGCAGCTGGAGCAGGG - Intergenic
954497841 3:50982594-50982616 CACCTGCTGCTGCTGCAGAGAGG + Intronic
954637084 3:52076857-52076879 CACATGCAGCTCCAGCAGCTGGG - Intronic
954693098 3:52406286-52406308 CACCTTCAGCACATGCAGCCTGG + Exonic
954706684 3:52484719-52484741 CATCTGCCTCAGCTCCAGCTAGG - Intronic
954745705 3:52786441-52786463 CACCTGCAGCTGCCCCAGGTGGG + Intronic
954808685 3:53234888-53234910 CAGGTGCAGGAGCTGAAGCTGGG - Intronic
954834745 3:53456158-53456180 CACCTGCATCAACTGCTGCTTGG + Intergenic
955365425 3:58306321-58306343 CCCCGGCAGCAGCCACAGCTGGG - Exonic
956179658 3:66505222-66505244 GAACTGCAGCAGCTGCAGCTTGG - Intergenic
956504759 3:69926148-69926170 CACCAACAACAGCAGCAGCTCGG - Intronic
956525032 3:70149435-70149457 CAGCAGCATCAGCTTCAGCTGGG + Intergenic
957359865 3:79141170-79141192 CATCTGAAGCATCTGCAGTTTGG + Intronic
957619334 3:82574575-82574597 CTCCTCCAGCAGCTGCCTCTTGG - Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959622219 3:108410825-108410847 CACCAGCTGCAGCTGGAGCTCGG - Exonic
961781130 3:129320539-129320561 CACCTGCAGCAGCAGCGGATGGG + Intergenic
961856710 3:129878734-129878756 CAGCAGCAGCAGCAGCACCTGGG + Intronic
963234646 3:142945148-142945170 CACCTGCAGGATGTGCAGCAGGG + Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
966320741 3:178698995-178699017 CTGCTGCAGCTGCTGCACCTTGG - Intronic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
967208482 3:187145555-187145577 CAGCTGCTCCAGCTCCAGCTGGG - Intronic
967437232 3:189461785-189461807 AATCTGGGGCAGCTGCAGCTGGG - Intergenic
967572026 3:191040940-191040962 ACCCTCCAGCAGCAGCAGCTTGG - Intergenic
967807956 3:193731788-193731810 CACCTGGAGCTACTGCATCTGGG + Intergenic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968565715 4:1311586-1311608 CGCCTGCAGCCGCAGCAGCCTGG + Intronic
968575238 4:1362957-1362979 CACCTCCAACATCTGCTGCTGGG - Intronic
968615559 4:1576017-1576039 TCCCAGCAGCATCTGCAGCTGGG + Intergenic
968762573 4:2450243-2450265 CACCTGCAGGTGCTGCCTCTGGG + Intronic
968881590 4:3302999-3303021 CTTCTGCAGCAGCTCCAGGTGGG - Intronic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
969321785 4:6417073-6417095 GTCCTGCAGCACCGGCAGCTGGG + Intronic
969617639 4:8262812-8262834 CACCAGCAGCACCCACAGCTGGG + Intergenic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970857181 4:20662301-20662323 CACCTGCAGCAAGGGAAGCTGGG + Intergenic
971326897 4:25652172-25652194 CTCTTGCAGCAGCTGCGGCCAGG + Intergenic
972503243 4:39697362-39697384 CACCAACAGCAGCAGCAACTGGG + Intergenic
972552179 4:40144070-40144092 AACCTGCACCAGCTGCCTCTTGG - Intronic
972554067 4:40163390-40163412 CACCTGCAGGAGCTACAGAGGGG - Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973636420 4:52865461-52865483 CACGTGCAGCAGCTACACCTGGG + Exonic
974663068 4:64920095-64920117 CAGCTGCAGCTGCTGCATGTTGG + Intergenic
974974263 4:68870652-68870674 CATCTTCAAAAGCTGCAGCTGGG + Intergenic
974981271 4:68960267-68960289 CACCTTCAGGAGCTGCAGCTGGG + Intergenic
975048437 4:69830576-69830598 CTGCTGCAGATGCTGCAGCTGGG + Intronic
976378673 4:84374756-84374778 CAGCTGAAGCAGGTGTAGCTGGG - Intergenic
976447790 4:85151505-85151527 TTCCTTCAGCAGCTGCAGCTTGG + Intergenic
977659182 4:99563365-99563387 CACCTGCAGCAACTTCCCCTCGG + Exonic
977786438 4:101040547-101040569 CAGGTGCAACAGCTGCAGCCCGG - Exonic
978090377 4:104707674-104707696 CACCAGCAGAAGCTGCAGAATGG - Intergenic
980351575 4:131691457-131691479 CATGTGCACCAGCTGCAGCAGGG - Intergenic
981081883 4:140644613-140644635 CGCCTTCAGCCGCTCCAGCTGGG + Intronic
981276164 4:142900584-142900606 CACATACAGCAGCTACTGCTGGG + Intergenic
981303584 4:143220327-143220349 AACATGAAGCAGATGCAGCTTGG - Exonic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981786736 4:148487964-148487986 CACCTGCATCAGAAGCATCTGGG - Intergenic
983491740 4:168397892-168397914 CTGCAGCTGCAGCTGCAGCTTGG - Intronic
984130155 4:175864925-175864947 CCTCCCCAGCAGCTGCAGCTGGG + Intronic
984732226 4:183078724-183078746 CCCCTGCAGTACCTGCAGATGGG + Intergenic
985093823 4:186392093-186392115 CAGCAGCAGCAGCAGCATCTTGG + Intergenic
985279473 4:188270965-188270987 CACCAGCAGCAGCAGCAGCCTGG + Intergenic
985537337 5:472744-472766 GGCCTGCAGCCGCTGCAGGTCGG + Exonic
985569086 5:634258-634280 CATCTGCGGCAGCTGCAGGGGGG + Intronic
985668650 5:1195239-1195261 CTCCTGCAGTACCTGGAGCTGGG + Intergenic
985733188 5:1563062-1563084 TCCCCGCAGCAGCTCCAGCTGGG + Intergenic
985831671 5:2238497-2238519 CCCCAGAAGCAGTTGCAGCTGGG - Intergenic
985836089 5:2272937-2272959 CACATGGAGCCGCTGGAGCTCGG + Intergenic
985886897 5:2687003-2687025 CGCCTGCAGGAGGAGCAGCTAGG + Intergenic
985947178 5:3194906-3194928 GACCTGCAGCAGCAGCAGCCAGG + Intergenic
986296937 5:6447072-6447094 CACCAGCAGCAGCGGCAGCAAGG + Intergenic
986317751 5:6601824-6601846 CACCTGCAACAGCTCCGTCTTGG - Intronic
986447271 5:7832317-7832339 GACCAGCAGCAGCAGGAGCTGGG - Intronic
986954411 5:13133867-13133889 CACCTCCAGCAGCTTAAGCATGG + Intergenic
988782238 5:34532932-34532954 CAATTGCAGCAGGTGCAGCAAGG + Intergenic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
989477048 5:41885690-41885712 CATCTTAAGGAGCTGCAGCTGGG - Intergenic
989635713 5:43530807-43530829 AAACTGCAGCTGCTGCAGCTGGG + Intronic
989788467 5:45361426-45361448 CTCCTGCCTCAGCTGTAGCTGGG + Intronic
990954786 5:61331503-61331525 CACCCGCCGAAGCTGCAGCGGGG - Intergenic
991677833 5:69106220-69106242 CCACAGTAGCAGCTGCAGCTTGG + Intronic
992072022 5:73157065-73157087 AACCAGCAGCAGCAGCACCTGGG - Intergenic
992084849 5:73269288-73269310 GTCCTGGAGCAGCTGGAGCTGGG + Intergenic
994034038 5:95178173-95178195 CCCCCACAGCAGCTGCAGCAAGG + Intronic
994643015 5:102433746-102433768 CAACAGCAGCAGCGGCAGCATGG + Intronic
994970565 5:106731286-106731308 CACCAGCAGCAGTGGCAGCATGG - Intergenic
995301999 5:110595094-110595116 CACCAGCAGAAGCTGCAGTATGG - Intronic
995388622 5:111615256-111615278 CACCTGCAGCCAATGCAGATGGG + Intergenic
995442324 5:112205779-112205801 CACCTGCAGGAGAGGCAGCAAGG + Intronic
995636810 5:114202159-114202181 ACCCTGGAGCAGCCGCAGCTGGG - Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998799638 5:145856365-145856387 CAGGAGCAGCAGCAGCAGCTAGG - Intergenic
999132968 5:149298801-149298823 CACCAGCATCAGCTGCAGCTTGG + Intronic
999471299 5:151857492-151857514 CACCTGCTGCAGGTGCACATGGG - Intronic
1001794438 5:174490347-174490369 CACCTGCAGAGGCAGCAGCAGGG + Intergenic
1002058980 5:176615225-176615247 CACCCCCAGCAGCTGCGGCCCGG + Intergenic
1002081817 5:176741857-176741879 CACCTGCATCAGAGGCACCTAGG + Intergenic
1002322070 5:178382224-178382246 CAGCCGCAGCAGCTGCAGCTGGG - Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002888054 6:1312938-1312960 CCGCTGCAGCAGCTGCTGCCGGG - Exonic
1003156787 6:3603609-3603631 CAGCAGCAGCAGCTGCGGATGGG + Intergenic
1003319992 6:5042964-5042986 GGCCTGCAGCAGCTGCCTCTTGG - Intergenic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1004564325 6:16781359-16781381 CAGCTGCAGCAGCATCACCTGGG + Intergenic
1004660717 6:17706760-17706782 CAACTGCGGCAGCTACGGCTAGG - Exonic
1006113617 6:31763520-31763542 CAGCGACAGCAGCTGCATCTAGG + Exonic
1006614969 6:35319959-35319981 CACCTCCTCCAGCTGCTGCTGGG - Exonic
1006640483 6:35486819-35486841 CACCTGGAGCACCTGCTCCTAGG - Intronic
1007219325 6:40265960-40265982 CACCTTCACCAGAGGCAGCTGGG - Intergenic
1007224457 6:40303091-40303113 CACTTGCAGCACCTGCAGCCAGG + Intergenic
1007323610 6:41043941-41043963 CAGCAGCAGCAGGTGCAGCAGGG - Exonic
1007409425 6:41653395-41653417 CACCTGTGGCTCCTGCAGCTCGG + Exonic
1007415915 6:41691077-41691099 CAGCAGCAACAGCAGCAGCTCGG - Exonic
1007506320 6:42337938-42337960 CAACAGCAGCAGCAGCACCTAGG + Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007769877 6:44183959-44183981 TACCAGCAGCAGCAGCAGCGAGG + Exonic
1008033133 6:46719381-46719403 CACTGGCACCAGCTGGAGCTTGG + Intronic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1009736833 6:67687548-67687570 CACCTTCAGGGGCTGCAGCTGGG + Intergenic
1010357706 6:74953841-74953863 CAGCTGCAACAGCAGCACCTGGG + Intergenic
1011399929 6:86949355-86949377 CAACAGCAGCAGCAGCAGCAGGG - Intronic
1011530228 6:88312892-88312914 CAGCAGCAGCAGCTGCACCTGGG + Intergenic
1011610502 6:89146197-89146219 CAGCTTCAGTAGCTCCAGCTCGG - Exonic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1013540725 6:111105820-111105842 CACTTCCAGCACCTTCAGCTGGG - Intronic
1013633747 6:112009369-112009391 TACCTTCAGCATCTGCTGCTTGG + Intergenic
1014099438 6:117494439-117494461 CAGCTGAAGCAGTGGCAGCTTGG + Intronic
1014592146 6:123286841-123286863 CAGCAGCAGCAGCAGCACCTGGG + Intronic
1015090226 6:129347171-129347193 CACCAGCAGCATTTGCAGATAGG + Intronic
1015178601 6:130338137-130338159 CAGCTGCTCCAGCTCCAGCTGGG + Intronic
1015813889 6:137187755-137187777 CATCTTAAGGAGCTGCAGCTGGG - Intergenic
1015878916 6:137851454-137851476 CACCAGCAGCAGCAGCAGCTGGG + Intergenic
1015952638 6:138569087-138569109 CCCCTCCAGCAGCTGCTGCCAGG - Intronic
1017043200 6:150324272-150324294 CATCTGCAGAAGCTGCTGCCAGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019577589 7:1744921-1744943 AACCTGCAGGTGCTGCAGCTGGG + Exonic
1019613797 7:1949742-1949764 TGCCTGCAGCAGCGGCTGCTTGG + Intronic
1020086436 7:5313153-5313175 CAGCAGCAGCAGCAGCGGCTCGG - Exonic
1020173655 7:5865135-5865157 CACCTGAAGCAGTTGCAGTGGGG - Intergenic
1021746424 7:23745513-23745535 CAAGGGCAGCAGCTGCAGGTGGG + Intronic
1022227264 7:28376140-28376162 CATCTGCAGCAGCTGATGATTGG - Intronic
1022275160 7:28847753-28847775 AAGCTGCATCAGCTGGAGCTGGG + Intergenic
1022480765 7:30741598-30741620 CACCTGCAGGAACAGGAGCTTGG + Intronic
1023821855 7:43985086-43985108 CTCCTGCAGCTGTTGAAGCTTGG + Intergenic
1024145544 7:46513003-46513025 CAGCAGCAGCAGATGCAACTGGG + Intergenic
1024250498 7:47502506-47502528 CTCCTGCATCAGCCGCAGCCAGG + Intronic
1024430699 7:49285096-49285118 CACCTGGAGCAGAAGCTGCTGGG + Intergenic
1025664064 7:63572914-63572936 CAGCAGCAGCAGCAGCGGCTCGG - Intergenic
1026095574 7:67343768-67343790 CATCTGCACCTGCTCCAGCTGGG + Intergenic
1026824188 7:73571033-73571055 CAACTTGAGCAGCTCCAGCTAGG + Intronic
1026841243 7:73671017-73671039 CAGATGGAGCAGCTGCTGCTCGG + Exonic
1026878535 7:73893759-73893781 GCCTGGCAGCAGCTGCAGCTGGG - Intergenic
1026905442 7:74060367-74060389 TGTCTGCAGGAGCTGCAGCTGGG + Exonic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028593930 7:92528304-92528326 TACCTGCAGCAGATGCAGCTGGG + Exonic
1028962545 7:96765491-96765513 GAGCAGCAGCAGCAGCAGCTGGG - Intergenic
1029124635 7:98287738-98287760 CGCGAGCAGCAGCTGCAGGTGGG + Intronic
1029335597 7:99896865-99896887 CAACTGCAGCTGCCACAGCTTGG - Intronic
1029336885 7:99908579-99908601 CACCTGAAGCAGCTCCAGGGTGG + Exonic
1029504108 7:100951689-100951711 CTCCTGCATCAGAGGCAGCTTGG - Intronic
1029750122 7:102538508-102538530 CTCCTGCAGCTGTTGAAGCTTGG + Intronic
1029768073 7:102637616-102637638 CTCCTGCAGCTGTTGAAGCTTGG + Exonic
1032006167 7:128303594-128303616 CACCTGGAGCAGCTGCCTGTGGG - Exonic
1032072130 7:128814654-128814676 CAGCTGCAGCTCCCGCAGCTTGG - Exonic
1032473960 7:132199773-132199795 CACCTGGAGAAGCTGCCACTTGG - Intronic
1032568801 7:132977213-132977235 CAGCTGCAGTAGCATCAGCTGGG + Intronic
1033142278 7:138838288-138838310 CACCTGCAGCATAGGCAGCAGGG - Intronic
1033214474 7:139483541-139483563 CACCTGCGGCTGCTCCAGCGTGG + Exonic
1033238748 7:139659480-139659502 CACAAGCTGCAGCTGCAGCCGGG - Intronic
1034055987 7:148035484-148035506 CACCAGCACCAGCTGCACCTGGG - Intronic
1034284252 7:149874009-149874031 CACCTGCAGCGCCCGCTGCTCGG + Exonic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035417446 7:158702305-158702327 CATCTTCAGAATCTGCAGCTGGG - Intronic
1035686674 8:1528486-1528508 CACCAGGAGCAGCAGCAGCTAGG + Intronic
1036431743 8:8698325-8698347 AACCTGCAACAGCTTCATCTTGG - Intergenic
1036659745 8:10700269-10700291 CTCCTGCAGGAGCTCCATCTGGG - Exonic
1037340412 8:17838814-17838836 AACCAGCAGCAGCAGCACCTGGG - Intergenic
1037683792 8:21120426-21120448 GAGCTGAAGCAGCTGCAGGTAGG + Intergenic
1037815017 8:22107552-22107574 CTCCTGCAGCAGCCGCAGGACGG + Exonic
1038024946 8:23579990-23580012 AACCTGAAGCAGTTGAAGCTTGG + Intergenic
1038883650 8:31640246-31640268 CACCCGCAGCGGCGGCAGCAGGG + Intronic
1039210274 8:35205134-35205156 CATCTGCAGCAGCTGCTGCAAGG - Intergenic
1039571211 8:38587865-38587887 CATCTTCTGCAGGTGCAGCTTGG + Intergenic
1039957358 8:42217807-42217829 CCCCTGCAGATGCTGCGGCTGGG + Intergenic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041943404 8:63414114-63414136 TATCTGCAGCAACTGCAGCATGG + Intergenic
1042218074 8:66446427-66446449 GAGCTTAAGCAGCTGCAGCTGGG - Intronic
1042659924 8:71143042-71143064 CAGCTGAAGAAGCTGCAGCCTGG + Intergenic
1043552201 8:81386909-81386931 AGCCCACAGCAGCTGCAGCTTGG - Intergenic
1043948362 8:86279367-86279389 CATCTTAAGGAGCTGCAGCTGGG - Intronic
1044726655 8:95199969-95199991 CACTTGGAGCAGCTGGAGGTAGG + Intergenic
1045852904 8:106724535-106724557 CATCAGCAGCAGCAGCACCTGGG + Intronic
1046543034 8:115611248-115611270 AACCAGCAGCACCTGCAGGTTGG - Intronic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048735258 8:137492516-137492538 CACCTGCAGAACCTGCAGTCAGG - Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048986821 8:139739193-139739215 CACCGGCAGCAGCTCAAGCTGGG + Intronic
1049262834 8:141648996-141649018 CGCCTGCCACACCTGCAGCTGGG + Intergenic
1049399675 8:142419337-142419359 CAGATGCAGCAGGTGCAGCAGGG + Intergenic
1049572675 8:143376584-143376606 CTCCTTCAGCAGCTGCAGGTTGG - Exonic
1049639331 8:143707558-143707580 CAGCTGCAGCACCTGCGGCGGGG + Exonic
1049646413 8:143737848-143737870 CTCCAGCAGCAGCTGCTCCTGGG + Intergenic
1049766270 8:144356678-144356700 CACCTCCAGGACCTGGAGCTGGG + Exonic
1049791082 8:144473032-144473054 CACCTGCAGCAGCAGCACCGCGG - Exonic
1049894652 9:101999-102021 GAGCTGAAGCAGCTGCAGCAGGG - Intergenic
1050182230 9:2934007-2934029 CAGCTGCAGCCGCTGCAGGGTGG + Intergenic
1050186645 9:2982019-2982041 AACCTGCAGCACCTGGATCTTGG - Intergenic
1050873998 9:10613019-10613041 CGTCTCCAGCAGCTGCCGCTCGG + Intergenic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1053015510 9:34659854-34659876 CACCTGGAGCACCTGGAGCCCGG + Exonic
1053149782 9:35736111-35736133 CAGCAGCAGCACCTGCATCTTGG + Exonic
1053735859 9:41101989-41102011 GAGCTGAAGCAGCTGCAGCAGGG - Intergenic
1053781137 9:41608255-41608277 CATGTGCACCAGCTGCAGCAGGG + Intergenic
1054169084 9:61818408-61818430 CATGTGCACCAGCTGCAGCAGGG + Intergenic
1054668448 9:67762408-67762430 CATGTGCACCAGCTGCAGCAGGG - Intergenic
1054692515 9:68329409-68329431 GAGCTGAAGCAGCTGCAGCAGGG + Intronic
1056052252 9:82781382-82781404 CACCAGCAGCAGCATCACCTGGG + Intergenic
1056558113 9:87706613-87706635 GACCAGCAGCACCAGCAGCTCGG - Exonic
1056579543 9:87880830-87880852 CCCCTGCAGCAGCAGGAGCAAGG + Intergenic
1057131212 9:92655838-92655860 CACCCACAGCAGCTGCAGAAGGG + Intronic
1057306614 9:93916170-93916192 CTCCTGGGGAAGCTGCAGCTGGG + Intergenic
1057410032 9:94809951-94809973 CACCTGCAGCACAATCAGCTGGG - Intronic
1057548374 9:96034726-96034748 CAGCTGCCCAAGCTGCAGCTGGG + Intergenic
1057719323 9:97519489-97519511 CACCAGGAGCTGCTGCAGGTGGG + Intronic
1057880422 9:98788735-98788757 CCCATGCAGGAGCTGCAGGTGGG + Intronic
1058073127 9:100621884-100621906 GACAGGCACCAGCTGCAGCTGGG - Intergenic
1058910011 9:109512301-109512323 CAGCTGCACCAGCTGCACCCAGG - Intergenic
1059332807 9:113546782-113546804 CTACAGCAGCAGCTCCAGCTGGG - Intronic
1059419246 9:114180862-114180884 CACCTTCAGAAGCTGCAGATGGG + Intronic
1059602015 9:115789006-115789028 CACCTGCAGCACCTACTGCCTGG + Intergenic
1060518560 9:124280916-124280938 CACCTGTAGCACCAGCTGCTTGG - Intronic
1060533445 9:124363604-124363626 GCCCAGCACCAGCTGCAGCTCGG - Intronic
1060588495 9:124801499-124801521 CACCTGAAGCAGCTTCTCCTTGG - Exonic
1060618696 9:125043778-125043800 CATCTGGAGCAGCTGCTGCAGGG + Intronic
1060758340 9:126228373-126228395 AACCTGCAGGAGCTGGTGCTTGG + Intergenic
1060881935 9:127123414-127123436 TACCTGCAACAGCTGCAGCGAGG + Intronic
1060968928 9:127727046-127727068 CATCTGCTCCAGCTGCAGCCTGG - Exonic
1060984161 9:127810087-127810109 CACCTGCAGCAGCTTCAGCAGGG - Exonic
1060999546 9:127895437-127895459 CACCTGCAGCACCTGGAGGCTGG + Intronic
1061955481 9:133959247-133959269 CACCTGGGGCAGCTGCTGCACGG + Intronic
1062057805 9:134477638-134477660 CACCCACAGCAACTCCAGCTGGG + Intergenic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062134013 9:134915221-134915243 CACGTGCAGCCGCTGCTGCCAGG + Intronic
1062220212 9:135410999-135411021 GGCCTGCCGCAGCTGCAGCCCGG - Intergenic
1062390616 9:136332257-136332279 CACCTGCAGCTGCACCAGGTGGG - Intronic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062496454 9:136833683-136833705 AGGCTGCTGCAGCTGCAGCTGGG - Intronic
1062616176 9:137396995-137397017 CACCTGCAGGAGGGGCTGCTGGG + Intronic
1203697088 Un_GL000214v1:109039-109061 CTCCTGCAGCAGCTGCACAGGGG - Intergenic
1186374326 X:8981944-8981966 CATCTGTAGCAGCTAAAGCTCGG - Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186880084 X:13856382-13856404 CAGCAGCAGCAGCAGCATCTGGG + Intronic
1187219194 X:17307739-17307761 CCCCCACAGCAGCTGCAGCAAGG - Intergenic
1187242112 X:17522844-17522866 CACCTTCAGTAACTGCAGTTGGG + Intronic
1189211929 X:39290980-39291002 CAGCAGCATCAGCAGCAGCTGGG - Intergenic
1189348804 X:40262127-40262149 CTCCTGCAGCAGCAGCAGCCTGG + Intergenic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190332218 X:49242973-49242995 CACCTGGAGGTGCTGCAGCTTGG - Exonic
1191178783 X:57537195-57537217 CACCTGTTGCAGCAGCAGCTGGG + Intergenic
1191640277 X:63424183-63424205 CACCTGCAGAGGCAGCAGCTGGG + Intergenic
1192795463 X:74421551-74421573 CTGCTGCAGCTGCTGCTGCTCGG - Exonic
1193412716 X:81183627-81183649 CCCCTGCAGCAGCTTCTGCCTGG - Intronic
1193417207 X:81238982-81239004 CTTCTGAAGCAGCTGCAGCTTGG + Intronic
1193466466 X:81853325-81853347 CAGCTGCAGCTGGAGCAGCTGGG + Intergenic
1194212046 X:91081923-91081945 CAGCTGGAGCAGGAGCAGCTAGG + Intergenic
1194391485 X:93322641-93322663 CACCTCCTGCAGCTGCAGTTTGG - Intergenic
1195903835 X:109825076-109825098 CATATGCAGCAGCTGCTGCTGGG + Intergenic
1196018505 X:110964946-110964968 CACAAGCAGCAGCTGCTGCCTGG - Intronic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1197262435 X:124333243-124333265 CAGGCGCAGCTGCTGCAGCTGGG - Intronic
1197345066 X:125320445-125320467 CAGGCGCAGCTGCTGCAGCTGGG - Intergenic
1197595120 X:128455034-128455056 CACTTGCAGCTGGGGCAGCTGGG + Intergenic
1198694753 X:139324239-139324261 CACCTGCTGCAGCAGCTGCATGG + Intergenic
1199439776 X:147854940-147854962 CACCCCCAACAGCAGCAGCTTGG - Intergenic
1200268879 X:154662603-154662625 CAGCTGCACCAGCTGCAGCTGGG + Intergenic
1200292627 X:154886880-154886902 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200339471 X:155382620-155382642 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200346999 X:155458073-155458095 CAGCTGGGGCAGCTGGAGCTGGG + Exonic