ID: 1149657744

View in Genome Browser
Species Human (GRCh38)
Location 17:58319189-58319211
Sequence GATCCAAGGGGCCCGGGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149657738_1149657744 -5 Left 1149657738 17:58319171-58319193 CCAGGGCAGATGTGAGCAGATCC 0: 1
1: 0
2: 2
3: 27
4: 217
Right 1149657744 17:58319189-58319211 GATCCAAGGGGCCCGGGTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1149657736_1149657744 3 Left 1149657736 17:58319163-58319185 CCCACAGTCCAGGGCAGATGTGA 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1149657744 17:58319189-58319211 GATCCAAGGGGCCCGGGTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1149657737_1149657744 2 Left 1149657737 17:58319164-58319186 CCACAGTCCAGGGCAGATGTGAG 0: 1
1: 0
2: 6
3: 29
4: 296
Right 1149657744 17:58319189-58319211 GATCCAAGGGGCCCGGGTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 164
1149657735_1149657744 11 Left 1149657735 17:58319155-58319177 CCAAGGCTCCCACAGTCCAGGGC 0: 1
1: 1
2: 4
3: 34
4: 465
Right 1149657744 17:58319189-58319211 GATCCAAGGGGCCCGGGTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149657744 Original CRISPR GATCCAAGGGGCCCGGGTGC AGG Exonic
900290494 1:1921662-1921684 GAACCGAGGGGCCTGGGTGGTGG - Intergenic
900737501 1:4308413-4308435 GATGACAGGGGCCCGGGTGCTGG + Intergenic
901069482 1:6509967-6509989 GACCCCAGGGCCCCAGGTGCAGG + Intronic
902669957 1:17966367-17966389 GAGGCAAGGGGCCTGGGAGCTGG - Intergenic
903521935 1:23957430-23957452 GATTCAAGAGGCCAGGCTGCAGG - Intergenic
903652954 1:24932305-24932327 GATCCAAGGGACCAGGGCGGCGG + Intronic
906603890 1:47151501-47151523 AGTACATGGGGCCCGGGTGCTGG - Intergenic
908330776 1:63068728-63068750 GATTCAAGGGGTACGGGTGCAGG + Intergenic
910613126 1:89166209-89166231 GATACAAGAGGTCCGGGTACTGG + Intronic
911036632 1:93557143-93557165 GATTCAAGGGGCACGTGTTCAGG + Intergenic
911167768 1:94739813-94739835 GTTCCAAAGCCCCCGGGTGCTGG - Intergenic
916239574 1:162625351-162625373 GATCCAGGGGTCTCGGTTGCAGG + Intergenic
918106152 1:181416947-181416969 GAACCAAGAGGTCAGGGTGCAGG - Intronic
919599896 1:199609784-199609806 GATCCAGGGGGTACGTGTGCAGG - Intergenic
922168618 1:223136330-223136352 GATCCCAGGGGCTCGGGTGCAGG - Intronic
922748543 1:228060317-228060339 GATCCCAGGGGCACGGGTTGGGG - Exonic
1062771510 10:104973-104995 GATCCAAGGCGACAGGGGGCTGG + Intergenic
1069788502 10:71004818-71004840 GATCCTAGGGTCCCAGGTGGAGG + Intergenic
1072745907 10:97939099-97939121 GACCCAACGGGCAGGGGTGCAGG - Intronic
1077140254 11:1021059-1021081 GACCCAAGGGGCCAGGGTCCTGG + Intronic
1077412002 11:2408008-2408030 GAACCCAGGGGACGGGGTGCTGG + Intronic
1077483029 11:2825398-2825420 GTGCCAGGGGCCCCGGGTGCTGG + Intronic
1077623934 11:3753342-3753364 GTTCCAAGAGTCCCAGGTGCTGG + Exonic
1079972989 11:27059180-27059202 GCTCCAAGGGGCCCAGGTACAGG + Intronic
1082731986 11:56810001-56810023 GTTTCAAGGGGTACGGGTGCAGG + Intergenic
1083032563 11:59606654-59606676 GATTCAAGGGGCACGTGTGCAGG - Intronic
1083678901 11:64342419-64342441 GAGGCAATGGGACCGGGTGCGGG - Intronic
1084641845 11:70430930-70430952 GATCCGAGGGGCAGGGGAGCTGG - Intronic
1084641861 11:70430989-70431011 GATCCGAGGGGCAGGGGAGCTGG - Intronic
1088842223 11:113636619-113636641 GATTCAAGGGGCACATGTGCAGG + Intergenic
1089301599 11:117502238-117502260 GATGCAGGGGTCGCGGGTGCCGG - Intronic
1089406926 11:118205368-118205390 GATCCTGGGGGCCAGGGTGAAGG - Intronic
1091692759 12:2608408-2608430 GATCCCAGGGATCAGGGTGCAGG - Intronic
1092245492 12:6861762-6861784 GAACCAAGGGGCCCTGGTAGGGG + Intronic
1092399695 12:8164244-8164266 GTTGCCAGGGGCCCTGGTGCTGG - Intronic
1097171558 12:57117179-57117201 GAACCAAGAGGCCAGGGTGTTGG + Intronic
1100980589 12:100159289-100159311 GAGCCAAGGGGCCAGGGGCCTGG - Intergenic
1102521250 12:113478671-113478693 GAGCCAAGGGGCTGGGGGGCGGG + Intergenic
1103036482 12:117660948-117660970 AATCCAAGGGGCAAGTGTGCAGG + Intronic
1104625312 12:130348575-130348597 GATTCAAGGGGCACACGTGCAGG - Intronic
1108156133 13:47586456-47586478 GATCCAAGGGGTACATGTGCAGG - Intergenic
1110187593 13:72693137-72693159 GAGCCAAGGGGTCAGGATGCAGG - Intergenic
1111430781 13:88145985-88146007 GATCTAAGGGGCCCAGAGGCAGG + Intergenic
1114516835 14:23305930-23305952 GATCCAAGAGCCCAGGGGGCTGG + Intronic
1115002358 14:28438500-28438522 GATCTAAGGGGCCCAGAGGCAGG + Intergenic
1122790480 14:104182269-104182291 GACACTAGGGGCCTGGGTGCGGG - Intergenic
1128378234 15:67092487-67092509 GATCCAAGAGGCCTGGGGGCGGG - Intronic
1131532623 15:93206686-93206708 GATTCAGGGGGCACGTGTGCAGG + Intergenic
1132553689 16:563799-563821 GACCCAAGGGGCGTGGGTGCGGG + Exonic
1132622721 16:875344-875366 GGACCAACGGGCCCTGGTGCAGG - Intronic
1132968631 16:2673653-2673675 AATCCCAGGGCCCCGGGGGCGGG + Intergenic
1138558706 16:57787560-57787582 GATCAAAGGGGCCCTTGTGCTGG + Intronic
1141204566 16:81923573-81923595 TCTCCAAGGAGCCCGGGGGCTGG + Exonic
1142342468 16:89532502-89532524 GATGCAGGGGGCCCGGGCTCGGG - Exonic
1142592457 17:1012318-1012340 GAGACAAGGGGCCAGGGTGGTGG + Intronic
1144154437 17:12485416-12485438 GCTCCAAGGGCCCCAGGGGCAGG + Intergenic
1145018829 17:19414938-19414960 GCTTCAAGGGGCTCGGTTGCCGG - Intronic
1146124259 17:30219429-30219451 GTTCCAAGGGTCCCAGGTACTGG - Intronic
1146176419 17:30668532-30668554 GAACCAAGGGGCCCCGCTGGAGG - Intergenic
1146263192 17:31434861-31434883 GATGCAGAGAGCCCGGGTGCTGG - Intronic
1146349879 17:32084646-32084668 GAACCAAGGGGCCCCGCTGGAGG - Intergenic
1146789441 17:35743171-35743193 GAACCAGGGGGCAGGGGTGCAGG - Exonic
1146978847 17:37140878-37140900 GATGCCAGTGCCCCGGGTGCAGG + Intronic
1149657744 17:58319189-58319211 GATCCAAGGGGCCCGGGTGCAGG + Exonic
1152298944 17:79484470-79484492 GGTGCAGGGGGCCTGGGTGCAGG + Intronic
1152298957 17:79484499-79484521 GGTGCAGGGGGCCTGGGTGCAGG + Intronic
1152298964 17:79484514-79484536 GGTGCAGGGGGCCTGGGTGCAGG + Intronic
1152298977 17:79484543-79484565 GGTGCAGGGGGCCTGGGTGCAGG + Intronic
1152298984 17:79484558-79484580 GGTGCAGGGGGCCTGGGTGCAGG + Intronic
1152561502 17:81081116-81081138 TGTCCAAGGGGCCCGAGAGCTGG + Intronic
1152604297 17:81281335-81281357 GGTCCCAGGGGCTCGGGTCCTGG + Intronic
1152751773 17:82065650-82065672 GCTCCGAGGGCGCCGGGTGCCGG + Intronic
1152754931 17:82083255-82083277 GTTCCATGGGGCCCAGGTGGAGG - Exonic
1152786466 17:82250514-82250536 GAGCCTCGGGGCCCAGGTGCCGG - Intronic
1152855994 17:82664733-82664755 GACAGGAGGGGCCCGGGTGCGGG - Intronic
1153053837 18:926232-926254 GATCCCAGGAGCCAGGGAGCAGG - Intergenic
1153805355 18:8705485-8705507 AATCCTCGGGGCCGGGGTGCGGG + Intergenic
1155426453 18:25712590-25712612 GATTCAGGGGGCACGTGTGCAGG + Intergenic
1156742019 18:40342858-40342880 GCTCCAAGTGGCCAGGGTCCTGG + Intergenic
1162517188 19:11155564-11155586 GGGGGAAGGGGCCCGGGTGCTGG - Intronic
1163000401 19:14363385-14363407 GGACAAAGGGGCCCGGGGGCGGG - Intergenic
1163688470 19:18725510-18725532 GAACCCAGGGGCCCGTGTGTGGG - Intronic
1163957927 19:20661244-20661266 GAGACAAGACGCCCGGGTGCCGG + Intronic
1164261370 19:23570898-23570920 GATGCAAGGGTCCCAGCTGCAGG - Intronic
1166917311 19:46204259-46204281 GATCCCAGGCACCCGGGGGCTGG - Intergenic
1167512269 19:49901609-49901631 CATCCCAGGGCCCCGGGTGGGGG + Intronic
1168712731 19:58511280-58511302 GAGCTCTGGGGCCCGGGTGCTGG - Exonic
925910234 2:8569214-8569236 GATCTGAGGGTCCCGGATGCTGG - Intergenic
927677498 2:25117134-25117156 GTTCCAAGGGGCATGGGTGTAGG + Intronic
928092489 2:28383741-28383763 GGTCCAAGGGCCTCTGGTGCTGG - Intergenic
930046264 2:47175881-47175903 GATCCAGGGGGCGCGCGGGCGGG - Intronic
931516417 2:63052939-63052961 GATCCAGGGGGCCCGGGGCCAGG - Exonic
933649040 2:84834079-84834101 GATGGAAGGTGCCCAGGTGCTGG - Intronic
934606708 2:95700650-95700672 GATCCACGGAGCCAGGGTGGAGG - Intergenic
935594256 2:104867331-104867353 GAACCGAGGGGCCCGGGAGGGGG + Intergenic
936556912 2:113503918-113503940 GGTCCAAGGGGCGCGGGGGCCGG + Intergenic
937093264 2:119220632-119220654 GATCCAAGTGGCCTGGCTTCTGG + Intergenic
937984838 2:127633739-127633761 GAACAAAGGGGCCAGGGGGCAGG + Intronic
943151262 2:184116416-184116438 CCTGCAAGGGGCCTGGGTGCGGG - Intergenic
946281817 2:218671532-218671554 GATCCAAGGGGAAAGGGGGCCGG + Intronic
947641020 2:231707998-231708020 GGTCCAAGGCGCCCAGGCGCGGG + Intronic
948456183 2:238105667-238105689 GGCCCATGGGGCCCGGGGGCGGG + Intronic
948462864 2:238138763-238138785 GATCCAGGGGGCTCTGGGGCAGG + Intronic
948746098 2:240095496-240095518 GGTGCAGGGGTCCCGGGTGCAGG + Intergenic
948746131 2:240095601-240095623 GGTTCAGGGGCCCCGGGTGCAGG + Intergenic
948996631 2:241583719-241583741 GATCCCTGGAGCCCGGGTGGTGG - Intergenic
1169083864 20:2815239-2815261 CCTCCAAGGGGCCTGGGTGCTGG + Exonic
1170566733 20:17611927-17611949 GATGCATGGGGCGCGGATGCAGG + Intergenic
1170971673 20:21122758-21122780 GACCCAAGGGGACAGGGTTCAGG + Intergenic
1174958194 20:55124477-55124499 CATCCAAGGAGCCGGGGTGGAGG + Intergenic
1175084334 20:56445974-56445996 GGACCACGGGGCCCCGGTGCTGG - Exonic
1175521746 20:59606179-59606201 AATCCCTGGGGCCCGGGTGAAGG + Intronic
1178271791 21:31197211-31197233 GATTCAAGGGGCACATGTGCAGG - Intronic
1178927964 21:36791763-36791785 GCTCCAAGGGGCCTGTTTGCTGG + Intronic
1184235161 22:43179390-43179412 GATCCCAGGGTGCCTGGTGCTGG - Intronic
1184510863 22:44932401-44932423 GATCCAAGGGCCCAGGTTGGGGG - Intronic
1184643548 22:45884538-45884560 GATGCAAGGCCCCCGGCTGCAGG + Intergenic
952809283 3:37387059-37387081 GGGCCAAGGGGCCTGGGGGCTGG - Intronic
952952878 3:38538764-38538786 GTCCCAAGCGGCCAGGGTGCAGG - Intronic
953371564 3:42392940-42392962 GAACCAAGATGCCAGGGTGCTGG + Intergenic
962835408 3:139184902-139184924 GATCCACGGGGCCCCTGGGCAGG + Intronic
967002439 3:185349146-185349168 GATTCAAGGGGCACATGTGCAGG + Intronic
975749497 4:77508330-77508352 GATCTAATGGGCTCTGGTGCTGG + Intergenic
977591901 4:98836455-98836477 GATCCAGGGGGCCTGGGTTCTGG - Intergenic
979521263 4:121669779-121669801 GATCAAATGCTCCCGGGTGCGGG + Intronic
980863527 4:138527568-138527590 GATACAAGGGGTACGTGTGCAGG - Intergenic
983655041 4:170074223-170074245 GATTCAAGGGGTACGTGTGCAGG + Intronic
983871246 4:172827181-172827203 AGTCCAAGAGGCCCGGTTGCAGG + Intronic
990492590 5:56317102-56317124 GATCCAAGGGGTACACGTGCAGG - Intergenic
992074929 5:73183701-73183723 GAACCAGGGGGCCAGGGGGCAGG - Intergenic
993018444 5:82563314-82563336 AATCCAAGGCGACCAGGTGCTGG + Intergenic
993322356 5:86487818-86487840 GATACAAGGGGCACATGTGCAGG - Intergenic
997465799 5:134087347-134087369 GAGCCAGGAGGCCTGGGTGCTGG + Intergenic
999732642 5:154486291-154486313 GATCTATGGAGCCTGGGTGCTGG + Intergenic
1000209920 5:159099367-159099389 GATGCAGGGCGCCGGGGTGCTGG - Exonic
1002079544 5:176729138-176729160 GGGCCAAGGGGCTGGGGTGCGGG - Intergenic
1002183053 5:177441387-177441409 GCTCGAAGGGGCCAGGGTGCAGG - Intronic
1002625127 5:180521583-180521605 GATCCAAGGGGTACATGTGCAGG + Intronic
1002642437 5:180636610-180636632 GATCTCAGAGGCCAGGGTGCTGG - Intronic
1005803666 6:29452302-29452324 GTTTCAAGGGGCACAGGTGCAGG - Intronic
1016038323 6:139406051-139406073 GATTCAAGGGGTCCGTGTGCAGG + Intergenic
1018675706 6:166220723-166220745 GATTCAGGGGGCCCGCATGCAGG + Intergenic
1018940266 6:168304852-168304874 GAGGCAAGGAGCCAGGGTGCCGG + Intronic
1019217532 6:170453444-170453466 CTTCCAAGGGGCCCGAGTGGCGG + Intergenic
1019703250 7:2484764-2484786 GAGCCATTGCGCCCGGGTGCTGG - Intergenic
1019748982 7:2717069-2717091 GAACCGAGGGGCGTGGGTGCCGG - Intronic
1021522867 7:21554461-21554483 GATCCCAAGGGGCCAGGTGCAGG - Intronic
1027131383 7:75593702-75593724 GAGCCAAGGGGTCAAGGTGCAGG - Intronic
1030805199 7:113909106-113909128 GATTCAAGGGGTCCATGTGCAGG - Intronic
1033217188 7:139501625-139501647 GATTCAAGGGGTACAGGTGCAGG - Intergenic
1033246440 7:139720355-139720377 GATCCATGGGCCCAGGGTGGAGG - Intronic
1034513334 7:151553697-151553719 GAGCTAGGGGGCCTGGGTGCAGG + Intergenic
1035282798 7:157787951-157787973 GTTCCCAGGGGACCCGGTGCTGG - Intronic
1036343700 8:7940598-7940620 GTTGCCAGGGGCCCTGGTGCTGG - Intronic
1036803263 8:11808590-11808612 GCGCCCAGGGGCCCGGGCGCAGG + Intronic
1038421662 8:27437693-27437715 GAGCCAGGGGACCAGGGTGCTGG - Intronic
1042761002 8:72271372-72271394 GATCCAAGGGGCCCAAAGGCAGG - Intergenic
1044971457 8:97624473-97624495 GATGCCAGCGCCCCGGGTGCAGG + Intergenic
1049168394 8:141141385-141141407 GAGCCAAGGGACCAGGGGGCTGG + Intronic
1049418764 8:142507563-142507585 GAGCCCTGGGGGCCGGGTGCTGG + Intronic
1049541356 8:143210601-143210623 GAGCCCAGGGGCGCAGGTGCAGG + Intergenic
1049896088 9:113383-113405 GGTCCAAGGGGCGCGGGGGCCGG - Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1050757418 9:9023560-9023582 GATACAAGGGGTCCATGTGCAGG + Intronic
1054999079 9:71427885-71427907 GATCCAGGGGGTACGTGTGCAGG - Intronic
1057404059 9:94751778-94751800 GATCCAGGGGGTCCATGTGCAGG + Intronic
1059728723 9:117035110-117035132 GTTCCAAGCTGCCCAGGTGCTGG - Intronic
1059945566 9:119405298-119405320 GATGCAAGGGGCTTGGGTGGAGG - Intergenic
1060798522 9:126528464-126528486 GGTGCCAGGGGCCAGGGTGCTGG - Intergenic
1061836603 9:133333717-133333739 GATCCAGGAGGCCCGGGGCCAGG - Exonic
1061925985 9:133806282-133806304 GAGGGGAGGGGCCCGGGTGCTGG + Intronic
1061961517 9:133991495-133991517 GCGCCAAGTGGCCCGGGTCCGGG + Intronic
1062493090 9:136817772-136817794 AAGCAAAGGGGGCCGGGTGCTGG + Intronic
1062583501 9:137238387-137238409 GAGCCAAGGTGCCCTGCTGCAGG - Intergenic
1187682965 X:21786522-21786544 CATCCAAGGGGCACAGGAGCTGG - Intergenic
1190844910 X:54182841-54182863 GCTGCCCGGGGCCCGGGTGCTGG - Exonic
1192214036 X:69145543-69145565 AACCCCAGGGGCCAGGGTGCTGG - Intergenic
1194570938 X:95553852-95553874 GATCTAAGGGGCCCAGAGGCAGG + Intergenic
1197872589 X:131073504-131073526 CCTCCAAGGGGCCAGAGTGCAGG - Intronic
1198413428 X:136394667-136394689 GATCCACGGGGCAGAGGTGCAGG - Intronic
1199666365 X:150099521-150099543 GAGCAGAGGGGCCCGGATGCTGG + Intergenic