ID: 1149658546

View in Genome Browser
Species Human (GRCh38)
Location 17:58322961-58322983
Sequence CTGTGGCTCTCCCACTGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149658540_1149658546 14 Left 1149658540 17:58322924-58322946 CCACAGCACCTGGGCGGAAGTGG 0: 1
1: 0
2: 3
3: 32
4: 356
Right 1149658546 17:58322961-58322983 CTGTGGCTCTCCCACTGAGCCGG 0: 1
1: 0
2: 4
3: 20
4: 196
1149658542_1149658546 6 Left 1149658542 17:58322932-58322954 CCTGGGCGGAAGTGGTACCTGCT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1149658546 17:58322961-58322983 CTGTGGCTCTCCCACTGAGCCGG 0: 1
1: 0
2: 4
3: 20
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149658546 Original CRISPR CTGTGGCTCTCCCACTGAGC CGG Exonic
901034795 1:6329922-6329944 CTGCAGCTTTCCCAGTGAGCAGG - Intronic
905255430 1:36678779-36678801 ATGTGGCTCTCTCCCTGAGGTGG - Intergenic
906669038 1:47641619-47641641 CTCTGGATCTCCCACTCTGCTGG - Intergenic
908562378 1:65319493-65319515 CTAGGGCTCTCCCAGTGAGAAGG - Intronic
912284801 1:108357806-108357828 CTGTGAGGCTCCCACAGAGCTGG + Intergenic
912981739 1:114380112-114380134 CTGTGGAACTCCCACTCACCAGG + Intergenic
915859000 1:159422314-159422336 CTGTGGCCCTACTACTGAGGAGG + Intergenic
917598461 1:176552797-176552819 CTGTGGCGATCAGACTGAGCAGG - Intronic
917836159 1:178943081-178943103 CTGTGGCTCTGCCAATCAGCCGG + Intergenic
920610501 1:207431987-207432009 CTTTGGCCCTCTCACTGACCTGG + Intergenic
920628386 1:207626629-207626651 CTGTGGCTCTCCCATAGAGCAGG - Intronic
920638529 1:207728842-207728864 TTGCGGCTCTCCCATAGAGCAGG - Intronic
921491357 1:215779952-215779974 CAGTGGCTCTGCATCTGAGCTGG - Exonic
921803779 1:219431542-219431564 GTGTGGCTCTGCCACTGACATGG + Intergenic
924168618 1:241312655-241312677 CTGTGTCTCTCCCACTCCTCGGG + Intronic
924179283 1:241424515-241424537 CGGAGGCTTTCCCACTGGGCAGG + Intergenic
1062907226 10:1187219-1187241 CTGTGGCTGTCCTACTAGGCAGG + Intronic
1062987033 10:1778751-1778773 CTGTGGCTCTCGCTGTGTGCTGG + Intergenic
1063462038 10:6221241-6221263 CTGTGGCTGTCCCAGTGGCCTGG + Intronic
1063860631 10:10303923-10303945 CTGTGCCTCTCCTTCAGAGCAGG - Intergenic
1064422305 10:15200914-15200936 CTGAGGCTTTACCACTGACCTGG - Intergenic
1064443396 10:15372329-15372351 TTTTGGCTCTGCCACTGACCAGG - Intergenic
1069586519 10:69607650-69607672 CTGTGGCCCTGCTACTGAGACGG - Intergenic
1071415466 10:85437194-85437216 CTGTGCCAATCCCTCTGAGCAGG + Intergenic
1071666534 10:87564113-87564135 CTGTGGCCCTGCCACTGGGGAGG - Intergenic
1072663709 10:97379387-97379409 CTCTGGATTTCCCACGGAGCTGG - Exonic
1073180488 10:101580169-101580191 CTGAGGTTCTCCCTCTGAGGGGG + Intronic
1075650596 10:124126291-124126313 CTGTGCCTCCCACACTGAGCTGG + Intergenic
1076525397 10:131109517-131109539 CTGTTGTTCTCCCACTGAGGCGG - Intronic
1078435393 11:11320796-11320818 CTGTGGCCTGCCCAGTGAGCTGG - Intronic
1083871175 11:65489412-65489434 CTGTGGCTGTCCCCGTGACCTGG - Intergenic
1084014396 11:66370092-66370114 CTGTGGATCTCCCTCTAAACAGG + Intronic
1084602259 11:70152829-70152851 CGGTGGCCCTCCCAATGGGCTGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1085821185 11:79795360-79795382 TTGAGGCTCTCCCCATGAGCTGG - Intergenic
1088846844 11:113675412-113675434 CAGTGGCTCTCCCACGCAGTTGG + Intergenic
1091288253 11:134421169-134421191 CTCTGGCTCTCGCACTGACAAGG - Intergenic
1094807481 12:34107162-34107184 CTGTGCCTCCCCCAATGCGCTGG - Intergenic
1100372052 12:93977395-93977417 CTGAGTCTCTCCCACTGTTCTGG + Intergenic
1102566580 12:113801225-113801247 CTGTGGCTCCCCCTGTGACCAGG + Intergenic
1104236983 12:126948388-126948410 CTGTGCCTCTTCCCCTAAGCTGG + Intergenic
1105505393 13:21005362-21005384 CTCTGGCACTCCTACTGGGCAGG + Intronic
1105874538 13:24540816-24540838 CTGTGGCTCTGAGGCTGAGCCGG + Intergenic
1106101106 13:26695684-26695706 CTGTGGCTTTCACACTTAGGTGG + Intergenic
1110303648 13:73958683-73958705 CAGTGGCTCTCACACTGAATTGG + Intronic
1112211599 13:97383150-97383172 CTGTGGCTCTCATGCTGAGATGG - Intronic
1112765152 13:102733822-102733844 CTGTTGCTCTGCCTCTGGGCGGG + Exonic
1113407506 13:110055273-110055295 CTGTGGTTTCCTCACTGAGCAGG - Intergenic
1113784866 13:112997140-112997162 CTCTGGGTCTGCCACTGAGCTGG - Intronic
1113889531 13:113728649-113728671 CTGTGCCTGTTCCACGGAGCCGG - Intronic
1114554142 14:23551783-23551805 CCGGGGCTGCCCCACTGAGCAGG + Intronic
1119375735 14:74191120-74191142 CTGTGGCTCTGGCGCAGAGCTGG - Intronic
1121396942 14:93633629-93633651 CTCTGCCTCTCTCACTGGGCTGG + Intronic
1122414199 14:101541021-101541043 CTGGGGCCCTCCCAGTGAGCTGG + Intergenic
1123035632 14:105470814-105470836 CTGTGGCTCTGCCGTGGAGCTGG + Intergenic
1125532276 15:40421506-40421528 CTGTTGCCCTCCCACAGGGCAGG - Intronic
1125587467 15:40831010-40831032 GTGTGGCTCTCTTCCTGAGCAGG + Intergenic
1127221634 15:56886961-56886983 CTGTGGCTCTCCCACCGTCCCGG - Intronic
1127329693 15:57926595-57926617 CTGTGGTTAACCCACTGAACTGG - Intergenic
1133333433 16:4990686-4990708 CTAGGGCTCTCCCACTGACCTGG - Intronic
1133349572 16:5092575-5092597 GTGTGGCTCTTTCACTCAGCAGG + Intronic
1133883441 16:9804507-9804529 TTGTGTTTCTCCCACTGGGCAGG + Intronic
1134244538 16:12530207-12530229 CTTTGGCTCTTCCACTGAGGAGG + Intronic
1134692426 16:16199662-16199684 CTGTGTGACTCACACTGAGCTGG + Intronic
1134979418 16:18595014-18595036 CTGTGTGACTCACACTGAGCTGG - Intergenic
1138221794 16:55258135-55258157 GTGTCGCTGTCCCACTGGGCTGG - Intergenic
1139532510 16:67549438-67549460 CTTTGTCTCGCCCACAGAGCGGG + Intergenic
1139699769 16:68700930-68700952 TCCTGCCTCTCCCACTGAGCTGG + Intronic
1140042357 16:71416489-71416511 CTGTGACTTTCCCAGTGAACTGG + Intergenic
1142418203 16:89954467-89954489 CCCTGGCTTTCCCACGGAGCCGG + Intronic
1142885710 17:2911098-2911120 TTGTGGCTCTCCCACTGGGAAGG + Intronic
1143997435 17:11019494-11019516 CTGTGGCAAAGCCACTGAGCTGG + Intergenic
1144076201 17:11721844-11721866 CTGTGGCTCTCCCCCTACTCTGG - Intronic
1144466047 17:15498549-15498571 CTATTCCTCTCCCACAGAGCAGG + Intronic
1145279604 17:21457904-21457926 CTCTGGCCCTCCTGCTGAGCAGG - Intergenic
1147441248 17:40448521-40448543 CTGTGGGTTCCCCTCTGAGCAGG - Intronic
1148860421 17:50601662-50601684 CTCTGGCTCTCCTTCTGAGAAGG - Intronic
1149658546 17:58322961-58322983 CTGTGGCTCTCCCACTGAGCCGG + Exonic
1150327082 17:64265823-64265845 CTTGGGCTCTCCTCCTGAGCGGG - Intergenic
1150626781 17:66847030-66847052 CTCTGGCTCTGCCACCAAGCAGG - Intronic
1156079567 18:33316578-33316600 CAGTGGATCTCCCACTGGGGCGG - Intronic
1157379675 18:47202165-47202187 CATTGGCTCTCCCACTCAGAGGG - Intergenic
1158500639 18:57997681-57997703 CTGTAGCTGTACCCCTGAGCTGG + Intergenic
1160162115 18:76481176-76481198 CTGTAGCCATCCCAGTGAGCTGG - Intronic
1160538781 18:79609468-79609490 CTGTGGCTCTGCATCTGACCTGG - Intergenic
1161491136 19:4562291-4562313 GTCTGGCTCTCTCACTGAGCGGG + Intergenic
1161491381 19:4563766-4563788 GTCTGGCTCTCTCACTGAGCGGG + Intergenic
1161668308 19:5590259-5590281 CTGGGGCTCACCCACTAACCTGG + Exonic
1162498735 19:11038714-11038736 CTGAGGCTGTGCCAGTGAGCTGG - Intronic
1163565665 19:18049680-18049702 CTGTGGCTCTCCGGCTGTCCTGG - Intergenic
1163620347 19:18355982-18356004 CTGTGCTTCTCCCACAGGGCGGG - Exonic
1164936672 19:32220238-32220260 CTGTGGATCTCCCAAGAAGCTGG - Intergenic
1165333876 19:35155716-35155738 CTGTCACCCTCCCGCTGAGCCGG + Intronic
1165897866 19:39154287-39154309 CCGTGGCTCTCCCACGCTGCTGG - Intronic
1165926522 19:39329533-39329555 CTGTGTCTCACCCACAGGGCTGG + Exonic
1165992436 19:39824352-39824374 GCCTGTCTCTCCCACTGAGCGGG + Intergenic
1166105216 19:40594846-40594868 CTGTGTGTCTCACAGTGAGCGGG + Intronic
1166151030 19:40875949-40875971 CTGCGGCTCTCCCAGGGAGGAGG + Intronic
1166155524 19:40908728-40908750 CTGCGGCTCTCCCAGGGAGGAGG + Intergenic
1166260763 19:41639305-41639327 CTGTGGCCCTTCCACAGACCAGG - Intronic
1166283007 19:41807698-41807720 CTGTGGCTCTTCCACAGACCAGG + Intronic
1166415022 19:42589092-42589114 CTGTGGCTCTTCCACAGACCAGG - Intronic
1166419576 19:42626106-42626128 CTGTGGCTCTTCCACAGACCAGG - Intronic
1166431577 19:42732437-42732459 CTGTGGCCCTTCCACAGACCAGG - Intronic
1166444568 19:42847676-42847698 CTGTGGCCCTTCCACAGACCAGG - Intronic
1166454457 19:42929096-42929118 CTGTGGCCCTTCCACAGACCAGG - Intronic
1166464255 19:43018423-43018445 CTGTGGCCCTTCCACAGACCAGG - Intronic
1166470405 19:43075007-43075029 CTGTGGCCCTTCCACAGACCAGG - Intronic
1166481535 19:43178532-43178554 CTGTGGCCCTTCCACAGACCAGG - Intronic
1166484006 19:43197650-43197672 CTGTGGCCCTTCCACAGACCAGG - Intronic
1166491121 19:43261514-43261536 CTGTGGCCCTTCCACAGACCAGG - Intronic
1168646670 19:58063424-58063446 CTATGGGTCTCTCCCTGAGCAGG + Exonic
929612232 2:43279619-43279641 TTGTGGCTTTCCCACTAAGATGG + Intronic
934661858 2:96147306-96147328 CTGGGGTCCTCCCACAGAGCTGG - Intergenic
935453862 2:103242931-103242953 CTGTGGTTCTCACACTTTGCAGG - Intergenic
935737560 2:106118409-106118431 CTGTGGCCCACCCACTGGGCTGG - Intronic
937904833 2:127047947-127047969 CTGTGGCTTTCTTACTGAGATGG - Intergenic
943223844 2:185144338-185144360 CTGTGCCTCCCCTGCTGAGCTGG - Intergenic
946085641 2:217168533-217168555 GTGTGTCTCTCCCACAGAGATGG - Intergenic
946711124 2:222507014-222507036 CTGTGGGTCTCCTACCAAGCTGG - Intronic
946923428 2:224603185-224603207 CTCTGGCTCTACCAATCAGCAGG - Intergenic
948757851 2:240169600-240169622 CTTTGTCTCTGCCACTGAGTAGG + Intergenic
1170900111 20:20454361-20454383 CTGAGGCTCTCGCACACAGCAGG + Intronic
1171399277 20:24861191-24861213 CTGTGGCTCTCACACCCATCTGG - Intergenic
1172434766 20:34921165-34921187 CTGTGGGTATCCCTCAGAGCTGG + Intronic
1172445893 20:34993259-34993281 CTGTGGCGGTCACACTGGGCAGG + Intronic
1172600278 20:36178386-36178408 CTGAGGCAGTCCCAGTGAGCAGG - Intronic
1173705849 20:45109972-45109994 CTGTGGCTCTGCACCTAAGCTGG - Exonic
1175374825 20:58516803-58516825 GTCTGGCTCTCCCAAAGAGCTGG - Intergenic
1175489793 20:59372123-59372145 TAGAGGCTCTGCCACTGAGCAGG + Intergenic
1175612549 20:60363806-60363828 CTGTGACTCCCCTGCTGAGCGGG - Intergenic
1175756223 20:61532049-61532071 CTCAGGCTCTGCCACTGAGGAGG + Intronic
1176015555 20:62929394-62929416 CTGTGGGTGTCCCCCGGAGCGGG - Intronic
1180138333 21:45875681-45875703 CTGATGCCCTCCCAGTGAGCTGG + Intronic
1180225064 21:46387348-46387370 CTCTCGCTCGCCCACTGACCTGG - Intronic
1184041018 22:41943683-41943705 CAGTGGCTCTCCCGCCCAGCTGG + Exonic
1184604141 22:45562620-45562642 GTGGGGCTCTGCCAGTGAGCAGG + Intronic
1184690033 22:46113346-46113368 CAGAGGCCCTGCCACTGAGCTGG - Intronic
1184691922 22:46121368-46121390 CAGTGGCTGTCCCACAGTGCAGG + Intergenic
1184792442 22:46708377-46708399 CTGTGCCTCTCCCGCAGTGCGGG - Intronic
1184950371 22:47837664-47837686 CTGTGGCTCTGCCACTGCACGGG + Intergenic
953692143 3:45128461-45128483 TTGTGTCTCTCTCACTGAGGGGG - Intronic
953927383 3:46989370-46989392 CTGGGTCTCACCCACTGCGCTGG - Exonic
954369607 3:50163318-50163340 CTCTGGCCCTTCCACTGAGCAGG + Intronic
954707512 3:52488899-52488921 CTGTTGCTCTCCCACTGGGCAGG - Intronic
954771028 3:52969009-52969031 CTGTTTCTCTACCACTGAACTGG - Intronic
956708158 3:72017242-72017264 TTGTGGCTCTCACACTGTGATGG - Intergenic
961009017 3:123423808-123423830 CCTATGCTCTCCCACTGAGCTGG - Intronic
961703144 3:128762676-128762698 CTCAGGCTCTCCCACTGAAGTGG - Intronic
968481252 4:834034-834056 CTGGGCCTCTCCCTGTGAGCCGG + Intergenic
969415195 4:7053381-7053403 CTGTGGCTCTTCAAGGGAGCAGG - Intronic
970001374 4:11368953-11368975 TTGGGGCTCTCCCGCTGGGCCGG + Intergenic
975695347 4:77007445-77007467 CTGTGGCAACCCCAGTGAGCTGG - Intronic
978905729 4:114003454-114003476 CTGGGGTTCTCCCACTGATAGGG + Intergenic
984996708 4:185438897-185438919 GTCTGGCTCTCACACAGAGCTGG - Intronic
985784052 5:1885094-1885116 CCCTGGCTCTCCCCCTCAGCCGG - Intronic
986404381 5:7411285-7411307 CTCTGGCTCACCCTCTGAGGTGG + Intronic
986477668 5:8152291-8152313 CTGTGGCTCTCCCACTGGCCTGG - Intergenic
988334817 5:29893469-29893491 CTGTGGATCTCACACTTTGCTGG + Intergenic
988860635 5:35274195-35274217 CTCTGACCCTCCCACTGATCTGG + Intergenic
992067255 5:73120022-73120044 CTGTGGCCCTCCTACTGCTCTGG - Intergenic
993328432 5:86569014-86569036 CTCTGGCTCTACCAATCAGCAGG - Intergenic
997338115 5:133121968-133121990 GTGTGCCTGGCCCACTGAGCGGG + Intergenic
999625739 5:153518307-153518329 TTGTGGCGCTTACACTGAGCAGG - Intronic
1002679671 5:180950973-180950995 CTCTGGCTCTGGCACAGAGCAGG - Intergenic
1004128823 6:12899873-12899895 CTGTGTCCATCCCACTGAGAGGG + Intronic
1005681693 6:28215272-28215294 CTGTGGCCCTCCGACAGTGCAGG - Intergenic
1006646895 6:35521134-35521156 CTGTGACTGTCCCACTGTGGGGG - Intergenic
1013432426 6:110066817-110066839 CCATGTCTCTCCCACAGAGCTGG - Intergenic
1015554326 6:134445316-134445338 CGGTGGCTCTCCCAATGTGAGGG - Intergenic
1018633604 6:165841519-165841541 CTGTTGCTTTCTCACAGAGCTGG - Intronic
1022498572 7:30868483-30868505 AAGAGGCTCTGCCACTGAGCAGG - Intronic
1022523049 7:31020124-31020146 CTGTAGCTCTCTGACTGAGGTGG - Intergenic
1022995367 7:35749864-35749886 CTGGAGCTTCCCCACTGAGCTGG + Intergenic
1023193221 7:37606100-37606122 CTGTGGATTTTCCACTGTGCAGG + Intergenic
1023609563 7:41959128-41959150 GTCTGCCTCTCCCACTGGGCTGG + Intergenic
1024178532 7:46864304-46864326 CTGTGGCTCCCACCCTGTGCGGG - Intergenic
1024355772 7:48412027-48412049 CTGTGACTCTCCCAGTGGACGGG + Intronic
1026979426 7:74517902-74517924 CTGGGGCTCCCCCACCAAGCAGG - Intronic
1027712583 7:81624221-81624243 GTGTGGCTCTCCCAGTAAGTAGG - Intergenic
1029402650 7:100355497-100355519 CTGTGGCTCTCTCTCAGAGGGGG - Intronic
1029405373 7:100371726-100371748 CTGTGGCTCTCTCACAGACAGGG - Intronic
1029664345 7:101985316-101985338 CTGTGTCTCCCCCACAGGGCAGG - Intronic
1030565556 7:111150527-111150549 AATTGGCTCTGCCACTGAGCTGG + Intronic
1031870059 7:127081530-127081552 CTGTCTCTCTCCCACTAACCTGG + Intronic
1034347526 7:150396700-150396722 GTGGGCCCCTCCCACTGAGCAGG + Exonic
1034401660 7:150865634-150865656 CTGTGCCTCTCCCAGTTAGGGGG + Intergenic
1035369108 7:158367503-158367525 CGGTGGCACTCACACTGTGCTGG + Intronic
1036629125 8:10498077-10498099 CTGTAGCTCACCCACTGCACTGG - Intergenic
1038583184 8:28767901-28767923 CTCTGGCTCTCTCAAGGAGCTGG - Exonic
1039076188 8:33692667-33692689 CTGTGGCTCACCCTGTGAGGGGG - Intergenic
1039599248 8:38820400-38820422 CTGGGGCTTTCCCACTGACTAGG - Exonic
1041446562 8:57957744-57957766 CTGTGGCTCCCACACTGAAGCGG - Intergenic
1042193777 8:66214367-66214389 CTCTGGCTCTCCCAGTGCTCAGG + Intergenic
1042355048 8:67818343-67818365 ATGTGGGACTCCCACTTAGCAGG + Intergenic
1044622694 8:94205811-94205833 CTGTTGTTATCCCACAGAGCAGG + Intronic
1045425247 8:102059837-102059859 CTGTGGTTCTCCAACTTTGCAGG + Intronic
1045567092 8:103330675-103330697 CTTTAGCTCTCCCATTGAGAAGG - Intronic
1049839626 8:144762752-144762774 CTGTGGCTCCTCCACTGACCAGG - Intergenic
1050716346 9:8530882-8530904 CTCTGGCTCTCCCGCTGGGCAGG + Intronic
1051497571 9:17741879-17741901 CTGTGACTCCCCATCTGAGCTGG - Intronic
1052857269 9:33415230-33415252 CTGTTTCTCTCCCACTCAGTGGG - Intergenic
1053604486 9:39642981-39643003 CTGTGGCTCTCAAAATGAGTGGG - Intergenic
1054249055 9:62699433-62699455 CTGTGGCTCTCAAAATGAGTGGG + Intergenic
1054563169 9:66733966-66733988 CTGTGGCTCTCAAAATGAGTGGG + Intergenic
1057315930 9:93968472-93968494 ATGTGCCTCTGTCACTGAGCGGG - Intergenic
1058341153 9:103898441-103898463 CTGTGGCTATCCTTCTCAGCAGG + Intergenic
1058711602 9:107683889-107683911 GTGTGTCTCTCCCACTAACCAGG + Intergenic
1060802588 9:126554159-126554181 TTGTGTCTCTCCCACTGGTCTGG + Intergenic
1062045849 9:134424159-134424181 CTGTGGCTGTCCCTCTTAGGTGG + Intronic
1185465800 X:353799-353821 CTGGGGCTCACCCAAGGAGCAGG + Intronic
1187084685 X:16029688-16029710 CTGTGGCTCTCCCAGTGCACAGG - Intergenic
1189090869 X:38081387-38081409 CTGTGTATCTCCCACTGATAAGG - Intronic
1190892900 X:54586635-54586657 CTGTGGCCCTACTACTGAGGAGG - Intergenic
1192291047 X:69795738-69795760 CTGTGGCTTTGCCACTGGGGAGG - Intronic
1194412871 X:93578141-93578163 TTGTGGCTGTGCCACTGACCAGG - Intergenic
1197720026 X:129738846-129738868 CTGGGGCTCTGCCGCTGAGAGGG + Intergenic
1197722885 X:129756722-129756744 CTGTGTATTTCCCACTGTGCAGG - Intronic
1200077275 X:153557396-153557418 CTGTTGCTCACCCACTGAGCAGG + Intronic
1200305072 X:155016738-155016760 ATGAGTCTCTCCCACTGACCTGG - Intronic
1201490140 Y:14532149-14532171 ATGTGTCTCTCCCACCGAGATGG + Intronic