ID: 1149658795

View in Genome Browser
Species Human (GRCh38)
Location 17:58324055-58324077
Sequence CCAAAGTTTGCACGGATAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149658795_1149658808 20 Left 1149658795 17:58324055-58324077 CCGATTATCCGTGCAAACTTTGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1149658808 17:58324098-58324120 GAGGGTGCATCTCCCTTCCAGGG 0: 1
1: 0
2: 3
3: 10
4: 166
1149658795_1149658810 30 Left 1149658795 17:58324055-58324077 CCGATTATCCGTGCAAACTTTGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1149658810 17:58324108-58324130 CTCCCTTCCAGGGCCAGCCAGGG 0: 1
1: 0
2: 4
3: 33
4: 423
1149658795_1149658804 -2 Left 1149658795 17:58324055-58324077 CCGATTATCCGTGCAAACTTTGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1149658804 17:58324076-58324098 GGGGGAGGACAGGTCTTGATGGG 0: 1
1: 0
2: 0
3: 14
4: 171
1149658795_1149658807 19 Left 1149658795 17:58324055-58324077 CCGATTATCCGTGCAAACTTTGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1149658807 17:58324097-58324119 GGAGGGTGCATCTCCCTTCCAGG 0: 1
1: 0
2: 3
3: 23
4: 253
1149658795_1149658805 1 Left 1149658795 17:58324055-58324077 CCGATTATCCGTGCAAACTTTGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1149658805 17:58324079-58324101 GGAGGACAGGTCTTGATGGGAGG 0: 1
1: 0
2: 2
3: 19
4: 216
1149658795_1149658809 29 Left 1149658795 17:58324055-58324077 CCGATTATCCGTGCAAACTTTGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1149658809 17:58324107-58324129 TCTCCCTTCCAGGGCCAGCCAGG 0: 1
1: 0
2: 3
3: 37
4: 377
1149658795_1149658806 2 Left 1149658795 17:58324055-58324077 CCGATTATCCGTGCAAACTTTGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1149658806 17:58324080-58324102 GAGGACAGGTCTTGATGGGAGGG 0: 1
1: 0
2: 0
3: 22
4: 234
1149658795_1149658803 -3 Left 1149658795 17:58324055-58324077 CCGATTATCCGTGCAAACTTTGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1149658803 17:58324075-58324097 TGGGGGAGGACAGGTCTTGATGG 0: 1
1: 0
2: 4
3: 23
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149658795 Original CRISPR CCAAAGTTTGCACGGATAAT CGG (reversed) Intronic