ID: 1149658810

View in Genome Browser
Species Human (GRCh38)
Location 17:58324108-58324130
Sequence CTCCCTTCCAGGGCCAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 423}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149658795_1149658810 30 Left 1149658795 17:58324055-58324077 CCGATTATCCGTGCAAACTTTGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1149658810 17:58324108-58324130 CTCCCTTCCAGGGCCAGCCAGGG 0: 1
1: 0
2: 4
3: 33
4: 423
1149658801_1149658810 22 Left 1149658801 17:58324063-58324085 CCGTGCAAACTTTGGGGGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1149658810 17:58324108-58324130 CTCCCTTCCAGGGCCAGCCAGGG 0: 1
1: 0
2: 4
3: 33
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149658810 Original CRISPR CTCCCTTCCAGGGCCAGCCA GGG Intronic