ID: 1149659671

View in Genome Browser
Species Human (GRCh38)
Location 17:58327711-58327733
Sequence CCTGGAGCTCCCGTCTCCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149659657_1149659671 29 Left 1149659657 17:58327659-58327681 CCAGGCTGGGCAGACAAGCCTCT 0: 1
1: 0
2: 6
3: 26
4: 216
Right 1149659671 17:58327711-58327733 CCTGGAGCTCCCGTCTCCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 163
1149659660_1149659671 11 Left 1149659660 17:58327677-58327699 CCTCTGCTCCTTCAGGGTCAGTT 0: 1
1: 0
2: 1
3: 25
4: 312
Right 1149659671 17:58327711-58327733 CCTGGAGCTCCCGTCTCCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 163
1149659661_1149659671 3 Left 1149659661 17:58327685-58327707 CCTTCAGGGTCAGTTCCCCCCAC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1149659671 17:58327711-58327733 CCTGGAGCTCCCGTCTCCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 163
1149659656_1149659671 30 Left 1149659656 17:58327658-58327680 CCCAGGCTGGGCAGACAAGCCTC 0: 1
1: 0
2: 4
3: 20
4: 208
Right 1149659671 17:58327711-58327733 CCTGGAGCTCCCGTCTCCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149659671 Original CRISPR CCTGGAGCTCCCGTCTCCTT TGG Exonic
902435832 1:16397675-16397697 CCTGGACCCCCCAGCTCCTTTGG - Exonic
903777750 1:25804076-25804098 CCTGTTGCTCCCTTCTTCTTGGG + Intronic
904008122 1:27374364-27374386 CCTGGGGCTCCCTTCTCCCCAGG + Exonic
905385831 1:37603448-37603470 CCTGAAGCTCCCTTCTCCTTTGG - Intergenic
905677844 1:39841778-39841800 CCTGGGGATCCCTTCTCTTTAGG + Exonic
906479210 1:46189289-46189311 CCTGGGGCTCCCTCCTCCTTTGG + Exonic
906845842 1:49190898-49190920 CCTGGAACTCCTGCCTCTTTTGG + Intronic
907050527 1:51327004-51327026 CCTCTAGCTCCCTTCTCGTTTGG - Intronic
907158685 1:52356154-52356176 CCTGGAGCCCCTGTTTCCCTAGG + Intronic
916704061 1:167328628-167328650 CCTGTACCTCCCTTCTCCCTTGG + Intronic
916869163 1:168893683-168893705 CCTGGAGCTCTCATCTCCAGTGG - Intergenic
919254431 1:195103431-195103453 ACTGGAGCTCAGGTTTCCTTGGG - Intergenic
922200173 1:223394285-223394307 GCTGCAGCTCCCGTATCCTCTGG - Exonic
922879074 1:228965908-228965930 CCTGGGGCTCCTGTCTCCATGGG - Intergenic
924045485 1:240025159-240025181 CCTTGAGCTCCCATCTTCTTAGG - Intronic
1066654597 10:37686486-37686508 CTTGGGGCTCCCGTCTCCTGGGG + Intergenic
1067039567 10:42941946-42941968 TCTGGGGCTCCTGTCTCCTGGGG + Intergenic
1067210892 10:44259753-44259775 CCTGGAGCTCCCGGCCCATGAGG + Intergenic
1067697666 10:48547554-48547576 CCTGGAGCACCTGTCTGCTTTGG - Intronic
1069669513 10:70189874-70189896 CCTGTGGCTTCAGTCTCCTTTGG + Intergenic
1070314043 10:75294394-75294416 CCTGGAGCTCCCTTTCCCTAAGG + Intergenic
1070533713 10:77359726-77359748 CCCAGAGCTCCCATCTCCGTGGG - Intronic
1070868446 10:79725632-79725654 CATGGAGCTGCCATCTCCTATGG - Intergenic
1071635361 10:87247838-87247860 CATGGAGCTGCCATCTCCTATGG - Intergenic
1071659886 10:87490149-87490171 CATGGAGCTGCCATCTCCTATGG + Intergenic
1074035281 10:109732466-109732488 CCTGGAGTTCCCATTTCCTCTGG + Intergenic
1074786493 10:116846741-116846763 CCTGGTGATCCCATCACCTTGGG + Intergenic
1075381865 10:122025696-122025718 CCTGTAGCTCCCAGCTACTTGGG - Intronic
1076696797 10:132251070-132251092 CCTGGGGCTCAGGGCTCCTTGGG - Intronic
1077139981 11:1020047-1020069 CCTGCAGCTGCCCTCTCCATGGG + Intronic
1080600664 11:33818605-33818627 CCTGGAGCTACCCCCTCCCTGGG + Intergenic
1082803963 11:57435155-57435177 CATGGAGCTGGCTTCTCCTTTGG - Intergenic
1083856156 11:65394078-65394100 CCTGGAGCTCCCGCCGCTTTGGG - Exonic
1084183760 11:67459540-67459562 CCTGGAGTTCCAGGCTCTTTAGG - Exonic
1084417599 11:69042423-69042445 CCTGGATCTCCAGTCCCCTCAGG - Intergenic
1084967427 11:72751931-72751953 CCTGGGGCTCCAGTGACCTTGGG - Intronic
1089588850 11:119527256-119527278 CCTGCAGCTCCCTTCTCCCCAGG - Intergenic
1095301348 12:40588003-40588025 CCTTGAAATCCAGTCTCCTTAGG - Intergenic
1096532370 12:52249920-52249942 CCTGGATCTCCTGACACCTTGGG - Intronic
1097029840 12:56082412-56082434 CCTGGAGTTCCCAGCTCCTCTGG + Intronic
1099790584 12:87329545-87329567 CCAGAAGCTTCCATCTCCTTAGG - Intergenic
1103739087 12:123079114-123079136 TCAGGAGCTGCGGTCTCCTTAGG + Intronic
1105408640 13:20151578-20151600 CCTGGAGCCCCGGTCTGCTCTGG - Intronic
1106872391 13:34035935-34035957 CCTGGTGCCCTCATCTCCTTTGG - Intergenic
1108221098 13:48233608-48233630 CCCGGCGCTCCCGTTTCCTGTGG + Intronic
1109008634 13:56910386-56910408 CCTGGAGCTGCCGGCTCCGCCGG + Intergenic
1110861109 13:80345348-80345370 CCTTGAGCTCCAGGCTCCTGCGG + Intergenic
1113252589 13:108470981-108471003 TCTGGAGCTTCCCTCTCCATAGG - Intergenic
1119029124 14:71177623-71177645 CCTTGAGCTTCTTTCTCCTTTGG + Intergenic
1121779731 14:96614667-96614689 CCAGGAGCTCACGTCTGCTCTGG - Intergenic
1123479517 15:20618018-20618040 GCTGTGGCTCCTGTCTCCTTCGG + Intergenic
1123638490 15:22382346-22382368 GCTGTGGCTCCTGTCTCCTTCGG - Intergenic
1127820087 15:62647012-62647034 TCTGGAGCTCCCTCCTCCTAAGG + Intronic
1132586576 16:708148-708170 CCTGGAGCACCCTTCACCTGGGG + Intronic
1134460389 16:14424923-14424945 CCTGGAGCTCCTGACTCAGTAGG + Intergenic
1134539234 16:15051468-15051490 CCTGTAGTTCCCAGCTCCTTGGG - Intronic
1134775208 16:16846991-16847013 CCAGGAGCTCCAGTCTCCAAGGG - Intergenic
1142371649 16:89686232-89686254 CCTGGAGGTCCCCTCACCTGGGG + Intronic
1143007449 17:3846142-3846164 CCTGGGGCTCCCGTCCCCTGAGG - Exonic
1147914232 17:43877191-43877213 ACTGCAGCTCCCAGCTCCTTTGG - Intronic
1148216531 17:45836570-45836592 CCTGGAGCTCCCTTCCGCTGGGG + Intergenic
1148328353 17:46797338-46797360 CCTGGAGCTGCCGTCTTCCTGGG - Intronic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1149654791 17:58304611-58304633 CCTTGAGCTTGCCTCTCCTTGGG - Intronic
1149659671 17:58327711-58327733 CCTGGAGCTCCCGTCTCCTTTGG + Exonic
1150723569 17:67633818-67633840 CCTGGACCTCCCGGCCTCTTTGG + Intronic
1152110137 17:78353259-78353281 CCTGGGGCTCCTGTCACCCTCGG + Intergenic
1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG + Intronic
1156763686 18:40625322-40625344 CCTGGAGCTGTTGTCCCCTTTGG - Intergenic
1157382203 18:47228931-47228953 CCATGAGCTCCAGCCTCCTTTGG + Intronic
1159666998 18:71173694-71173716 CCTGGAGCTCTGATCTCCGTGGG - Intergenic
1160427799 18:78790326-78790348 CCTGGAGCTCCCAACGCCCTGGG - Intergenic
1160870700 19:1276432-1276454 CCTGTGGCTCCAGTCTCCTCTGG + Intronic
1163861242 19:19744021-19744043 CCTGGAGCTCAGCTCACCTTTGG - Intergenic
1168137418 19:54360709-54360731 CCTGGAGCCCTGGTCTCCTCTGG - Intronic
925714447 2:6771828-6771850 CCTGGTGTTCCTGGCTCCTTGGG - Intergenic
928655973 2:33452487-33452509 CCTGGAGCTTGCATCTCCTGGGG + Intronic
934973028 2:98778595-98778617 CCTGTAACTCCCAGCTCCTTGGG - Intergenic
937280544 2:120714490-120714512 CCTGGTGCTTCCATCTCCTTTGG + Intergenic
937870425 2:126782272-126782294 CCTTGCGCTCCCGTCCCCTTGGG - Intergenic
937946565 2:127343893-127343915 CCTGTAGCTCCCAGCTACTTGGG + Intronic
940895948 2:159081899-159081921 CCTGGATCCCCCAGCTCCTTTGG - Intronic
942655623 2:178211487-178211509 CCAGGACCTCCGGTCTCCTCAGG + Intronic
944668320 2:201974768-201974790 CCTGCAGCTCCCATCCCCTGTGG + Intergenic
946111892 2:217427113-217427135 CCTAAAGATCGCGTCTCCTTTGG - Intronic
946135580 2:217644244-217644266 CCTGGTGCACCCCTCCCCTTTGG - Intronic
946843479 2:223839206-223839228 CCTGGAGCTTACGTCTCTTGTGG + Intergenic
947750157 2:232527815-232527837 CATGGAGATCCCGTCTGCCTTGG + Intronic
948007767 2:234624420-234624442 CCTGGGGCCCCCGTATCCTTGGG + Intergenic
949035023 2:241812294-241812316 CCTGGAGGTCCCATCTCCCCTGG + Intronic
1169345407 20:4824267-4824289 CCTGAGGCTCCCTTCCCCTTTGG - Intergenic
1169775468 20:9247757-9247779 CCTGGAGCACCTGCCTCCTCAGG - Intronic
1170740733 20:19053862-19053884 CCTGGAGTTCCTGATTCCTTAGG - Intergenic
1172951561 20:38726161-38726183 CCTAGAGCTGAAGTCTCCTTCGG - Intronic
1174510781 20:51050735-51050757 GCTGGAGGCACCGTCTCCTTTGG + Intergenic
1175121198 20:56717429-56717451 CCAGGATCTCCCATCCCCTTTGG + Intergenic
1179209497 21:39313392-39313414 CCTGGCGCTCCCGGCTGCTTCGG - Intronic
1180048437 21:45320476-45320498 CCTGGAGCTCCCTGCTGCATTGG + Intergenic
1181540977 22:23573223-23573245 CCTGCAGCTCCAGGCCCCTTTGG + Exonic
1181615981 22:24054750-24054772 CCTGGAGCTGCCATGTCCATGGG - Intronic
1182992696 22:34783144-34783166 CCTTGAACTTCAGTCTCCTTTGG + Intergenic
1183716498 22:39536189-39536211 CCCGGAGCTCCTGGCTCCTGTGG + Intergenic
1184129457 22:42509142-42509164 CCTGGCGCCCATGTCTCCTTGGG - Intergenic
1185373246 22:50470456-50470478 CCCTGAGCTCCACTCTCCTTGGG + Intronic
950546299 3:13640016-13640038 CACGGAGCTCCCGTGTCCTCAGG + Intergenic
953914361 3:46909110-46909132 GCTGGAGCTCCTTTCTCCCTGGG - Intergenic
955042289 3:55329357-55329379 CCTGCTGCTTCCCTCTCCTTTGG - Intergenic
955137963 3:56238579-56238601 CCTGGAGCTTCAGTCTCCCCTGG - Intronic
957221475 3:77388336-77388358 ACTGTAGCTTCCATCTCCTTGGG - Intronic
960262747 3:115587108-115587130 CCTGGAGCTCAGCTCTACTTGGG + Intergenic
963791655 3:149589078-149589100 ACAGGAGCTGCCCTCTCCTTGGG + Intronic
966728491 3:183130706-183130728 CCTGGAGCGATCGTCTGCTTTGG + Intronic
966860600 3:184229458-184229480 GCTGGCGCTCCCCCCTCCTTCGG - Intronic
967317662 3:188164507-188164529 CCTGGAGCTTCTGTCTTGTTTGG + Intronic
969446090 4:7245359-7245381 CCTGGAGCTCCTTGCTCCTCCGG + Intronic
969638160 4:8381367-8381389 CCCCGAGCTCCCGTGACCTTGGG - Intronic
970540824 4:17077201-17077223 TCTGCAGCTGCCGGCTCCTTTGG + Intergenic
972878388 4:43394282-43394304 CATGGAGCTGCCATCTCCTTTGG - Intergenic
975475750 4:74821456-74821478 CCTGAAGCTCCCGTGGCCTCAGG + Intergenic
975642264 4:76512308-76512330 TCTGGAGATCCCCTCTGCTTTGG - Intronic
980886590 4:138769088-138769110 CCTTGATCTTCTGTCTCCTTTGG + Intergenic
981603373 4:146517337-146517359 CCTGTAGTTCCCAGCTCCTTGGG + Intronic
983626283 4:169804886-169804908 CATGGAGCTTCCGTCCCCTCTGG - Intergenic
983893344 4:173054785-173054807 TCTGGTGCTCCAGGCTCCTTTGG - Intergenic
995409666 5:111841639-111841661 CCTGGGGTTCCCTCCTCCTTAGG + Intronic
997352977 5:133244169-133244191 CCTGTAGCCCCTGTCTCCTGGGG - Intronic
998368080 5:141644076-141644098 CCTGGGCCTCCCATCTCCTATGG - Intronic
999900088 5:156077750-156077772 CCTGGAAATCCCATCTCCCTTGG + Intronic
1001522958 5:172408011-172408033 GCTGGAGCTCCCGGCCTCTTTGG + Intronic
1001785852 5:174412532-174412554 GCTGGAGCTCCTGACTCCTCTGG + Intergenic
1002510921 5:179716805-179716827 CCTGGTGCTCTGGTCTCCTGTGG - Intronic
1002837809 6:880083-880105 ACTGGTGCTCAAGTCTCCTTAGG + Intergenic
1003354571 6:5355125-5355147 CCTGTAGCTCCCACCTCCTTTGG + Intronic
1003488153 6:6597303-6597325 CCTGGAGCTCCTGCCTCATGGGG - Intronic
1007069137 6:39022424-39022446 CCTGGACCCCCCAGCTCCTTTGG - Intronic
1009940217 6:70281532-70281554 CCTGAAGCCCCCGCCTCCGTGGG + Intronic
1014170344 6:118271797-118271819 CCTGAAGCACCTGTCTCTTTGGG - Intronic
1015742124 6:136468003-136468025 CTTGGAACTACCGACTCCTTAGG + Intronic
1018041608 6:159928920-159928942 CATGGAGCTGTCGTCTCCTATGG - Intergenic
1019292229 7:256425-256447 CCTGGAGCTGCCTTCACCTCTGG - Intronic
1019915453 7:4129456-4129478 CCGGGAGCTCTGGCCTCCTTGGG - Intronic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1020997488 7:15281393-15281415 CCTGGAGGGCCCTTCTCCTGTGG - Intronic
1021929710 7:25567957-25567979 CATGGAGCTGTCGTCTCCTGTGG - Intergenic
1023266861 7:38415605-38415627 CCTCGTTCTCCCTTCTCCTTAGG - Intronic
1024054467 7:45651088-45651110 CCTGTAGCTGCTGTCTGCTTGGG + Intronic
1025839167 7:65127926-65127948 CCTGGAGCTCCTGTGTGATTAGG - Intergenic
1025883901 7:65568039-65568061 CCTGGAGCTCCTGTGTGATTAGG + Intergenic
1025889544 7:65634567-65634589 CCTGGAGCTCCTGTGTGATTAGG - Intergenic
1027116559 7:75486057-75486079 CCTGGGGCTCCCGGCCCCTCTGG + Exonic
1031852912 7:126887410-126887432 CCTGGAGTTCCTGTGTGCTTAGG + Intronic
1032011566 7:128351176-128351198 CCCGGAGCTCCCCTCCCCTGGGG - Exonic
1033879988 7:145869184-145869206 CCTGGTGATCACCTCTCCTTTGG - Intergenic
1035315154 7:157992981-157993003 CCTGGAGCCCCCGTCTTACTGGG + Intronic
1035477857 7:159156317-159156339 CCTGGTGCTCCCGCCTGCTGTGG + Intergenic
1035814747 8:2527311-2527333 CCAGGAGCGCCTGTCTACTTGGG + Intergenic
1039079684 8:33722525-33722547 CCTGCAGCTGCCGTGCCCTTGGG - Intergenic
1039860484 8:41453086-41453108 GCTGAAGCTTCCTTCTCCTTGGG - Intergenic
1041858061 8:62480625-62480647 CCTGAAGCTTCCGTCTCCTAGGG - Intronic
1045052016 8:98336035-98336057 GCTGGAAATCCCCTCTCCTTAGG + Intergenic
1045385261 8:101666514-101666536 CCTGGAGCTCCCCTTGCCCTGGG + Intronic
1048214392 8:132481289-132481311 CCTGGAGCTCCCGTGGGCGTTGG + Intergenic
1049662058 8:143823996-143824018 CCTGGAGCTCGCGCGTTCTTAGG - Intronic
1049759257 8:144324575-144324597 CGTGGAGGTCGGGTCTCCTTGGG - Intronic
1050409203 9:5343982-5344004 TTTGGCGCTCACGTCTCCTTAGG - Intergenic
1056134977 9:83622891-83622913 CCTGGCACTCGCGTCTCCCTGGG - Intergenic
1058402822 9:104637055-104637077 CCTGTAGCACCCTGCTCCTTAGG + Intergenic
1059028561 9:110664577-110664599 CATGGAGCTGCCATCTCCTATGG + Intergenic
1061201386 9:129140463-129140485 CCTGGAGCTCCAGTGGCCCTGGG - Intronic
1061590430 9:131594312-131594334 CCCGGAGCTTCCGATTCCTTAGG - Intronic
1061674265 9:132206931-132206953 CCTGGACCTGCGGTCTCCTCTGG + Intronic
1061762263 9:132858940-132858962 CCTGGTGCTCCAGTTTCCCTGGG + Intronic
1061842318 9:133366456-133366478 CCTGGAGCTCCTTTCTCTTCTGG - Intronic
1062583394 9:137237997-137238019 CGGGGAGCTCCCCTGTCCTTTGG + Intergenic
1191019247 X:55842209-55842231 CCTGGACCTCCTTTCTCATTGGG - Intergenic
1191846638 X:65551878-65551900 TCTGGAGCTCCCGCCCCTTTGGG + Intergenic
1192146791 X:68687915-68687937 CCTGGAGCTCCCATGTCAGTGGG - Intronic
1192313911 X:70037353-70037375 CCTGGAGTTCACCTCACCTTGGG - Exonic
1193092627 X:77510768-77510790 CCTGGAGCTCTATTCTACTTCGG - Intronic
1196820376 X:119695744-119695766 CCTGGGCCTCCAGCCTCCTTCGG + Intergenic
1197706802 X:129640003-129640025 CCTGGAGTTCCTCTCTCCTTTGG - Intergenic
1200162409 X:154016312-154016334 CCTGGAGCTGCAGCCTCCTGGGG + Intronic