ID: 1149662208

View in Genome Browser
Species Human (GRCh38)
Location 17:58339909-58339931
Sequence GCCATAAGATCCCAGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149662208_1149662211 6 Left 1149662208 17:58339909-58339931 CCCGCTTCCTGGGATCTTATGGC No data
Right 1149662211 17:58339938-58339960 ACACAGCATCTTTAGACAAGAGG No data
1149662208_1149662212 18 Left 1149662208 17:58339909-58339931 CCCGCTTCCTGGGATCTTATGGC No data
Right 1149662212 17:58339950-58339972 TAGACAAGAGGTACTGAGCTAGG No data
1149662208_1149662213 27 Left 1149662208 17:58339909-58339931 CCCGCTTCCTGGGATCTTATGGC No data
Right 1149662213 17:58339959-58339981 GGTACTGAGCTAGGCAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149662208 Original CRISPR GCCATAAGATCCCAGGAAGC GGG (reversed) Intergenic
No off target data available for this crispr