ID: 1149663112

View in Genome Browser
Species Human (GRCh38)
Location 17:58346372-58346394
Sequence CTCAGCTGCCACCTTGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149663112 Original CRISPR CTCAGCTGCCACCTTGAGGG GGG Intronic
900186467 1:1335486-1335508 CACAGCTGCCACAGGGAGGGAGG - Exonic
900494287 1:2969441-2969463 CTCAGCAGACACCTTGGGGAGGG + Intergenic
900743487 1:4344467-4344489 CGCAGAGGCCACCTTGGGGGTGG + Intergenic
902527357 1:17067986-17068008 GTCAGCTGCCAACTTAGGGGTGG - Exonic
903016154 1:20363476-20363498 CCCAGCTGCCTCCTTGGGGAGGG - Intergenic
905488779 1:38327410-38327432 CTCTGCTGCCACCATCAGTGTGG - Intergenic
910962576 1:92778387-92778409 GTCACCTGCCACATTGAGGGTGG - Intronic
915734359 1:158075352-158075374 CTCAGCTCCCACAGTGAAGGAGG + Intronic
916408241 1:164518887-164518909 CCCATCTGCCACCATGAGGTTGG - Intergenic
919015227 1:192024909-192024931 CACAGCGGCCTGCTTGAGGGTGG - Intergenic
922738919 1:228005034-228005056 CTCACCTGCCCCCTTCAGTGAGG + Intergenic
922790304 1:228307514-228307536 CTCACCTGTGACCCTGAGGGAGG - Exonic
923113545 1:230913317-230913339 CTCAGCTGCTGCCTTGATTGAGG + Intronic
923731971 1:236560421-236560443 CACTGCTGCCAGCCTGAGGGGGG + Intronic
1062791447 10:308921-308943 CTCAGCTGGCATCTGGTGGGGGG - Intronic
1066436534 10:35401075-35401097 CTCAGCTGCCACCTGGGCCGGGG - Intronic
1069756065 10:70775080-70775102 CTCAGCTCCCACCCTGGAGGGGG - Intronic
1069809527 10:71148130-71148152 CACAACTGCCTCCTTCAGGGAGG + Intergenic
1070767763 10:79066575-79066597 CTCAGCTGCCACCTACAGGGAGG + Intergenic
1072528358 10:96294935-96294957 TTCAGCTGGCACCTTGATGTTGG + Intergenic
1073324157 10:102632870-102632892 CTCAGCTGCAATTCTGAGGGGGG + Exonic
1075462960 10:122630956-122630978 TTCAGATGCCACCTTGAGGTTGG + Exonic
1076032820 10:127174019-127174041 CTCAGCCTCCACCTTAAGGCAGG + Intronic
1077145249 11:1041635-1041657 CTAAGCTCCCACCTGGAGGGAGG - Intergenic
1077286053 11:1766479-1766501 CTCAGATGCCACCTTCTTGGAGG - Intergenic
1077330509 11:1982051-1982073 CTCATTTGCCACATGGAGGGTGG + Intronic
1077391908 11:2304162-2304184 CGCTGCAGCCACCGTGAGGGAGG + Exonic
1078636332 11:13053815-13053837 CTGAGCTACCACTTAGAGGGCGG + Intergenic
1078893683 11:15579590-15579612 CTCTGTGCCCACCTTGAGGGAGG - Intergenic
1083632824 11:64104521-64104543 CACTGCTACCACCTTTAGGGAGG - Intronic
1083638712 11:64133914-64133936 CTCAGCTGGGACCTGGAGGACGG + Intronic
1084267827 11:68014007-68014029 TTAAGTGGCCACCTTGAGGGCGG - Intronic
1085409837 11:76284413-76284435 CCCAGCGGCCACTTTGAAGGAGG - Intergenic
1085533651 11:77205738-77205760 CTCAACTGCCAGCTAGACGGAGG + Intronic
1086994389 11:93339850-93339872 CTCTGTTGCCACTTGGAGGGAGG - Intronic
1087175181 11:95089712-95089734 CTCTGCAGCCATCTTCAGGGAGG + Intergenic
1088764755 11:112963566-112963588 CTCCGCTGCCACCTGGGCGGGGG + Intronic
1089377476 11:118004845-118004867 CTCAGCTGCACCCTTGATGATGG - Intergenic
1091043112 11:132300872-132300894 CTCTGCTGCCACTTGGAGTGGGG + Intronic
1091231152 11:133988755-133988777 ACCAGTTGCCACCTTGGGGGTGG - Intergenic
1202813487 11_KI270721v1_random:37230-37252 CTCATTTGCCACATGGAGGGTGG + Intergenic
1091662090 12:2391904-2391926 CTCAGCTGCCACGTGGCTGGTGG + Intronic
1091670417 12:2448206-2448228 CTCCCCTGCCACCTTGAAGAAGG - Intronic
1091951107 12:4593720-4593742 CTCAGCTTTCACCTTAAGGCTGG - Intronic
1092161164 12:6316244-6316266 CTCAGCTGACACCTGGAGGAGGG - Exonic
1099081821 12:78193246-78193268 TCCAGCTGGCAGCTTGAGGGAGG - Intronic
1101483813 12:105130747-105130769 CCCAGCTGCCTCCTTGACTGGGG + Intronic
1102199632 12:111048433-111048455 CACAGCTCCCACCTTGCTGGGGG - Intronic
1103070471 12:117936989-117937011 CCCAGATACCACCTTGAGGCTGG - Intronic
1103240364 12:119408361-119408383 CCCAGCTGCCATCTTCAGTGTGG - Intronic
1103450281 12:121024089-121024111 CCCTTCTGCCACGTTGAGGGTGG + Exonic
1103807437 12:123584448-123584470 CGCAGCTGCCACGTAAAGGGAGG - Intergenic
1103843809 12:123887434-123887456 CTCAGGGGCCGCCGTGAGGGAGG - Intronic
1103947940 12:124537409-124537431 CACAGCTGCTCCCTTGTGGGAGG - Intronic
1104018746 12:124977548-124977570 GTCAGCTGCCACCTTCCTGGAGG - Intronic
1104674113 12:130701212-130701234 CTCAGCTCCCACCTGCTGGGGGG - Intronic
1107634622 13:42379736-42379758 CTCAGCTGACACCTTGATCTTGG - Intergenic
1108765887 13:53628990-53629012 CACTGCTGCCTCCTAGAGGGTGG - Intergenic
1109555939 13:63975917-63975939 CTCAGCAGCCACTTTGACAGTGG - Intergenic
1109690615 13:65883014-65883036 CTCAGCTACCACCACTAGGGTGG - Intergenic
1110436602 13:75482665-75482687 CTCTGCTGCCCCCTAGAGAGGGG + Intergenic
1110468001 13:75825390-75825412 GTCAGCTGCCACCCTGAGGGAGG - Intronic
1110891595 13:80704538-80704560 CTCAGTTCCCGCCTTGCGGGCGG - Intergenic
1110892415 13:80707579-80707601 CTCAGTTCCCGCCTAGAGGGCGG - Intergenic
1112283384 13:98082396-98082418 ATCAGTGGCTACCTTGAGGGAGG + Intergenic
1113613533 13:111664850-111664872 CCCAGCTGGCACCTTGAGTTTGG + Intronic
1116159296 14:41248427-41248449 GTTAGCTGCCACATTGTGGGAGG - Intergenic
1118819505 14:69335857-69335879 CCCAGAGGCCACCTTGAGTGGGG + Intronic
1121318359 14:92975381-92975403 CTCATCTGCCTCCATCAGGGAGG - Intronic
1122613655 14:103002219-103002241 CACACCTGCCACCTTGAGCGGGG - Intronic
1123023660 14:105413614-105413636 CTCTGCTGCCACCATGGGGGAGG - Exonic
1125602718 15:40924299-40924321 CTGAACTGCCACCATGAAGGAGG + Intergenic
1126753793 15:51904560-51904582 ATCACCTGCCTCCTGGAGGGAGG - Intronic
1127616340 15:60689895-60689917 CTCTGCTGCCACCTTGATTTTGG + Intronic
1128255301 15:66191681-66191703 TTCAGATGCCCCCTTGAGGAGGG + Intronic
1129194763 15:73957131-73957153 CTCAGCTGCAACTTTCAGGGTGG - Intergenic
1129694539 15:77733183-77733205 CTCAGCTGCCATCCTGTGGGTGG - Intronic
1129697408 15:77748476-77748498 CCCAGAGGCTACCTTGAGGGCGG - Intronic
1131829649 15:96345879-96345901 CGCAGCCGCCAGCTTGATGGCGG + Intergenic
1132636564 16:952695-952717 CCCAGCTGTCCCATTGAGGGCGG + Intronic
1132806557 16:1777696-1777718 CTCAGCTGTCACCCCGAGGGAGG - Intronic
1133611447 16:7437301-7437323 GGCAGCTCCCACTTTGAGGGTGG + Intronic
1134173847 16:11990346-11990368 AGCAGCTGCCATCTTGAGAGGGG + Intronic
1134538743 16:15047437-15047459 CTCACCTTCCACATTGAGCGTGG + Exonic
1137542750 16:49376412-49376434 CTCAGGTGACTCTTTGAGGGAGG + Intronic
1138607456 16:58098185-58098207 CTCACCTGCCCCCATGAAGGTGG + Intergenic
1139315160 16:66061405-66061427 GTCAGCTGGCAGCTTGAGGAAGG + Intergenic
1139752985 16:69120354-69120376 CTCCGCTGCCACCTCGAGGACGG - Exonic
1140973379 16:80035475-80035497 CTCAGTTGGAACCTTGAGGCTGG + Intergenic
1141369692 16:83475420-83475442 CTAAGCTGCCACTTGGAGAGAGG + Intronic
1141825703 16:86478329-86478351 CACAGCTGCCACCAAGATGGAGG + Intergenic
1142866172 17:2792766-2792788 CGCTGCTGCCACCCTGAGGCTGG - Intronic
1145062842 17:19743539-19743561 CTCAGCTGCCAGGGTGATGGGGG + Intronic
1145921659 17:28614348-28614370 TGCAGCTGCCACTCTGAGGGTGG - Intergenic
1147147029 17:38491338-38491360 CTCAGGTGCCAGAGTGAGGGAGG + Intronic
1147338005 17:39738597-39738619 CTCAGCTGCTGCCTGCAGGGAGG - Intronic
1147498300 17:40938235-40938257 CCCAGCTTCCACCATGAGGTGGG - Intergenic
1148833475 17:50452087-50452109 CTCTGCTGGCACCTTTAAGGTGG + Intronic
1148897343 17:50846489-50846511 CTAAGCTGCAACCTTCAGGAGGG + Intergenic
1149663112 17:58346372-58346394 CTCAGCTGCCACCTTGAGGGGGG + Intronic
1151556641 17:74850115-74850137 CTCAGATGCCCTCTAGAGGGGGG - Intronic
1152840763 17:82566674-82566696 CACAGCTGCCACCCTGAGGTTGG + Intronic
1157010974 18:43648199-43648221 CTCAGCTGCCTCCTACAGGATGG - Intergenic
1157198872 18:45642277-45642299 CTCAGCAGCCAACATGAGGCTGG + Intronic
1157566131 18:48680388-48680410 CCCAGCTGAGACCTTGAGGAAGG - Intronic
1160504376 18:79418788-79418810 CACAGCTGACACTTGGAGGGCGG + Intronic
1160928792 19:1560052-1560074 CTGAGCTGCCTCCCTGAGGCTGG + Intronic
1161153665 19:2721610-2721632 CCCAGCTCCCACCCCGAGGGAGG - Intronic
1162612824 19:11769192-11769214 CTCAGCTTCCATTTTGAGTGTGG - Intronic
1163077944 19:14912405-14912427 AACAGCTGCCACCTTGAGAGGGG - Intergenic
1163427820 19:17248641-17248663 TTCAGCTGCCACCCTGAAGGGGG + Intronic
1163787698 19:19284790-19284812 CTCATCTGCCACCTCTAGGTGGG - Intronic
1163862123 19:19748047-19748069 ATGAGCTGCCACCATGAGGCTGG - Intergenic
1164955272 19:32377731-32377753 ATCAACTGCCTCCTTGAGGGAGG - Intronic
1165498761 19:36170890-36170912 CTCTGCTGCCATCTTGTGGCGGG + Intergenic
1165798410 19:38532668-38532690 CAGAGCTGCCACCTGGAGGAGGG + Exonic
1166679877 19:44759594-44759616 CTCAGCTGCCTCCTGGAGCTGGG - Exonic
1166694497 19:44844929-44844951 CTCTGCTGCCCCCTGGCGGGTGG + Intergenic
1166719014 19:44986960-44986982 CACAGCTGCCCCCTTCAGTGGGG + Intronic
1167420636 19:49400929-49400951 CTTAGATACCACCTTGAGGTCGG - Intronic
925099597 2:1234076-1234098 CTGAGCGGCCACCATGAGGCGGG + Intronic
926628535 2:15116336-15116358 CTCAGCTGCCACCTTGATCTTGG - Intergenic
927473811 2:23396972-23396994 CTCACTTGTGACCTTGAGGGAGG + Intronic
927706478 2:25299415-25299437 CTCAGCCCCCACCTGGAGGAAGG - Intronic
928028823 2:27761642-27761664 CACACCTGCACCCTTGAGGGAGG - Intergenic
929589599 2:43136273-43136295 CTCAGCTGCTACCCACAGGGAGG + Intergenic
930334605 2:50029227-50029249 ATCAGCTGCCACCTTGATCATGG + Intronic
931567469 2:63629571-63629593 CTCCACTGCCACCAGGAGGGAGG - Intronic
933620972 2:84541095-84541117 TTCAGCTGCCTCCTAGAGAGTGG - Intronic
935219178 2:100997564-100997586 CACATATGCCACGTTGAGGGTGG + Intergenic
935609485 2:105006200-105006222 CCCTGCTGACACCTTGATGGTGG - Intergenic
936025915 2:109031218-109031240 CACTGCTGACACCTTGATGGTGG - Intergenic
940460774 2:153959954-153959976 CTCAGCTGCCACAGTGGGAGGGG + Intronic
946361334 2:219220834-219220856 CTCGGCTGCCTCTTGGAGGGTGG - Exonic
946366386 2:219251757-219251779 CACAGCTACCACCCTGGGGGAGG - Intronic
947319402 2:228899113-228899135 CCCAGCTGCCACCTTGATAAAGG + Intronic
948364914 2:237448552-237448574 CTCAGCACCCTCCTTGAGGAAGG - Intergenic
949028207 2:241776011-241776033 CTCAGCTGGCACCGACAGGGAGG + Intergenic
1169016514 20:2297145-2297167 CTCAGCCACCTCCTGGAGGGAGG - Intronic
1169197513 20:3691522-3691544 CTCAGCTGCCGCCTCCTGGGTGG - Exonic
1169415953 20:5416388-5416410 AGCAGCTGACACCTGGAGGGAGG + Intergenic
1171454224 20:25258348-25258370 CCTGTCTGCCACCTTGAGGGTGG - Intronic
1171990759 20:31694495-31694517 CTGAGCTGCCTCTTGGAGGGCGG + Intronic
1172055113 20:32149552-32149574 GTCAGCTGTCACCTTGGGGGTGG + Intronic
1174053488 20:47783353-47783375 CCCAGCTGCCCTCTTGAGGCAGG + Intronic
1174361314 20:50030348-50030370 CTCAGCAGACACCATCAGGGTGG - Intergenic
1174444639 20:50582462-50582484 CTCAGATGCCACCTGGAAAGAGG - Intronic
1176912078 21:14578319-14578341 ATCAGCACCCACCTTGAGAGTGG + Intronic
1178303390 21:31470928-31470950 CCCAGCTGCCCCCTCGGGGGTGG - Intronic
1178492947 21:33065084-33065106 TTCAGCTACTACCTTCAGGGAGG + Intergenic
1178760989 21:35402879-35402901 CCCTGCTGACACCTTGATGGTGG - Intronic
1180129920 21:45820736-45820758 CTCTGCTGCCACCTCGTGGCAGG + Intronic
1180260959 21:46668310-46668332 CTCAGCTGTCACCCTGGGTGTGG - Intergenic
1180957663 22:19748099-19748121 GTCAGCTGCCACCAGGTGGGGGG + Intergenic
1181298937 22:21865901-21865923 TTGAGCAGCCACATTGAGGGAGG - Intronic
1181311129 22:21945593-21945615 CGCAGCTGCCACCTTGATCTTGG + Intronic
1181778692 22:25178008-25178030 CTCAGCTTCCATCCTGCGGGAGG - Intronic
1182632272 22:31695782-31695804 CTCAACTCCAACCTTGAGGGAGG + Intronic
1183312087 22:37115719-37115741 CCCTGCTGCCACCTTGAGTTTGG - Intergenic
1184034089 22:41910403-41910425 CTCACCTGCGGCCTTGAGCGCGG + Exonic
1184370712 22:44080321-44080343 CCCTGCTGCCACCTTGATGTTGG - Intronic
1184657308 22:45948298-45948320 CACAGCTGGCACCTGGAGGGAGG + Intronic
1185215208 22:49595220-49595242 CACAGCTGCCAGCTTGAGGATGG - Intronic
951576199 3:24116745-24116767 GTGAGCTGTCATCTTGAGGGTGG + Intergenic
952145881 3:30531437-30531459 CTGAGCTGGCCCCCTGAGGGAGG - Intergenic
953553724 3:43925222-43925244 CCCAACTGCCACCTCCAGGGAGG - Intergenic
954328080 3:49874532-49874554 CTCAGCTGTCAGCTTGAATGGGG + Intergenic
954432474 3:50478215-50478237 CTCAGCTGCCAGCCTGGGGAGGG + Intronic
954580005 3:51698104-51698126 CTCAGCAGCCAGCTGAAGGGAGG - Intronic
956150992 3:66242043-66242065 CTTGGATGCCACCTGGAGGGTGG + Intronic
956761592 3:72448605-72448627 CACAGCTGCCTCCTTAGGGGAGG + Intergenic
959155153 3:102658198-102658220 CTCTCCTGCCACCTTGTGAGAGG - Intergenic
960634502 3:119769509-119769531 CTTAGCTGCAATCTTGAAGGAGG + Intergenic
961642835 3:128375620-128375642 CTCAGATGCCACCTCTAGGAAGG + Intronic
962414011 3:135166436-135166458 CTCAGCAGCCAGCAAGAGGGAGG + Intronic
963923820 3:150930495-150930517 CTCAGCTACCACTCTGAGGATGG - Intronic
965156824 3:165070855-165070877 CTCTGCTGACACCTTGAGTTAGG - Intronic
968776312 4:2542875-2542897 CTCAGCAGCCACCTCGATGAAGG - Intronic
971194261 4:24456955-24456977 CTGAACTGCCACCATCAGGGTGG - Intergenic
972333004 4:38080801-38080823 CTCAGCTGTCTCCTTAGGGGTGG + Intronic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
978174731 4:105716473-105716495 CTCACCTCCCACTTTGAGGTGGG - Intronic
979309729 4:119188419-119188441 CTCAGCTGACACCTTTAGAAAGG + Intergenic
981484746 4:145273584-145273606 CTCTGCTGCCACCTTGATCTTGG + Intergenic
982312955 4:154004532-154004554 CTCCACTGCCCCTTTGAGGGAGG - Intergenic
982418824 4:155169667-155169689 CCCAGCTGACACCTTGATTGTGG - Intergenic
982578986 4:157154063-157154085 CTTAGCTGAAACCTTCAGGGAGG + Intronic
985090264 4:186355383-186355405 CCCAGCTGCCACCTTGATTTTGG - Intergenic
985918306 5:2945385-2945407 CTCACCTGCCCTCTTGAGAGGGG - Intergenic
985993563 5:3583743-3583765 CTCTGCTGCCACCTTGAACTTGG + Intergenic
986584639 5:9301915-9301937 CTCTGCTACCACCTTGAGTTTGG - Intronic
987165477 5:15193754-15193776 CTCTGCTGACACCTTGACTGGGG + Intergenic
990683374 5:58271196-58271218 CTCAGCTGACTCCTTTAGGATGG + Intergenic
997481531 5:134188724-134188746 CTCAGCTGGGATCTTGGGGGTGG - Intronic
997587536 5:135052443-135052465 CTCAGCTGGCACCTGGAAGACGG - Exonic
997646758 5:135487195-135487217 CTCAGCAGCCTCCCTGATGGGGG + Intergenic
998149204 5:139747425-139747447 CCCAGCTGCCAGCTTGGCGGAGG + Intergenic
998443870 5:142183867-142183889 CTCAGCTGACACAGTGATGGTGG + Intergenic
999125872 5:149245352-149245374 CTCAGCTGCCATCAGGAGGGTGG + Intronic
1000955493 5:167537954-167537976 GTCAGCTTACACCTTAAGGGAGG + Intronic
1002534947 5:179870879-179870901 CGCAGCAGCCACCTTGAGCACGG + Intronic
1002813404 6:656594-656616 CTCCACCGCCACCGTGAGGGAGG + Exonic
1003097170 6:3151458-3151480 CTCAGCCACCACATTGGGGGTGG - Intronic
1003617513 6:7669020-7669042 CTCAGCTGTCACCTTGATCTTGG - Intergenic
1005666691 6:28064639-28064661 CCCTGCTGACACCTTGAAGGAGG - Intergenic
1006781803 6:36637267-36637289 TTCAGCTGCTGCCTGGAGGGAGG - Intergenic
1007216982 6:40248025-40248047 CTCCTCAGCCACCATGAGGGAGG - Intergenic
1007711130 6:43825239-43825261 CTCAGCCCCCAACTTGAGTGGGG + Intergenic
1011364721 6:86569437-86569459 CTCAGCTGTCAAATGGAGGGAGG - Intergenic
1013187931 6:107777795-107777817 CCCAGCTGCCACCTGTGGGGAGG - Intronic
1013196080 6:107846502-107846524 CCCTGCTGACACCTTGAGTGTGG + Intergenic
1014934093 6:127366008-127366030 CTCAGCTGCCATATTGTGAGAGG + Intergenic
1015978270 6:138813518-138813540 CTCATCTCCTACCTTAAGGGAGG + Intronic
1017261154 6:152389361-152389383 CACTGGTGCCTCCTTGAGGGTGG - Intronic
1018887939 6:167957146-167957168 CTCAGATGCCACCTTTCTGGGGG + Intronic
1019817180 7:3209898-3209920 CACTGGTGTCACCTTGAGGGTGG - Intergenic
1019931051 7:4223412-4223434 CCCTGCTGCCACCTTGACTGTGG - Intronic
1020070369 7:5223350-5223372 TTCAACAGCCACCTTCAGGGAGG - Intronic
1020188416 7:5975844-5975866 CTCAGCTGCCATCTAAAAGGTGG - Intronic
1020294499 7:6748925-6748947 CTCAGCTGCCATCTAAAAGGTGG + Intergenic
1020545906 7:9529844-9529866 CTGTGCTGCGACCTTGAGTGTGG + Intergenic
1021255461 7:18386949-18386971 ATGAGCTGCCACATTGCGGGAGG - Intronic
1022585315 7:31603285-31603307 CCCAGCTGCCACGGGGAGGGAGG - Intronic
1023078654 7:36507336-36507358 CTCAGCTGCCTCCTGGAGCTGGG - Intergenic
1029107443 7:98189829-98189851 CACAGCTGCCAGCGTGATGGGGG + Intronic
1032840326 7:135708239-135708261 CTCCGCCGCCACCTGTAGGGAGG + Exonic
1033595150 7:142854191-142854213 CTCAGCTGGCGCCTGGAGGCAGG - Intergenic
1035123122 7:156585504-156585526 CTCACCTACCACCTGCAGGGAGG + Intergenic
1038493327 8:27985232-27985254 CTCAGCTCCCACCTTCTGCGAGG - Intronic
1038779443 8:30557637-30557659 CTCCTCTGCCACCCTGCGGGAGG + Intronic
1041308244 8:56485825-56485847 CTCAGCTGACACCTAAGGGGAGG - Intergenic
1042689762 8:71484819-71484841 CTCAGCTGCCAGATGGAAGGAGG - Intronic
1044712076 8:95067828-95067850 CTCCGCTGACACCATGGGGGTGG + Intronic
1046814527 8:118569748-118569770 CTCAGCTGGCACCTTGATCTTGG + Intronic
1047235458 8:123038464-123038486 CTCAGCTGCCAGCAGGAGGCAGG - Intronic
1048611197 8:136025057-136025079 CTCAACTGCCAACTTGGGGCAGG + Intergenic
1049660469 8:143817558-143817580 CACAGCTGTCGGCTTGAGGGTGG - Intronic
1050525650 9:6544066-6544088 CTCAGCAGCCGCCTTGAGGATGG - Intronic
1055818400 9:80233328-80233350 CTAATCTGCCATCTTGGGGGGGG + Intergenic
1056381990 9:86064070-86064092 CTCACCTCCCACCTCCAGGGAGG - Intronic
1056699397 9:88889551-88889573 CTCAGCTGGCAGCCTGTGGGCGG + Intergenic
1058286584 9:103187124-103187146 CTTAGCTGCCTCCCTGCGGGGGG + Intergenic
1058876627 9:109250263-109250285 CACAGCTGGTACCTGGAGGGAGG + Intronic
1059083980 9:111280269-111280291 CGCTGGGGCCACCTTGAGGGTGG - Intergenic
1059664946 9:116437691-116437713 CTCAGCTGCCATCTTGCCTGTGG - Intronic
1062183616 9:135204573-135204595 CTCTGCTGACACCTTGAGCTGGG - Intergenic
1062301749 9:135877300-135877322 CTCATCTGCCATCTTCACGGTGG - Intronic
1185477905 X:425921-425943 CTCTGCGGCCTCGTTGAGGGGGG + Intergenic
1189689897 X:43605081-43605103 CACAGCTGACACCTTGATTGAGG + Intergenic
1189794407 X:44633743-44633765 CTCCGCTGCCACCTCAAGGATGG + Intergenic
1191843924 X:65532403-65532425 CTCAGCTTCCAGCCTGAAGGAGG - Intronic
1192767180 X:74152659-74152681 CACAGGTGCCTCCTTGAGGGTGG + Intergenic
1194568540 X:95523215-95523237 CTCCACTCCCAGCTTGAGGGGGG + Intergenic
1198221339 X:134605200-134605222 CTCAGCTGCCAGCTTAGGGAAGG + Intronic