ID: 1149663303

View in Genome Browser
Species Human (GRCh38)
Location 17:58347919-58347941
Sequence AGGGCCTAGTGCAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149663295_1149663303 12 Left 1149663295 17:58347884-58347906 CCAATAGTTACAACTAACACAAC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1149663303 17:58347919-58347941 AGGGCCTAGTGCAAAGAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149663303 Original CRISPR AGGGCCTAGTGCAAAGAGGA GGG Intronic
901347638 1:8560481-8560503 ATGGCCTACTGGAAAGAAGATGG + Intronic
902802065 1:18836728-18836750 AGGCCCTAGAGCAAAGAGCTGGG - Intergenic
902894015 1:19466299-19466321 CTGGTCTAGTGCAAAGAGTAAGG - Intronic
903582723 1:24384230-24384252 AGGGCATAGTGGAAAGAGCAAGG - Intronic
906525616 1:46491481-46491503 AGGGCGTTGGGGAAAGAGGAGGG + Intergenic
906612294 1:47211990-47212012 AGGGGCTGGTCCAAAGGGGAGGG + Intergenic
908512391 1:64859906-64859928 AGGGGCTGCTGCAAAGAGGATGG + Intronic
909225464 1:73015010-73015032 AGGGCCTAGGGCCTAGGGGAGGG + Intergenic
910106195 1:83633624-83633646 AGGGCATGGTGCAAAGAAGCGGG + Intergenic
910143127 1:84049160-84049182 AGGCCCTAGTAGAAAAAGGAAGG + Intergenic
910760137 1:90725039-90725061 AGGGCCGAGTGCGCAGCGGAGGG - Intergenic
911183973 1:94885482-94885504 ATGGCTTAGTGGAAAGAGGCTGG - Intronic
913966430 1:143381214-143381236 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
914060804 1:144206821-144206843 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
914118346 1:144759548-144759570 AGGGCCCAGTCCAAGGAGAAGGG - Intergenic
915176097 1:154016352-154016374 AGTGCTTTGGGCAAAGAGGAAGG + Intronic
915465521 1:156095675-156095697 AGGGCCTAGTACAAGGATGTTGG - Intronic
920316161 1:205076972-205076994 AGGGCCTCCTGGAATGAGGAAGG - Exonic
920560854 1:206937357-206937379 AGGGCCCAGGGCACAGTGGAAGG + Exonic
921050640 1:211508931-211508953 GGGGCCTAGTTCCAAGAGGAGGG + Intergenic
922117655 1:222629962-222629984 AGGGCATAGTGACAAGAGGGAGG + Exonic
922725081 1:227918873-227918895 AGGGCCTGGTGCAGAGAAGGTGG + Exonic
923151489 1:231237472-231237494 TGGGCCTAAAGCAAAGAGGAAGG + Intronic
924943257 1:248826726-248826748 AGGGCCTAGGCCTAAGGGGAAGG + Intergenic
1062977032 10:1691451-1691473 AGGTCCAAGTGCAGAGAAGAAGG - Intronic
1063699203 10:8368380-8368402 AGGGCCTATTGGAAGGTGGAAGG + Intergenic
1066138216 10:32473605-32473627 AGAGACTAGTGAAAAGAAGAAGG + Intronic
1067790715 10:49285488-49285510 AGGGCCTGGGGGAAGGAGGATGG + Intergenic
1069718948 10:70538081-70538103 AGGGCCCGGTGGAAAGAGGTGGG - Intronic
1071559807 10:86636373-86636395 AGTTCTTAGTGAAAAGAGGAGGG - Intergenic
1071796352 10:89010579-89010601 AACACCAAGTGCAAAGAGGAAGG + Exonic
1073565045 10:104527878-104527900 AGGGCAGAGAGGAAAGAGGATGG - Intergenic
1074600392 10:114907978-114908000 AGGGCTTAGTCCAAAGGGGAAGG + Intergenic
1076432543 10:130416052-130416074 AGGGCAGAGTACACAGAGGAGGG - Intergenic
1076432587 10:130416444-130416466 AGGGCAGAGTACACAGAGGAGGG - Intergenic
1076432636 10:130416906-130416928 AGGGCAGAGTACACAGAGGAGGG - Intergenic
1077162855 11:1121533-1121555 AGGGGCCAGTGCACAGAGGATGG + Intergenic
1077295117 11:1822917-1822939 AGGCCCTAGGGTAGAGAGGAGGG - Intergenic
1077318478 11:1929568-1929590 AGGGCCTGGGGCCAGGAGGAAGG - Intronic
1077547809 11:3183428-3183450 AGGGCCTAGTGGAAAGCGTTTGG - Intergenic
1078673098 11:13382403-13382425 AGGACCTCGTGCAAAGATGCTGG - Intronic
1080897355 11:36457696-36457718 AGGGGTTTGTGCAAAGGGGAGGG - Intronic
1081231807 11:40594107-40594129 AGGGACTATTGCAATGACGAGGG - Intronic
1084440057 11:69167657-69167679 AGATGCTAGTGCATAGAGGAGGG + Intergenic
1085688829 11:78649490-78649512 AGGGCTGAGTGAAGAGAGGAAGG - Intergenic
1087261528 11:96017700-96017722 AGAGCCTTGTGCACAGTGGAGGG + Intronic
1088700545 11:112407565-112407587 AGGGCTTACAGAAAAGAGGATGG + Intergenic
1088944955 11:114502385-114502407 AGAATATAGTGCAAAGAGGATGG - Intergenic
1090636984 11:128695281-128695303 AGGGCCAGGAGCAGAGAGGAGGG + Intronic
1091203432 11:133800461-133800483 AGGACCTATTGCTAACAGGATGG + Intergenic
1095946087 12:47754191-47754213 AGGGCATAATGCTAAGAGCATGG - Intronic
1095999878 12:48120113-48120135 AGTGACTAGGGCAAATAGGAAGG - Intronic
1096112431 12:49037483-49037505 AGGGCCTGGTGCAGACAGTAGGG + Exonic
1096815612 12:54200073-54200095 AGGGCCTTGTGGGAAGAGGGAGG + Intergenic
1096907665 12:54949948-54949970 AGGCCCAAGTGAAGAGAGGAAGG - Intronic
1097069041 12:56341428-56341450 AGGGGCTACTCCAAACAGGAAGG + Intergenic
1097263523 12:57733044-57733066 AGGGCCCAGTGCAAGGATAAGGG - Intronic
1097613866 12:61860588-61860610 AGAGCAAAGAGCAAAGAGGATGG - Intronic
1101135469 12:101739178-101739200 AGGGCCTAGTGGAAAGCGGGCGG - Intronic
1102283348 12:111635596-111635618 AGGGCGCAGTGGAAACAGGATGG - Intergenic
1103727516 12:123005401-123005423 ATGGCCCAGTTCAATGAGGATGG - Exonic
1104165069 12:126219897-126219919 AGGGACTTGGGCAAAGAGTAGGG + Intergenic
1104535502 12:129614363-129614385 ATGCCCTGCTGCAAAGAGGACGG + Intronic
1105068663 12:133220618-133220640 AGGCCCTAGTGTAGAGAGGATGG + Intronic
1105581196 13:21698156-21698178 AGGGCCTGGTCCCAAGAGGGTGG + Intronic
1105612095 13:21977632-21977654 AGGGCATAGCGGAAAGAGGGAGG + Intergenic
1107602725 13:42029884-42029906 AGCGCTTAGTGAAAAGAGCATGG - Intergenic
1108500234 13:51063746-51063768 AGAGCCCAGTGCCAACAGGAAGG + Intergenic
1114265669 14:21071313-21071335 AGCGCCCACTGCAAAGAGGGCGG + Intronic
1118133029 14:62988996-62989018 AGGTAATAGTGAAAAGAGGATGG - Intronic
1118178233 14:63464070-63464092 AAGGTCTAGTGCAAAGGGAATGG + Intronic
1118386432 14:65259154-65259176 AGGGCATAGAGCAAGGAGGTGGG - Intergenic
1118840368 14:69505442-69505464 ATGGCCTAGTGATAAGATGAAGG + Intronic
1119062676 14:71492131-71492153 AGGGCTGAGTGCAAAGAGGGTGG + Intronic
1119644711 14:76339911-76339933 GGGGCTGAGTGCACAGAGGAGGG + Intronic
1121176875 14:91897131-91897153 AGAACCTAGTGCCAAGATGACGG + Intronic
1121345903 14:93135756-93135778 AAGGTCTAGTGGGAAGAGGAGGG + Intergenic
1122124520 14:99571926-99571948 AGGGCCTAGCTCAATGAGGCAGG - Intronic
1125090401 15:35784264-35784286 AATGCCTAGTGGAAAGAGGATGG - Intergenic
1126352846 15:47763221-47763243 AGGGCCAACTGCAGAGAGGTGGG + Intronic
1126977893 15:54206232-54206254 AGTGACTAGTGCAAAGAGAAGGG - Intronic
1129952815 15:79607088-79607110 AGGGCCAGGTCCAAGGAGGAAGG - Intergenic
1130754122 15:86744689-86744711 AGGACTCAGTGCAAAGAGGGAGG - Intronic
1131856700 15:96604896-96604918 AGAGTGTAGGGCAAAGAGGAGGG + Intergenic
1138440270 16:57030115-57030137 TGGGCCTTGAGAAAAGAGGAGGG + Intronic
1138532837 16:57644087-57644109 GGGGCACAGTGCAAAGAGCAGGG - Intronic
1139342614 16:66278327-66278349 AGGGCCTTGTGCAAGAAGGGTGG - Intergenic
1140198758 16:72877782-72877804 AGGGCTGACTGCAAGGAGGAGGG - Intronic
1141678346 16:85529575-85529597 GGGGGCTAGAGCAAATAGGAGGG - Intergenic
1141802157 16:86317399-86317421 ACGGCCAAGTGCAAAGGGCAGGG + Intergenic
1142784884 17:2213404-2213426 AGGGCCTAGCGCTGAGAGGCCGG - Intronic
1144314626 17:14048256-14048278 AGGACCTTGTGCCAAGAGAATGG - Intergenic
1144321071 17:14120467-14120489 AGGGCATATTTCAAGGAGGAAGG + Intronic
1144405356 17:14947799-14947821 AGGGCCTGGTGGAGAGAAGAAGG - Intergenic
1146888071 17:36485674-36485696 AGGGCCCAGTGCAGGTAGGATGG + Intergenic
1147136143 17:38435141-38435163 AGGGGATAGAGCAGAGAGGAAGG + Intronic
1147328295 17:39680796-39680818 AGAGCCTAGTGAAAAGAGAAGGG - Intronic
1147357013 17:39906105-39906127 AGGATCTAGAGCAAAGAGTAAGG - Exonic
1148354295 17:46965170-46965192 AGGGCCCAGGGCATAGTGGAAGG + Intronic
1149351695 17:55795065-55795087 AGGCACTGGTGAAAAGAGGAGGG - Intronic
1149663303 17:58347919-58347941 AGGGCCTAGTGCAAAGAGGAGGG + Intronic
1150225473 17:63522643-63522665 AGGGCCTGGTCCTGAGAGGAGGG - Intergenic
1150979345 17:70124229-70124251 AGGGCCTGGAGCAAGGAGGGAGG - Intronic
1151366055 17:73617195-73617217 GGGGCCTCCTGCAGAGAGGAGGG + Intronic
1151403594 17:73872304-73872326 ACTACCCAGTGCAAAGAGGAGGG - Intergenic
1153432293 18:5030946-5030968 ACGTCCTAGTTCAAAGAGGAAGG + Intergenic
1155495694 18:26439643-26439665 AGGGGCTAGTGCCAAGTGCAGGG + Intergenic
1156182001 18:34615744-34615766 AGGGCCTACTTCAGAGTGGAGGG - Intronic
1157035179 18:43963249-43963271 AGTCCCTAGTGCAATGAGGAAGG + Intergenic
1157291895 18:46415583-46415605 AGGGCCTAGTGCACCAGGGAGGG - Intronic
1157431151 18:47627563-47627585 AGGGCCTTATTGAAAGAGGAAGG - Intergenic
1164564287 19:29314877-29314899 AGGGACTAGAGCTCAGAGGAAGG - Intergenic
1165325483 19:35112038-35112060 AGGGCCTGGTGCATAGTGGGTGG - Intergenic
1165388297 19:35524520-35524542 AGGGCAGGGTGCAAAGGGGAGGG + Intronic
1167464904 19:49645566-49645588 AGGGCCTAGTGTGCAGTGGAAGG + Intronic
1168286842 19:55339500-55339522 AGGTCCAAGTGGAAAGAGGGCGG - Intergenic
1168318569 19:55494862-55494884 GGGGCCTCTTGCAAAGAGAAAGG + Intronic
1168654683 19:58118450-58118472 GGGGCCTAGTGCGACGAGGGCGG + Intergenic
1202700212 1_KI270712v1_random:158709-158731 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
925921183 2:8639053-8639075 AGGGCCCAGTTCCAGGAGGAAGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927068679 2:19501712-19501734 AGGAGCAAGTGCAAAGGGGAAGG - Intergenic
927340436 2:21977868-21977890 AGGGCCCAATGGAAATAGGATGG + Intergenic
927913418 2:26917544-26917566 GGGGGGTGGTGCAAAGAGGATGG + Intronic
927987941 2:27426598-27426620 AGGACCTAGTTGAAAGCGGAAGG + Intergenic
928920340 2:36520373-36520395 AGGGCCTAGTGTGAACAAGAGGG + Intronic
929183770 2:39071258-39071280 AGGGTTTAGTGGAAAGAGGCAGG - Intronic
933716039 2:85361623-85361645 GGGGCCTATTGGAAAGTGGAGGG + Intronic
934171144 2:89542184-89542206 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
934281450 2:91616502-91616524 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
934924312 2:98371293-98371315 AGGGCCCAGTGCAGGGAGGTGGG - Intronic
936010690 2:108923509-108923531 AGGGACTGGTGCAGAGAGCACGG + Intronic
941036079 2:160570628-160570650 TGGACCTAGTGCACAGAAGAAGG - Intergenic
944818983 2:203409892-203409914 AGTGCTTAGTGGAAAGAGGTTGG - Intronic
944848712 2:203695111-203695133 AGGCCCCAGGGGAAAGAGGAGGG + Intergenic
945835080 2:214830051-214830073 AGTGCTTAGGGTAAAGAGGAAGG - Intergenic
946359238 2:219209244-219209266 TGGGCCTAGAGCAAAGAGAGGGG - Exonic
946410255 2:219511965-219511987 AGGGCCTGGTGAGAAGCGGAGGG + Intergenic
948416553 2:237810619-237810641 AGGGCATTGAGCAAGGAGGAGGG + Intronic
1169825645 20:9765745-9765767 AGGTTCTACTGCAAATAGGAAGG + Intronic
1170601650 20:17846040-17846062 AGTGTCTGGTGCCAAGAGGAGGG - Intergenic
1172595469 20:36148332-36148354 AGGAGTTGGTGCAAAGAGGAAGG + Intronic
1172633694 20:36395041-36395063 AGGGACTGGTGCAAGGAGGCTGG - Intronic
1173534559 20:43799726-43799748 AGGGTCAAGTTCTAAGAGGAGGG - Intergenic
1175329341 20:58152318-58152340 AGGGCCCTATTCAAAGAGGAGGG - Intronic
1175363738 20:58435909-58435931 ATGGCATAGTGAAAAGAGCATGG + Intronic
1175578682 20:60081875-60081897 AGGGCCCACTGGAAAGACGATGG + Intergenic
1175725090 20:61312678-61312700 AGTGACGTGTGCAAAGAGGAAGG - Intronic
1179409427 21:41150973-41150995 AGGTCCTGGTGCACACAGGAAGG - Intergenic
1179463003 21:41550346-41550368 AGGACCTATTGCAATGGGGAAGG + Intergenic
1180782345 22:18528380-18528402 AGGGCCTAGAGCAGAGATGCGGG - Intronic
1181125898 22:20702407-20702429 AGGGCCTAGAGCAGAGATGCGGG - Intergenic
1181239234 22:21467715-21467737 AGGGCCTAGAGCAGAGATGCGGG - Intergenic
1181260771 22:21595549-21595571 TGGTCGTAGTGCACAGAGGAGGG + Intronic
1184421173 22:44383771-44383793 GGGGCCAAGGGCAAAGGGGAGGG - Intergenic
949354802 3:3168467-3168489 ATGAACTAGTGCAAACAGGAAGG + Intronic
951326985 3:21314174-21314196 AGGTGATAGTGCTAAGAGGAGGG + Intergenic
952252169 3:31665647-31665669 AGGGTACAGTGGAAAGAGGAGGG - Intronic
953243197 3:41167698-41167720 AGTGCCTAGTGAAAAGAAGAGGG + Intergenic
955057429 3:55469056-55469078 AGGGCTCAGTGTGAAGAGGAAGG + Exonic
956420897 3:69085438-69085460 GGGCCCTAGGGGAAAGAGGACGG + Intronic
956845995 3:73183493-73183515 AGGGCATAGAGCAGAGTGGAGGG - Intergenic
958190988 3:90184950-90184972 AGGCCCTTCTTCAAAGAGGATGG - Intergenic
958413191 3:93844080-93844102 AGGCCCTTCTTCAAAGAGGATGG - Intergenic
958615405 3:96487780-96487802 AGGGCCTAGTGGACGGTGGAGGG - Intergenic
961910635 3:130312723-130312745 AGGGCCTACTGGAAGGTGGAGGG + Intergenic
962328675 3:134457939-134457961 AGGGGCTAGTGCTCACAGGATGG + Intergenic
965036716 3:163449335-163449357 AGGGCCTACTTGAAAGTGGAGGG + Intergenic
966976086 3:185084643-185084665 AGGGCTCAGAGCAGAGAGGAAGG - Intronic
969028620 4:4193704-4193726 AGGGCCCAGTCCAAGGAGAAGGG - Intronic
969998542 4:11340404-11340426 AGGGGCAAGTGCAAAGGGTATGG - Intergenic
970049816 4:11901095-11901117 AGGGCAGAGTGCACAGAGAATGG - Intergenic
970875374 4:20862957-20862979 GGGGCCTAGTGGAATGTGGAGGG + Intronic
971645482 4:29195306-29195328 AGGGCCTAGAGTAAAGAAAATGG - Intergenic
972638480 4:40905084-40905106 AGGCCCTTCTACAAAGAGGACGG + Intronic
972919267 4:43917972-43917994 GGGGCCTAGAGCAAGGAGGTTGG + Intergenic
973627018 4:52783093-52783115 GGGGTCTAGTGCAAAGTGGAAGG - Intergenic
975946416 4:79710944-79710966 GGGGCCTATTGCAAGGTGGAGGG - Intergenic
977573404 4:98653288-98653310 AGGGCTTAATTCAGAGAGGAGGG - Intronic
978351367 4:107824380-107824402 CGGGCCTAGGTCAAAGAGGTGGG - Intergenic
979018222 4:115461723-115461745 AGGGCCTATTGTAAGGTGGAGGG + Intergenic
980398864 4:132253431-132253453 AGGGCCTATTGGAAGGTGGAGGG - Intergenic
981729517 4:147883058-147883080 TGGGAGTAGTGCAGAGAGGAAGG + Intronic
984333269 4:178354693-178354715 ATGACTTGGTGCAAAGAGGAAGG + Intergenic
985537101 5:471631-471653 AGGGCTTGCTGCATAGAGGATGG + Exonic
985695090 5:1335627-1335649 AGGGCCTAAAGCACAGAGCAGGG + Intronic
987905076 5:24066334-24066356 AGGGCCTATTGGAGAGTGGAAGG - Intronic
990140258 5:52694951-52694973 AGAGCCTAGTGAAAGGAGAAAGG - Intergenic
993084104 5:83341673-83341695 ATGGCCTAGTGTAAAGGGTATGG + Intronic
993913278 5:93709969-93709991 AGGGCCTAGTTAATACAGGAAGG + Intronic
998696938 5:144651677-144651699 AGGTCCTAGGGCAATTAGGAAGG + Intergenic
999748364 5:154608876-154608898 AGGGCTGAGATCAAAGAGGAGGG - Intergenic
999748429 5:154609248-154609270 AGAGCCTGGTGCATAGAGGGGGG + Intergenic
1001087089 5:168708160-168708182 AGGGCCCAGAGCAGAGGGGAAGG - Intronic
1001609130 5:172985738-172985760 AGGGCTAAGTGGAAACAGGATGG - Intronic
1002453536 5:179332734-179332756 AGGGAGGAGTGCAGAGAGGAAGG + Intronic
1003064281 6:2890057-2890079 AAAGCCAAGTGCAAAGATGAGGG - Exonic
1003468841 6:6409553-6409575 AATGCCCAGTGCAAAGGGGAGGG - Intergenic
1004608132 6:17213096-17213118 AGGGCCTTGGGAAAAGAGAAGGG - Intergenic
1005111391 6:22285706-22285728 AGGGGGTAGAACAAAGAGGAAGG - Intergenic
1005159598 6:22843599-22843621 ATGGCAGAGGGCAAAGAGGAAGG - Intergenic
1005821163 6:29600665-29600687 AGTGCCCAGTGCAAAGGGGTGGG - Intronic
1006856164 6:37134673-37134695 AGGGCCTGGTGCAATGTGGCTGG + Intergenic
1012046349 6:94279723-94279745 GGGGCCTAGTGGAAAGTGGTTGG + Intergenic
1012145393 6:95673965-95673987 AGGGCATACTGGGAAGAGGAGGG - Intergenic
1013282082 6:108647996-108648018 AGAGCTAAGTGGAAAGAGGAGGG + Intronic
1016886312 6:148963100-148963122 AGGGCCCAGGGCACAGAGGAGGG + Intronic
1018156255 6:160988047-160988069 AGGGCCTATTGGAAGGTGGAGGG + Intergenic
1019119712 6:169793091-169793113 AGAGTCTACTGTAAAGAGGAAGG + Intergenic
1022737316 7:33088423-33088445 GGGGCCTATTGGAGAGAGGAGGG - Intergenic
1023298863 7:38746556-38746578 AGGGCCATGTGTACAGAGGAGGG + Intronic
1023528912 7:41133560-41133582 ATGGCCAAGTGCACAGAAGAAGG + Intergenic
1025689048 7:63744422-63744444 TGGGCCTCCTGCAAAGAGGCAGG - Intergenic
1027560633 7:79724492-79724514 ATGGCCTACTTCAAAGAAGAAGG + Intergenic
1032016851 7:128385540-128385562 AGGGCCTGGGGTGAAGAGGAGGG + Intergenic
1035449342 7:158965639-158965661 ATGGCAGAGGGCAAAGAGGAAGG - Intergenic
1037058936 8:14482415-14482437 AGGCACAAGTGTAAAGAGGAAGG - Intronic
1037521730 8:19686446-19686468 AGCGAGCAGTGCAAAGAGGAAGG - Intronic
1039113985 8:34071772-34071794 AGGGACTAGGGCAAAGATTACGG + Intergenic
1040672760 8:49712452-49712474 AGGGCCTATTGGAAGGTGGAGGG + Intergenic
1042751664 8:72164088-72164110 AGGGCCTACTGGAAGGTGGAGGG - Intergenic
1042764228 8:72302852-72302874 AGGGCCTACTGGAAGGTGGAGGG - Intergenic
1043355830 8:79411512-79411534 AGGGCCTACTGGAGAGTGGAGGG + Intergenic
1044769179 8:95611346-95611368 AGGGCCTACTTGAGAGAGGAAGG - Intergenic
1045778974 8:105841258-105841280 AGGGCATAGTGCAAAGGAGAAGG - Intergenic
1047169119 8:122473475-122473497 AGGGCCTACTGGAAGGTGGAGGG + Intergenic
1049278483 8:141731890-141731912 TGGGCCTGGTGCAGAGGGGATGG + Intergenic
1049474138 8:142789112-142789134 AGGCCCTAGAGAACAGAGGAGGG - Intergenic
1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG + Intronic
1052395638 9:27934809-27934831 ATGGCAGAGTGGAAAGAGGATGG + Intergenic
1053073173 9:35112883-35112905 AGGGACTAGGGGGAAGAGGAAGG - Intronic
1057746147 9:97752873-97752895 TGGGCCCATTGCACAGAGGAGGG - Intergenic
1058920844 9:109613243-109613265 AGGGCCCAGTGCAAAATGAAGGG + Intergenic
1059264937 9:113018616-113018638 GGGGCCTACTGCAGAGTGGAGGG + Intergenic
1062080115 9:134619290-134619312 GGGGCTTAGTGCTGAGAGGATGG + Intergenic
1062444392 9:136587601-136587623 AGGGCCCATTTCAGAGAGGAGGG - Intergenic
1185941410 X:4324089-4324111 AGGGCTGAATGCAAATAGGATGG - Intergenic
1188726714 X:33593272-33593294 GGGGCCTACTGCAGAGTGGAGGG + Intergenic
1189406178 X:40726226-40726248 AGGGTATAGGGCACAGAGGATGG - Intronic
1189548516 X:42069407-42069429 AGGGCCTGTTGGAGAGAGGAGGG + Intergenic
1191777097 X:64826511-64826533 AGGGACTGGGGGAAAGAGGAAGG + Intergenic
1192244356 X:69360470-69360492 TGGGGCTAGGCCAAAGAGGAGGG + Intergenic
1193099638 X:77594190-77594212 AGGGCCTGGTGGGAAGGGGATGG - Intronic
1194018626 X:88658613-88658635 AGGGGCTAGAGAAAAGAGGAAGG + Intergenic
1195141355 X:101963760-101963782 AGGGCCAAGAGTAGAGAGGAAGG + Intergenic
1195861215 X:109385340-109385362 GAGGAATAGTGCAAAGAGGAAGG + Intronic
1196762695 X:119213820-119213842 AGAGCTTGGTGCATAGAGGATGG + Intergenic
1197099100 X:122630393-122630415 AGGGCCTAGGGAAATGAGAATGG - Intergenic
1202017426 Y:20425256-20425278 AGGGCTGAGAGGAAAGAGGAGGG + Intergenic