ID: 1149665591

View in Genome Browser
Species Human (GRCh38)
Location 17:58362933-58362955
Sequence AACCTCATCCAGCGGCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149665591_1149665604 21 Left 1149665591 17:58362933-58362955 CCAGTGAGCCGCTGGATGAGGTT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1149665604 17:58362977-58362999 AATCAGGGGTCATGGATCAGGGG 0: 1
1: 0
2: 0
3: 13
4: 144
1149665591_1149665605 27 Left 1149665591 17:58362933-58362955 CCAGTGAGCCGCTGGATGAGGTT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1149665605 17:58362983-58363005 GGGTCATGGATCAGGGGACCAGG 0: 1
1: 0
2: 7
3: 50
4: 290
1149665591_1149665595 5 Left 1149665591 17:58362933-58362955 CCAGTGAGCCGCTGGATGAGGTT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1149665595 17:58362961-58362983 CCAGTAGAGAAGCCCCAATCAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1149665591_1149665597 7 Left 1149665591 17:58362933-58362955 CCAGTGAGCCGCTGGATGAGGTT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1149665597 17:58362963-58362985 AGTAGAGAAGCCCCAATCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 123
1149665591_1149665596 6 Left 1149665591 17:58362933-58362955 CCAGTGAGCCGCTGGATGAGGTT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1149665596 17:58362962-58362984 CAGTAGAGAAGCCCCAATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 114
1149665591_1149665598 13 Left 1149665591 17:58362933-58362955 CCAGTGAGCCGCTGGATGAGGTT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1149665598 17:58362969-58362991 GAAGCCCCAATCAGGGGTCATGG 0: 1
1: 0
2: 0
3: 12
4: 123
1149665591_1149665603 20 Left 1149665591 17:58362933-58362955 CCAGTGAGCCGCTGGATGAGGTT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1149665603 17:58362976-58362998 CAATCAGGGGTCATGGATCAGGG 0: 1
1: 0
2: 1
3: 11
4: 147
1149665591_1149665606 28 Left 1149665591 17:58362933-58362955 CCAGTGAGCCGCTGGATGAGGTT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1149665606 17:58362984-58363006 GGTCATGGATCAGGGGACCAGGG 0: 1
1: 0
2: 0
3: 22
4: 229
1149665591_1149665602 19 Left 1149665591 17:58362933-58362955 CCAGTGAGCCGCTGGATGAGGTT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1149665602 17:58362975-58362997 CCAATCAGGGGTCATGGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149665591 Original CRISPR AACCTCATCCAGCGGCTCAC TGG (reversed) Intronic
901191122 1:7410331-7410353 ACCCTCACCCAGCAGCTCAGGGG - Intronic
902602862 1:17551875-17551897 AACCCCAGGGAGCGGCTCACTGG + Intronic
906696534 1:47827181-47827203 AAACTCAGCCTCCGGCTCACAGG + Intronic
911748295 1:101465944-101465966 ACCCTGATCCAGAGGCTCCCAGG - Intergenic
915893283 1:159791167-159791189 AACCTCATCCAGTGGGTAGCAGG + Intergenic
915942495 1:160127665-160127687 CACTTCATCCAGCTGATCACAGG + Exonic
918514462 1:185347153-185347175 AACATCACCCAGCCCCTCACTGG - Intergenic
920493852 1:206440095-206440117 AGCCTGATCCAGCTGTTCACTGG - Intronic
921793121 1:219312467-219312489 ATCCTCATGCAGCTGCTCATTGG - Intergenic
1069855651 10:71439586-71439608 AGCCTCACCCAGTGACTCACAGG + Intronic
1077037068 11:500334-500356 AACATCAGCCAGAGGCACACAGG - Intronic
1078188773 11:9074666-9074688 CACCTCACCCAGCAGCTCAGGGG + Intronic
1081812757 11:45922709-45922731 CACCTGCTCCAGCGGCTCCCGGG - Intronic
1083654598 11:64223451-64223473 GACCTCTTCCTGCAGCTCACCGG + Exonic
1085455028 11:76660748-76660770 AACCTCATCCGGCTCCCCACAGG - Exonic
1088069760 11:105767802-105767824 AACCTCATCCAACTTCACACAGG + Intronic
1095971797 12:47906639-47906661 AACCTCTTTCAGAGGCTCATGGG - Intronic
1097754109 12:63390040-63390062 GACCTGAGCAAGCGGCTCACGGG - Intergenic
1101030328 12:100651893-100651915 CCTCTCCTCCAGCGGCTCACTGG + Intergenic
1105606467 13:21930393-21930415 AATCTCATCATGTGGCTCACAGG + Intergenic
1107728878 13:43328222-43328244 AACCTGTTCCAGTGGATCACCGG + Intronic
1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG + Intergenic
1114696826 14:24633514-24633536 GCCCTCATCCAGAGGCTAACTGG - Intronic
1119948996 14:78725210-78725232 AACCTCCTGCTGTGGCTCACTGG + Intronic
1120521170 14:85529990-85530012 AACCGCAGGCAGCGGCTCCCGGG - Intergenic
1122188199 14:100018290-100018312 AACCTCATCCAGCTGGTCCATGG + Intronic
1129452466 15:75658704-75658726 AATCTCATCCAATGGCTCTCAGG - Exonic
1136858698 16:33681661-33681683 AACCTCACTCAGCTGCTGACAGG + Intergenic
1139532630 16:67550170-67550192 CCCCACATCCAGCTGCTCACTGG + Intergenic
1142594103 17:1021209-1021231 GACGTGATCCAGGGGCTCACTGG + Intronic
1144955410 17:19016641-19016663 GAGCTCATCCACGGGCTCACAGG + Intronic
1146006302 17:29162856-29162878 AACCTCATCTAGCAGCTACCAGG + Intronic
1149665591 17:58362933-58362955 AACCTCATCCAGCGGCTCACTGG - Intronic
1151701333 17:75744055-75744077 AGCCTCATCCAGCGTGTCACTGG - Intronic
1156301139 18:35837163-35837185 AACCACATCAAGGGACTCACGGG + Intergenic
1161258861 19:3324590-3324612 GACCTGATCCAGGTGCTCACAGG - Intergenic
1161407071 19:4096555-4096577 ACCCTCATACTGTGGCTCACTGG + Intronic
1164557787 19:29266890-29266912 AAGCTCATCCCATGGCTCACAGG - Intergenic
1166745597 19:45140527-45140549 GACCTCTTCCAGGGCCTCACAGG - Exonic
925172116 2:1756532-1756554 AGCCTCATCCAGGGCTTCACAGG - Intergenic
927751028 2:25671300-25671322 AAACTCATCCAACCGCACACGGG + Intronic
938636782 2:133236272-133236294 AACCAGAGCCAGAGGCTCACAGG + Intronic
938755649 2:134376674-134376696 ATCCTCATGCAGTGGCTCAGTGG + Intronic
944718181 2:202396230-202396252 CAGCTCATCCAGCAGCTCAGTGG - Intronic
948596911 2:239085455-239085477 GAGCTCCTGCAGCGGCTCACGGG + Intronic
1172316023 20:33955021-33955043 GACCTCATTCAGCTGCTCCCTGG - Intergenic
1174375692 20:50125107-50125129 GACCTCATCCAGGGCCTGACGGG - Exonic
1180999259 22:19980445-19980467 AACCCCAGCCAGCGGCTACCAGG + Intronic
1181266230 22:21632577-21632599 ATCCTCAGCCTGCGGCTCCCAGG + Intergenic
1184076902 22:42186101-42186123 AACATCAGCCAGCCACTCACTGG + Intronic
1184308522 22:43625673-43625695 AACCTCCTCCAGCCCCTCCCCGG - Intronic
1184504752 22:44893895-44893917 AGCCTCACCCTGCAGCTCACTGG - Intronic
952889094 3:38029335-38029357 AATCTCAGCCCGCGGCTCCCTGG - Intronic
955050838 3:55409385-55409407 CACCTCATCCCTCGGCTAACAGG - Intergenic
959544533 3:107578744-107578766 AAGCCCATCCAGAGGTTCACAGG + Intronic
961150971 3:124637564-124637586 AGCCTGATCCAGCGGCCCACAGG + Intronic
962254437 3:133860760-133860782 GAGCTCATCCAGCTGCTCTCAGG - Intronic
968668785 4:1836667-1836689 AACCTCAGGCAGCGACTCACAGG + Intronic
970171347 4:13293927-13293949 AAGCTCATCCAGCAGAGCACAGG + Intergenic
981352848 4:143752492-143752514 AACCCCATCCAGGGGCTCAGGGG + Intergenic
984119857 4:175728888-175728910 CCCCTCATCCAGTGACTCACAGG + Intronic
987507272 5:18789883-18789905 ATCCTCATCCAGCAGCTGACAGG + Intergenic
1001308960 5:170597043-170597065 AAGCTCATGCAGCTGCTAACAGG + Intronic
1001559397 5:172659414-172659436 AACCTCAGCCAGCTTATCACTGG + Intronic
1006314272 6:33280760-33280782 TACCTCACCCACCGGCTCTCAGG - Exonic
1007315716 6:40987046-40987068 AACATCATCCTGTGGCTCTCTGG - Intergenic
1012935062 6:105358944-105358966 AACCTCATCCACCTGGGCACAGG - Intronic
1014594571 6:123318426-123318448 AACCTCATTCAGCTGCTAAGTGG + Intronic
1016808863 6:148240178-148240200 AACCTGAACCAGTGCCTCACTGG + Intergenic
1018068925 6:160143863-160143885 GACCCCATCCATCAGCTCACAGG - Intronic
1019350050 7:550338-550360 CACCTCACACAGCGGCTCCCGGG + Exonic
1026092133 7:67309067-67309089 AACCTCATCTCCCTGCTCACTGG + Intergenic
1029845175 7:103405591-103405613 CACCTCATCCAGGGGATCTCTGG - Intronic
1031406726 7:121395946-121395968 AACCCCGGCCAGCGGCTCTCCGG + Intronic
1040768370 8:50943798-50943820 GACCACATCCAGTGACTCACGGG + Intergenic
1043443954 8:80301158-80301180 GAGATCATCCAGCTGCTCACAGG + Intergenic
1050540993 9:6670018-6670040 CACCCCAGCCAGGGGCTCACTGG + Intergenic
1051194108 9:14544608-14544630 AACCTGATACAAAGGCTCACAGG + Intergenic
1057266050 9:93618997-93619019 ATCCTCTTCCAGCTGCTCACAGG + Intronic
1057935244 9:99232890-99232912 ATCCTCATCCACTGTCTCACTGG - Intergenic
1061673571 9:132202722-132202744 AACCTGACCCAGCATCTCACAGG + Intronic
1062259246 9:135651569-135651591 AAAATCATCCCTCGGCTCACTGG - Intergenic
1198374938 X:136029452-136029474 GCCCTCATCCTGAGGCTCACGGG - Intronic
1198522444 X:137466686-137466708 AAACTCATCCAGGAGCTGACAGG - Intergenic