ID: 1149665888

View in Genome Browser
Species Human (GRCh38)
Location 17:58364566-58364588
Sequence GCTGCTCCTGGGCTTGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 511}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149665888 Original CRISPR GCTGCTCCTGGGCTTGGCCT GGG Intronic
900114130 1:1021272-1021294 GCTGCTCCTGGGTGTGGCTGGGG + Intronic
900136207 1:1118117-1118139 CCTACCCCTCGGCTTGGCCTGGG + Intergenic
900165607 1:1243231-1243253 GCCACTCCTGGGCCTGTCCTGGG - Intronic
900252214 1:1676822-1676844 TCTGCTTCTGCGCTTTGCCTGGG - Exonic
900409695 1:2507048-2507070 GCTGAGCCTGGGCTAGGCCCTGG + Intergenic
900423345 1:2565122-2565144 GCTGCTCCCAGGTCTGGCCTCGG + Intronic
900805394 1:4764036-4764058 TCTTCTCCTGCCCTTGGCCTTGG + Intronic
901380358 1:8869526-8869548 GCTGTGGCTGGGCTTGGACTGGG + Intronic
901644456 1:10709116-10709138 GCTGGTCCAGGACTTGGCTTTGG + Intronic
901766302 1:11502156-11502178 CCTGGGCCTGGGCCTGGCCTGGG - Intronic
901782058 1:11600734-11600756 GCTCCTATTGGCCTTGGCCTTGG - Intergenic
901842170 1:11960630-11960652 GCTGCTCCTGGGGTTGGGGATGG - Exonic
901878952 1:12182779-12182801 GCTCCTCCAGGTCTTGGCTTTGG - Intronic
901988199 1:13092258-13092280 GCAGCTCCTGAGCTTGGTCCTGG - Intergenic
901993613 1:13134509-13134531 GCAGCTCCTGAGCTTGGTCCTGG + Intergenic
902038345 1:13473816-13473838 TCTTCTCCTGCCCTTGGCCTGGG + Intergenic
902376554 1:16032645-16032667 GCTCCTCCTGGGCCTGGACAGGG + Intronic
902470045 1:16642932-16642954 GCTGCACCTGTGGCTGGCCTAGG - Intergenic
902624026 1:17666557-17666579 GGTGCTACTGGGCTGGGCCAAGG + Intronic
902841629 1:19077864-19077886 GCTGCTCCTCCGCTGGGCCTGGG - Intronic
903229840 1:21915008-21915030 GCCGGTCCTGGGCTGGGCCCTGG - Intronic
903283385 1:22262860-22262882 GCTGCTCCTGGGCTGGTGGTGGG + Intergenic
903376333 1:22868686-22868708 ACTGATGCTGGGCTTGGCCGTGG - Intronic
903529451 1:24018978-24019000 GCTGTGCCAGGGCTGGGCCTGGG + Intergenic
903568226 1:24285004-24285026 GGGGCTCCTGGGCTGGGCCAAGG - Intergenic
904405609 1:30286281-30286303 GCTGCTTCTGGGCTCGTGCTGGG + Intergenic
904412871 1:30335632-30335654 TCTGCTCCAGGACCTGGCCTGGG - Intergenic
904458596 1:30662245-30662267 GCTGCTTCTGGGCTCGTGCTGGG + Intergenic
904465382 1:30704517-30704539 GCTGCTCCCAGGCTGGGCCTGGG + Intergenic
904465494 1:30704942-30704964 GCTGCTCCCAGGCTGGGCCTGGG + Intergenic
904592234 1:31621367-31621389 GCTGCTCCTAGGCCTTGCTTTGG + Intronic
904610097 1:31721113-31721135 GCTCAGCCTGGACTTGGCCTGGG - Intergenic
905915701 1:41682816-41682838 CCAGGCCCTGGGCTTGGCCTGGG + Intronic
906747059 1:48229303-48229325 GCTGCTCCTGGCCCTTGGCTGGG + Exonic
907377101 1:54053110-54053132 GCTGCTGCTGACCATGGCCTTGG - Exonic
907509930 1:54950448-54950470 GCTGCCCCTGGGATCAGCCTTGG + Intergenic
912151085 1:106859425-106859447 GGTGTTCCTGGGCTTTCCCTTGG - Intergenic
912803536 1:112737286-112737308 GCTGCATCTGGGGTTGGCCTGGG - Intergenic
913194527 1:116444663-116444685 GCTGGGGCTGGGCTGGGCCTGGG - Intergenic
913957204 1:143317807-143317829 CCTGCTTCTGGCCCTGGCCTTGG - Intergenic
913958164 1:143321507-143321529 GCAGCTCCTGGGCAGGGCCAGGG + Intergenic
913971339 1:143420458-143420480 GCTGCTCATGGGGTAGGGCTGGG + Intergenic
914051518 1:144143171-144143193 CCTGCTTCTGGCCCTGGCCTTGG - Intergenic
914052479 1:144146882-144146904 GCAGCTCCTGGGCAGGGCCAGGG + Intergenic
914065716 1:144246071-144246093 GCTGCTCATGGGGTAGGGCTGGG + Intergenic
914113435 1:144720283-144720305 GCTGCTCATGGGGTAGGGCTGGG - Intergenic
914126718 1:144819659-144819681 GCAGCTCCTGGGCAGGGCCAGGG - Intergenic
914127679 1:144823370-144823392 CCTGCTTCTGGCCCTGGCCTTGG + Intergenic
914315981 1:146512313-146512335 TCAAATCCTGGGCTTGGCCTTGG - Intergenic
914498374 1:148221048-148221070 TCAAATCCTGGGCTTGGCCTTGG + Intergenic
915009098 1:152667824-152667846 GCTGCTCCTGGAGTTAGCATGGG - Intergenic
916720590 1:167482386-167482408 GCTTCTTCAGGGCTTTGCCTGGG + Intronic
918061246 1:181063012-181063034 GCTGCCCATGTGCTCGGCCTTGG - Intergenic
920041719 1:203102242-203102264 GCTGCTCCTGGGCTCGAGCTTGG + Intronic
920420817 1:205832142-205832164 GGTGCTGCTGGGATTGGTCTGGG + Intronic
921081413 1:211741275-211741297 GCTGCTCCTGGGCTCCTACTTGG + Intergenic
923512755 1:234666625-234666647 CCTGCCCTTGGGCTTGGCCGAGG + Intergenic
923793997 1:237135910-237135932 GCTACTCCTCTGCTTGGCCATGG + Intronic
1063429521 10:5977120-5977142 ACTGCTCCTGACCTCGGCCTCGG + Intronic
1065825906 10:29571306-29571328 GATGCTCCATGGCTTTGCCTTGG - Intronic
1066745576 10:38602550-38602572 GCTCCTGCTGCCCTTGGCCTGGG + Intergenic
1067134359 10:43595053-43595075 GCCCCCCCTGGACTTGGCCTTGG + Intergenic
1067681624 10:48445434-48445456 GCTCCAGCTGGGCCTGGCCTGGG + Intergenic
1069808080 10:71138359-71138381 GCCTCTCCTGGGCTTTGGCTGGG - Intergenic
1070597370 10:77841929-77841951 GCTGCTCTTGAGCTTGGACTCGG + Exonic
1070674885 10:78405720-78405742 GCTGCCACTGGGCTTGGCGAAGG - Intergenic
1071337634 10:84613867-84613889 GCTGCTCCTGGCGGTGCCCTTGG - Intergenic
1072686007 10:97537359-97537381 GGTGCTAATGGGCTTGGCCTGGG - Intronic
1073276092 10:102312745-102312767 ACTGCTCCTGGTGTTTGCCTCGG + Intronic
1073424899 10:103450426-103450448 GCTTCTCCTGGGGTAGGGCTTGG + Intronic
1073541330 10:104318147-104318169 GCTGCTCCTTGGCTTGGGGAAGG - Intronic
1074313291 10:112340927-112340949 ACTGCTCTTGGGCAAGGCCTGGG - Intergenic
1074705521 10:116126462-116126484 CTTGCTGTTGGGCTTGGCCTTGG - Intronic
1075423463 10:122323838-122323860 GGTGGTCCTGGGGTTGACCTTGG + Intronic
1076294425 10:129373777-129373799 CCTGGACCTGGGCTTGGCCCTGG + Intergenic
1076430105 10:130395767-130395789 TCTTCCCCTGCGCTTGGCCTGGG + Intergenic
1076647061 10:131960929-131960951 GCTCGTCCTGGGCTGGGCCAGGG + Intergenic
1076659858 10:132048318-132048340 TCTGCTCCTGGCCTTGGCACCGG + Intergenic
1077046263 11:547074-547096 GCTGGGCTTGGGCTTGGGCTTGG + Intronic
1077322670 11:1949305-1949327 CCTCCTCTTGGGCATGGCCTTGG - Intronic
1077468537 11:2745802-2745824 CCTGCTCCTGGTCCTGGCCCCGG - Intronic
1077483241 11:2826392-2826414 GCGGCTGCTGGGCCTGGCCGCGG - Intronic
1077503210 11:2918509-2918531 GCTGCTCGTGGGCTTGTCCGTGG - Intronic
1077503891 11:2921564-2921586 GCTGCTCCCGGGGATGGGCTCGG - Intronic
1077503905 11:2921607-2921629 GCTGCTCCCGGGGATGGGCTCGG - Intronic
1077503919 11:2921650-2921672 GCTGCTCCCGGGGATGGGCTCGG - Intronic
1077503933 11:2921693-2921715 GCTGCTCCCGGGGATGGGCTCGG - Intronic
1077503947 11:2921736-2921758 GCTGCTCCCGGGGATGGGCTCGG - Intronic
1077503961 11:2921779-2921801 GCTGCTCCCGGGGATGGGCTCGG - Intronic
1077513170 11:2982731-2982753 GTTGCTGCTAGGCTGGGCCTGGG + Intronic
1077543668 11:3159607-3159629 TCTGCTCCTGAACTTGGCATTGG - Intronic
1077896436 11:6456930-6456952 ACTGCGCCTGGGCTCGGCCCCGG - Exonic
1078195100 11:9130637-9130659 GCTGCTCCAGAGCTGGGCCAAGG - Intronic
1078548524 11:12263975-12263997 AATGCTCCTGGGCTAGGCTTTGG + Intergenic
1078740921 11:14065432-14065454 GCTGCTCCGTGGCTGGGCGTGGG - Intronic
1078984975 11:16584847-16584869 GCTGCACCTAGGCCTGCCCTGGG + Intronic
1078986683 11:16605121-16605143 GCTGCTCCCGGGCTCGGCCCAGG - Intronic
1079076229 11:17386943-17386965 GCTGAACTTGGGCTTGGCCTTGG + Exonic
1079110723 11:17603624-17603646 GCTTCTCCTGGGCTGTGCCCAGG + Intronic
1079117017 11:17646340-17646362 CCTGCCCCTGTGCTTGGTCTTGG - Intronic
1080676624 11:34433857-34433879 GTTGCACCTGGGCTTGACCTTGG - Intergenic
1081742554 11:45450654-45450676 GGTGAGCCTGGGCTTGCCCTTGG + Intergenic
1081772636 11:45659313-45659335 GATGCTCTTGGGTGTGGCCTGGG - Intronic
1082016733 11:47494592-47494614 GCTGCCCCTGAGATAGGCCTGGG - Intronic
1083158851 11:60842311-60842333 GGTGATCCTGGGCTTGTCTTCGG - Exonic
1083170548 11:60921871-60921893 TCTGCTCCTCGGCTTGGTCTTGG + Exonic
1083321773 11:61852104-61852126 CCTGAGCCCGGGCTTGGCCTGGG + Intronic
1083334620 11:61915388-61915410 GCTGTGTCTGGCCTTGGCCTGGG + Intronic
1083638726 11:64133989-64134011 TCTGCTCCTGGCCTTTGCCTGGG - Intronic
1083768608 11:64854161-64854183 GCTGTTCCTGGGCCTGGCGGGGG - Exonic
1083784134 11:64934147-64934169 TCTGCTCCTGGCCTTGGGCAAGG + Exonic
1084058010 11:66650078-66650100 GCTGCTGCTTGTCTGGGCCTTGG + Intronic
1084271322 11:68030821-68030843 TCTGCGCCTGGGCTTCCCCTCGG + Intronic
1084274473 11:68044430-68044452 CCTGCACCTGGGCTTTGCCTAGG + Intronic
1084275620 11:68049683-68049705 GGTGGTCCTGGCCTTGGCCATGG + Exonic
1084420099 11:69056194-69056216 GCCGCTCCTTGGCTGGGCCTTGG + Intronic
1084607937 11:70183460-70183482 GGCTCTCCTTGGCTTGGCCTGGG + Intronic
1084677502 11:70644546-70644568 GCTGGTCCTGCCCTTGGCCGGGG - Intronic
1088469474 11:110177611-110177633 GCTGGACCTTGGCCTGGCCTGGG + Intronic
1088679956 11:112231163-112231185 ACTGCTCCTGGCCTTCTCCTTGG + Intronic
1088807414 11:113365188-113365210 GCAGCTACTGGGCTTAACCTAGG - Intronic
1090208216 11:124897208-124897230 GCTGGTCCTGGGGGTGGACTAGG + Exonic
1090504603 11:127297948-127297970 GGGGTTCCTGGGCTTGGCCCAGG - Intergenic
1091124264 11:133082134-133082156 GCTTGTCCTGCCCTTGGCCTGGG - Intronic
1202805687 11_KI270721v1_random:4618-4640 CCTCCTCTTGGGCATGGCCTTGG - Intergenic
1091888244 12:4031889-4031911 TCTGCTCCTGGACCCGGCCTGGG + Intergenic
1093767368 12:22980458-22980480 ACTGCTTCTGAGCTTGGCCATGG - Intergenic
1094754668 12:33454280-33454302 GCTGAGCCAGGGCCTGGCCTGGG + Intergenic
1094819245 12:34211700-34211722 GCAGCGCCTGCGCTGGGCCTGGG - Intergenic
1095096070 12:38149990-38150012 GCTGCTCCTGTGTGTGTCCTGGG + Intergenic
1095906153 12:47380128-47380150 GCAGCTCCTGGGCGTGGCCTTGG - Intergenic
1096744450 12:53716262-53716284 CCCGCTGCTGGGCCTGGCCTAGG + Exonic
1097154741 12:57004510-57004532 GCTGGTCAGGGGCTTGGCCCTGG + Exonic
1099287430 12:80731875-80731897 GCTGCTTCTGGGAGTGGACTAGG - Intergenic
1101482153 12:105108141-105108163 GCTGCCCCGGGGCTTGGGCGGGG + Intronic
1101738661 12:107482691-107482713 CCTGCTCCTTGGCTTGGAGTGGG - Intronic
1102038892 12:109788041-109788063 GCTGCCCCTGGGCTCAGCGTGGG + Intronic
1103244148 12:119440755-119440777 GCTGCCCTTGGGATTGGCCAAGG - Intronic
1103607621 12:122098828-122098850 GCTGATCCTGGGGGTGGGCTGGG + Intronic
1103766953 12:123287184-123287206 GCTTCACCTTGGGTTGGCCTGGG - Intergenic
1103952330 12:124557974-124557996 GCAGCTCCAGGCCCTGGCCTGGG - Intronic
1106197936 13:27510041-27510063 TCTGCTTCTGTGCTTGGCCCTGG + Intergenic
1106702905 13:32248928-32248950 CCAGCTCATGGGCTTGACCTCGG - Intronic
1108088895 13:46824910-46824932 GCTTTTCCAGGGCTTGCCCTGGG - Intergenic
1108322540 13:49302369-49302391 GAGGCTCCTGTGCTGGGCCTGGG + Intergenic
1109024909 13:57144365-57144387 GCTGCTTCTTGGCTTGCCATTGG + Intronic
1109025896 13:57150935-57150957 GCTGCTTCTTGGCTTGCCATTGG + Intronic
1109026886 13:57157508-57157530 GCTGCTTCTTGGCTTGCCATTGG + Intergenic
1109027878 13:57164079-57164101 GCTGCTTCTTGGCTTGCCATTGG + Intergenic
1109028864 13:57170644-57170666 GCTGCTTCTTGGCTTGCCATTGG + Intergenic
1109029567 13:57175816-57175838 GCTGCTTCTTGGCTTGCCATAGG + Intergenic
1110596538 13:77326615-77326637 GCTGCTGCGGGGCTGGGGCTGGG - Exonic
1112435739 13:99390172-99390194 GGTGCTGCTGGGCATGGCGTGGG - Intergenic
1113557856 13:111253007-111253029 GCTGCTGCTGGGCCTGGCCCTGG - Intronic
1113707477 13:112444102-112444124 GCAGCTTCTGGGCTCAGCCTGGG - Intergenic
1115474738 14:33801837-33801859 GCAGCTCCTGGGCTGGGTTTTGG + Intronic
1116764468 14:49053390-49053412 CATGCTCCTGAGCTTGGCGTGGG - Intergenic
1117547180 14:56803303-56803325 GGTGGTCTTGAGCTTGGCCTTGG - Intronic
1117780110 14:59223372-59223394 ACAGCTCTTGGGCTGGGCCTTGG - Intronic
1118692319 14:68352001-68352023 GCTGATAATGAGCTTGGCCTTGG + Intronic
1118776900 14:68978969-68978991 CCTGCTCCTGGACCCGGCCTGGG - Exonic
1119415469 14:74466620-74466642 GCTGCTGCTGGGCTTGAGCTGGG + Intergenic
1120200530 14:81533684-81533706 GGTGCTGCTGAGCTTGGCCTCGG - Exonic
1121025260 14:90610986-90611008 CCTGCTTCCTGGCTTGGCCTGGG + Intronic
1121853936 14:97249144-97249166 ACTGGGCCTGGGCCTGGCCTTGG + Intergenic
1122072055 14:99211277-99211299 GTTGCCCATGGGCTTGGGCTGGG - Intronic
1122144476 14:99681344-99681366 GCTGCTCCTGGGGTAAGCCATGG + Intergenic
1122636091 14:103130328-103130350 GATGCTCTCGGCCTTGGCCTGGG - Exonic
1122770960 14:104097451-104097473 GGGGCTCCTGGGCTGGGCCTGGG + Intronic
1122836878 14:104434876-104434898 GTTGCTCCTGGGCATTGCCCTGG - Intergenic
1122980582 14:105190801-105190823 GCTGCTCCCGGGTTCTGCCTGGG - Intergenic
1123028150 14:105438306-105438328 GCTGGAGCTGGGCTTTGCCTGGG + Intronic
1123122905 14:105926383-105926405 GCCTCTCCTGGGCTGTGCCTAGG + Intronic
1123421270 15:20139441-20139463 CCTGCTTCTGGCCCTGGCCTTGG - Intergenic
1123514880 15:21024450-21024472 GCCTCTCCTGGGCTGTGCCTAGG + Intergenic
1123530496 15:21145981-21146003 CCTGCTTCTGGCCCTGGCCTTGG - Intergenic
1123857303 15:24426757-24426779 GAGGCTCCTGGGCTGGGCCAGGG + Intergenic
1124136026 15:27037102-27037124 GCTGCTCCAGGGCTCTGCCCTGG - Intronic
1124398848 15:29331038-29331060 GCAGCTCAGGGGCTTGCCCTGGG - Intronic
1124433878 15:29631907-29631929 GCTGCTGCTGGGCGGGGCATAGG + Intergenic
1125454702 15:39845142-39845164 CCTGAACCTGGGCCTGGCCTAGG - Intronic
1125513903 15:40307515-40307537 GCTGCTACGGGGCTTTGCTTGGG - Intronic
1127601784 15:60544898-60544920 GATGGTCCTTGACTTGGCCTTGG - Intronic
1127752474 15:62060009-62060031 GCAGGGCCAGGGCTTGGCCTCGG + Intronic
1128113774 15:65093117-65093139 GCTCCTCCAGGGCTTGCTCTCGG + Exonic
1129066974 15:72913237-72913259 CCTGTTCTTGGTCTTGGCCTTGG - Intergenic
1129158771 15:73735233-73735255 GCTGCTGCTGGGTCTAGCCTGGG - Intergenic
1129226802 15:74174888-74174910 GCTTCTCCTGGGCCTGGCTCAGG + Exonic
1129314324 15:74732042-74732064 GGTTCTCATTGGCTTGGCCTGGG - Intergenic
1129331919 15:74832235-74832257 GCTGCTCCTGGGCTGCCCCCAGG + Intergenic
1129413956 15:75364487-75364509 GCTGCTGCTGGGCATAGCCAAGG - Exonic
1129683027 15:77668948-77668970 GCTGCTGCTTGGCTTGTCCGTGG - Intronic
1129758044 15:78110378-78110400 GCTGGTCCAGGGCTGAGCCTGGG + Intronic
1130649793 15:85756061-85756083 TCTGGCCCTGGGGTTGGCCTGGG - Intergenic
1130899259 15:88194729-88194751 GCTTCTCCTGCACTTGGACTTGG + Intronic
1131957728 15:97755500-97755522 CCACCTCCTGGGCTTTGCCTTGG + Intergenic
1132344596 15:101100747-101100769 GCTGCCCCGTGGCTGGGCCTTGG + Intergenic
1132546562 16:535951-535973 GCTGTCCCTCGGCCTGGCCTGGG + Intronic
1132565771 16:621972-621994 GTTGCTCCTGGGCAGAGCCTGGG + Intronic
1132608339 16:802748-802770 CCTCCTCCTGCCCTTGGCCTTGG - Intergenic
1132686407 16:1163987-1164009 GCTGCTCCTCGGCTGGGGCAGGG - Intronic
1132762982 16:1519955-1519977 GGGGCTCTTGGCCTTGGCCTTGG + Exonic
1132841923 16:1982266-1982288 GCTGTCCCTGGTCTTGGCATGGG + Exonic
1132873656 16:2126388-2126410 GCTGGGCCAGGGCTGGGCCTCGG + Intronic
1132959198 16:2612783-2612805 GCTTCTCCAGCGCTTGGCCCTGG + Intergenic
1132972258 16:2694758-2694780 GCTTCTCCAGCGCTTGGCCCTGG + Intronic
1133317164 16:4892039-4892061 GCAGCTGCTGGACTTGGCCCAGG - Exonic
1134533692 16:15006542-15006564 GCTGCTGCTAGACCTGGCCTGGG + Exonic
1134552744 16:15145562-15145584 GCTGGGCCAGGGCTGGGCCTTGG + Intergenic
1135247433 16:20869051-20869073 GCTGTTCCTGGGGATGGGCTTGG + Intronic
1136250272 16:28999812-28999834 GCTGCTCCTGGGGTTGGGTGGGG + Intergenic
1136267384 16:29129734-29129756 GCTGCTGCTGAGCCTGGGCTGGG + Intergenic
1136498810 16:30659596-30659618 GCTGCTCCCGGTCTCGGTCTCGG - Exonic
1136637888 16:31537462-31537484 GCTGCTCCTGGGCTCTGGCCAGG - Intergenic
1136666838 16:31819690-31819712 GCTGCTCCTGGGCTCCGGCCAGG + Intergenic
1137724889 16:50650533-50650555 GCTGCTCCTGGCCTGAGCCTGGG + Intergenic
1138079588 16:54077364-54077386 GCAGGTACTGGGCTTGGTCTGGG - Intronic
1138269843 16:55687685-55687707 ACTGCTTCTGGCCTTGGCATAGG + Intronic
1138550689 16:57746541-57746563 ACTGCTCCTGTGCTGTGCCTCGG + Intronic
1139862338 16:70034190-70034212 GCTGCTGCTAGACCTGGCCTGGG - Intergenic
1140116267 16:72044040-72044062 GGTGGTCAAGGGCTTGGCCTGGG + Intergenic
1140654045 16:77121713-77121735 GGTGCTCCTGATGTTGGCCTGGG + Intergenic
1141070834 16:80953136-80953158 GCTGCTCCTGGGCTCAGCCAAGG - Intergenic
1141495779 16:84408425-84408447 GCTGCTGCTGGGCTCTGCCCTGG + Exonic
1141644054 16:85358042-85358064 GCTTCTCTTGGGCTGGGCCACGG + Intronic
1141646377 16:85370172-85370194 GCAGCCCCAGGGCTTGGCTTTGG - Intergenic
1141710637 16:85696933-85696955 CCGGCTCCTGGGTTTGGCCGGGG + Intronic
1142025901 16:87813443-87813465 TTTCCTCCTGGGCTTGCCCTTGG + Intergenic
1142070675 16:88090057-88090079 GCTGCTGCTGAGCCTGGGCTGGG + Intronic
1142085424 16:88177601-88177623 GCTGTGCCTGGTCTTGGCCGGGG - Intergenic
1142286202 16:89172480-89172502 TCTGTTCCTGGGCTTCACCTGGG + Intronic
1142517688 17:443418-443440 GCTGCCCCTGGGCCTGGCGGTGG - Exonic
1142965279 17:3577220-3577242 GCTCCTCCTGGGCCTGGCCTCGG - Intronic
1143949899 17:10624100-10624122 CCTGTTCCTGGGCATGGCATAGG + Intergenic
1144393615 17:14820656-14820678 GCTGGTCCTGGGCTTCACTTTGG + Intergenic
1145248471 17:21284806-21284828 GCTGCTCCTCCGCCTGGCCTGGG + Exonic
1145359827 17:22202913-22202935 GTTGTTCCTGGGCTCCGCCTTGG - Intergenic
1146477250 17:33172950-33172972 GCTGCTCCTGTGCCTGGCTGTGG + Intronic
1148127841 17:45245981-45246003 ACTGCTCCTGGGCTTGGTACTGG + Intronic
1149038548 17:52159689-52159711 GCTGCCCCTGGCCTCGGCCTGGG - Intronic
1149665888 17:58364566-58364588 GCTGCTCCTGGGCTTGGCCTGGG + Intronic
1149867077 17:60157048-60157070 GCTGCCCCTGGGCCTTGCTTGGG - Intronic
1150135125 17:62691175-62691197 GCTGGTCCTGGGCTGGGGCTGGG + Intronic
1150435018 17:65147009-65147031 GCTGCTCCTGGGGGTGGCCCAGG - Intronic
1151726968 17:75890967-75890989 GCGGCTCCTGGGCATGGATTTGG - Exonic
1151877723 17:76876834-76876856 GCTGCATTTGGGCTGGGCCTGGG + Intronic
1152231333 17:79115454-79115476 GAAGCTCCAGGGCTGGGCCTGGG + Intronic
1152460078 17:80438011-80438033 GCTGCTCCCGGGCTGGGACCTGG + Exonic
1152570847 17:81120665-81120687 GCCGCACCTTGGCTGGGCCTTGG + Exonic
1152641230 17:81450140-81450162 GTTGCTCCTGGGCTTTCCCAGGG + Intronic
1152643406 17:81458294-81458316 GCTGCCCTTGGCCTTGCCCTTGG - Exonic
1152656675 17:81523150-81523172 GCTGCTCCGGAGCCTCGCCTTGG - Intronic
1152730484 17:81967402-81967424 GCTGCTCCTGGGCTTGGTGTTGG + Intergenic
1152799753 17:82325342-82325364 CCTGCACCTGGCCTAGGCCTTGG - Intronic
1152868348 17:82737149-82737171 GCTGTGCCTGGGCTTTCCCTGGG + Intronic
1154133102 18:11752568-11752590 GCTGCTCCTGGGTAAGGCCGAGG + Intronic
1154414770 18:14171005-14171027 CCTGCTTCTGGCCCTGGCCTTGG - Intergenic
1156122711 18:33864100-33864122 GCAAGTCCTGGGCTTGGCCCAGG + Intronic
1156359772 18:36374343-36374365 CCTGCTCTTGGGGTTGACCTGGG + Intronic
1156453382 18:37279233-37279255 GGTGCTGCTGGGCTGGGCCAAGG + Intronic
1157914897 18:51655124-51655146 TCTGCTCCTTGGCCTGGCCATGG + Intergenic
1158395677 18:57077114-57077136 GCTGCTGCAGGGCTGGGCCAGGG + Intergenic
1158405274 18:57154645-57154667 GCCGCTCCGGGGCCTGGCCGAGG + Intergenic
1158569159 18:58582123-58582145 GCTGATACTGGGCTTTGCCTTGG + Intronic
1160355960 18:78229018-78229040 GCTCCTCCTGTCCATGGCCTTGG - Intergenic
1160420043 18:78737757-78737779 GCTGCTCATGGGCCTGGCTCAGG - Intergenic
1160534281 18:79584060-79584082 GGTGCTCCTGGGCGTGGGCAGGG + Intergenic
1160534300 18:79584099-79584121 GGTGCTCCTGGGCGTGGGCAGGG + Intergenic
1160561022 18:79755811-79755833 TCTGCTGCTGGGTCTGGCCTAGG + Exonic
1160668606 19:345010-345032 CCTGATCTTGGCCTTGGCCTTGG + Intergenic
1160765834 19:807295-807317 GCTGCTGCAGGGCTTGGCTGAGG + Intronic
1160811970 19:1016747-1016769 GCAGCTCCTGGGGTTGCCCTGGG + Intronic
1160914515 19:1490298-1490320 GCTGCGCCTGGTCTTGGCCCTGG - Exonic
1160936323 19:1597426-1597448 TCTGCACGTGGGCTGGGCCTGGG + Exonic
1161054215 19:2181787-2181809 GCTGCAGCTGGGCTGGGGCTGGG - Intronic
1161710133 19:5843137-5843159 GGTGGTCCTGGGCTTGAACTTGG + Exonic
1162935431 19:13979388-13979410 GCTGGTCCCGGGCTGGGGCTGGG - Intronic
1162950978 19:14072171-14072193 GCCGCTTCTCGGCTTGGCGTGGG + Intergenic
1163032404 19:14553255-14553277 TCTGCACCTGGCCCTGGCCTCGG + Intronic
1165096893 19:33414336-33414358 GCAGGTTCTGGGCTTAGCCTGGG - Intronic
1165169617 19:33882532-33882554 CCTGGTCCTGGCCTTGCCCTGGG + Intergenic
1166733737 19:45072425-45072447 CCCGCTCCTGGGCCTGGCCGAGG - Exonic
1167528374 19:49999698-49999720 GCCTCTCCAGGGCTGGGCCTGGG + Intronic
1167710893 19:51109836-51109858 GCTGCCCCTGGGCTAGGTTTAGG + Intergenic
1202690915 1_KI270712v1_random:95595-95617 CCTGCTTCTGGCCCTGGCCTTGG - Intergenic
1202691877 1_KI270712v1_random:99306-99328 GCAGCTCCTGGGCAGGGCCAGGG + Intergenic
925288402 2:2730546-2730568 GCAGCTCCTGAGCGTGGCCCTGG - Intergenic
925309698 2:2873857-2873879 GCTGCTCCAGCTCTGGGCCTGGG + Intergenic
925609776 2:5693104-5693126 GCTGGCGCTGGGCTTGGCCGAGG - Exonic
926112868 2:10193931-10193953 GCTGCTCCTGGGCTGGAGCGTGG + Intronic
926700437 2:15799900-15799922 CCTGCTCCCGGGGTTGTCCTGGG + Intergenic
927493071 2:23533259-23533281 GCTGCTTGTGGGCTAGTCCTAGG + Intronic
927701451 2:25271483-25271505 TCTCCTCCTGGGCTATGCCTGGG - Intronic
928363056 2:30680959-30680981 GCTGCTCGGGGGCATGGCCCAGG + Intergenic
929134639 2:38611825-38611847 TCTGCTGCTAGGCTTGGCTTTGG - Intergenic
929221613 2:39470092-39470114 GCTGCACCTGGGGCTGGCCCAGG + Intergenic
929762487 2:44817470-44817492 TCTCTTCCTGCGCTTGGCCTGGG + Intergenic
930035490 2:47082879-47082901 GCCCCTCCTGGGCTGGGCATGGG - Intronic
930826849 2:55703720-55703742 TCTGTTCCTGGGCCTGGGCTTGG + Intergenic
933805482 2:85995859-85995881 GCTCCTCCAGGGCTTGGCCAAGG - Intergenic
933954515 2:87354650-87354672 GCAGCTCCTGGGCAGGGCCAGGG - Intergenic
933955478 2:87358356-87358378 CCTGCTTCTGGCCCTGGCCTTGG + Intergenic
933966811 2:87436822-87436844 GCTGCCCTTGGGCTTTGGCTGGG - Intergenic
933967530 2:87442310-87442332 GCTGCCCTTGGGCTTTGGCTGGG - Intergenic
934048455 2:88190755-88190777 GCAGCTCCTGGGCACGGCCATGG - Intergenic
934176034 2:89581391-89581413 GCTGCTCATGGGGTAGGGCTGGG + Intergenic
934238709 2:90250870-90250892 GCAGCTCCTGGGCAGGGCCAGGG - Intergenic
934239664 2:90254567-90254589 CCTGCTTCTGGCCCTGGCCTTGG + Intergenic
934273530 2:91562173-91562195 CCTGCTTCTGGCCCTGGCCTTGG - Intergenic
934274485 2:91565840-91565862 GCAGCTCCTGGGCAGGGCCAGGG + Intergenic
934286344 2:91655753-91655775 GCTGCTCATGGGGTAGGGCTGGG + Intergenic
934462106 2:94217907-94217929 CCTGCTTCTGGCCCTGGCCTTGG + Intergenic
935672044 2:105564278-105564300 GCTGCTGCTGCGCTGGGCTTCGG - Intergenic
936053742 2:109244921-109244943 GCTGGCCCTGAGCTTGCCCTTGG + Intronic
936326265 2:111508186-111508208 GCTGCCCTTGGGCTTTGGCTGGG + Intergenic
936326984 2:111513664-111513686 GCTGCCCTTGGGCTTTGGCTGGG + Intergenic
936463762 2:112729409-112729431 ACCGCGCCTGGCCTTGGCCTGGG + Intronic
937223397 2:120354588-120354610 GCTGCTCATGGGTGTGGCCTGGG + Intergenic
938378890 2:130825708-130825730 GCAGCCCCTGGCCTAGGCCTGGG + Intergenic
941492972 2:166165206-166165228 TCTTCTCCTGTGCTTGGACTGGG - Intergenic
942791830 2:179769513-179769535 GTTGCTGCTGGGGCTGGCCTGGG + Exonic
943769972 2:191705614-191705636 GCTGCTCCTGAGCTTGGAGCAGG + Intergenic
944933662 2:204545619-204545641 GCTGGTCCTGGCCCTGGCCCTGG - Intergenic
946415534 2:219538111-219538133 CCTGCTCCTGGGAGAGGCCTGGG + Exonic
946696033 2:222360131-222360153 ACTACTCCTAGGCTTGGCCATGG + Intergenic
947200154 2:227607777-227607799 TGTGCTCCTTGGCATGGCCTGGG + Intergenic
947379664 2:229532914-229532936 GCTGATCCTGGGCTGGGCATGGG + Intronic
948102431 2:235385418-235385440 ACTGCTGCTGGACTTGGCCTTGG - Intergenic
948252075 2:236537266-236537288 GCTGCCCCTGGGCTTGACCTTGG - Intergenic
948628903 2:239289040-239289062 GCTGCTCCAGAGCCTGTCCTGGG - Intronic
948670446 2:239565047-239565069 GCTGCTCCTGGCCTTTGACCAGG - Intergenic
948857401 2:240736441-240736463 GCAGCCCCTGCGGTTGGCCTGGG - Intronic
949019659 2:241734253-241734275 GCGCCCCCTGGGCTCGGCCTCGG + Intergenic
1170567614 20:17615805-17615827 GCAGCACCTGGGCTGGGCCTGGG - Intronic
1170801049 20:19590672-19590694 GCTGGACCTGACCTTGGCCTTGG - Intronic
1170885966 20:20340104-20340126 GCTGGCCCAGGGCTGGGCCTCGG - Intronic
1171507748 20:25652750-25652772 GCTGCTGCTCAGCTTGGCCCAGG + Intergenic
1172947044 20:38697584-38697606 GATTCTGCTCGGCTTGGCCTGGG - Intergenic
1173147159 20:40534758-40534780 ACTGCTCCTGTGCTTGGCTGAGG - Intergenic
1173617731 20:44413876-44413898 GCTGCTCCAGGGCCTGGCTGGGG - Intronic
1174173814 20:48632673-48632695 GCTTCCCCTGGCCTTGGCCTCGG - Intronic
1174209512 20:48866375-48866397 GCTGCTCATGGGCATTGTCTGGG + Intergenic
1174363147 20:50040893-50040915 GCTCCTCCTGGGCCAGGTCTGGG + Intergenic
1174435623 20:50504771-50504793 GCTGCTTCTAGGCCAGGCCTTGG + Intergenic
1174500696 20:50981982-50982004 GAGGTTACTGGGCTTGGCCTCGG + Intergenic
1175189228 20:57199886-57199908 GCTCCTCCTGGGCAGGGCCCTGG - Intronic
1175200972 20:57277525-57277547 GCTCCTCCTAGGCCTGGCTTTGG - Intergenic
1175812296 20:61864820-61864842 GCTGCACTTGGCCTTGCCCTGGG - Intronic
1175814904 20:61878243-61878265 GATGTTCCTAGGCTTGGGCTCGG - Intronic
1175829365 20:61953644-61953666 GCTGGCCCTGGGCTTGTGCTTGG - Intronic
1176083606 20:63285949-63285971 GCTGCTGCTGGCCTTTTCCTCGG + Intronic
1176150629 20:63589025-63589047 GCAGCCCCTGGGCTGGCCCTTGG - Exonic
1176240857 20:64075186-64075208 CCTGCTCCTGGGCCTGATCTTGG + Intronic
1176858249 21:13987249-13987271 CCTGCTTCTGGCCCTGGCCTTGG + Intergenic
1178585240 21:33865919-33865941 GCAGCTCTGGGACTTGGCCTTGG + Intronic
1178833783 21:36078918-36078940 GCTGCTCCTGAGCTTGAACCCGG - Intronic
1180077265 21:45469084-45469106 GGCCCTCCTGGGCTGGGCCTCGG - Intronic
1180739751 22:18044930-18044952 GCTGGCCCTGGCCCTGGCCTTGG - Intergenic
1181052223 22:20243358-20243380 GCTGCTCCTGGGTGTGGTATGGG - Intronic
1181354134 22:22288846-22288868 CCTGCTTCTGGCCCTGGCCTTGG - Intergenic
1181432148 22:22888131-22888153 GCTGCTGCTGGGTCTGGCCATGG + Exonic
1181534811 22:23535934-23535956 GCTGCTCCTGAGCTGGACCTGGG - Intergenic
1181542320 22:23580091-23580113 GCTGCTGCTGGGTCTGGCCGTGG - Exonic
1181746278 22:24956941-24956963 CCTGCTCCTGGCTGTGGCCTTGG + Intronic
1181774885 22:25152283-25152305 ACTGCATATGGGCTTGGCCTGGG - Intronic
1181859211 22:25805286-25805308 GCTGCACCCGAGCTTGGACTGGG + Intronic
1182128718 22:27835080-27835102 GCTGCTCCTGAGGTGGGGCTGGG + Intergenic
1182484039 22:30628607-30628629 GCTGCTTCTGGGCATGGTCCTGG + Intergenic
1183678141 22:39311174-39311196 GCTCCTTCTGAGCTTGGCTTGGG - Intergenic
1183863016 22:40683033-40683055 TCTGCTGCTGGGCTTGTTCTTGG + Intergenic
1183983280 22:41555152-41555174 GCTGCTCCCTGGTTTGGCTTGGG + Intergenic
1184091020 22:42293076-42293098 CCTCCTCCTGGGCTTGGGCCTGG - Intronic
1184334494 22:43845251-43845273 GGTGGACCTGGGTTTGGCCTGGG - Intronic
1184458610 22:44625070-44625092 GCTGCCCAAGGGCCTGGCCTGGG + Intergenic
1184484081 22:44765671-44765693 GCTGCTCCTGTCCTTGGCCCGGG - Intronic
1184536259 22:45089187-45089209 GCTGCACCTGAGCTTGAGCTGGG + Intergenic
1184715127 22:46277672-46277694 GCCCATCCTGGGCTGGGCCTGGG + Intronic
1185274531 22:49944599-49944621 CCTCCTCCTGGACCTGGCCTTGG + Intergenic
949614254 3:5736678-5736700 GCTGCTCAAGGGAGTGGCCTGGG + Intergenic
950020979 3:9787444-9787466 CCTGACACTGGGCTTGGCCTTGG - Intronic
950410275 3:12831591-12831613 GGTGCTCCAGGGCCTGGGCTAGG - Intronic
951699140 3:25477291-25477313 GCTGCTCTTGGGCATGGGGTAGG + Intronic
953439864 3:42907975-42907997 CCTGGTCCTGGGGTTGTCCTAGG + Intronic
954292418 3:49656574-49656596 GCTGCTCCTGGGGGTGGCAGTGG + Exonic
954299388 3:49691321-49691343 GCTGCACCTGTGGCTGGCCTAGG + Intronic
954328377 3:49875990-49876012 CCTCCTCCTGGGCATGGTCTGGG + Intergenic
954394626 3:50286989-50287011 GCTGCCCCTGGTCCTGGGCTGGG + Intronic
954452535 3:50579531-50579553 GCTGCTCCTCTTCTTGGTCTGGG - Intronic
954752991 3:52824114-52824136 GCTGCACCTGGGCTTGCTGTGGG - Intronic
956618594 3:71198210-71198232 GCTGCTGCTGGGCGTGGGCGAGG + Intronic
956975233 3:74571353-74571375 GATTCTCATGGGATTGGCCTGGG + Intergenic
960438435 3:117656316-117656338 GCTTCTCCTTGGCTTCTCCTTGG - Intergenic
960539838 3:118850358-118850380 GTTGCTCTTGGGCTTGATCTTGG - Intergenic
960959189 3:123057228-123057250 GCTACTCCTTGGTGTGGCCTTGG - Intergenic
961474255 3:127136862-127136884 GTTGCTCCTGGCCCTGGGCTAGG + Intergenic
962374142 3:134846470-134846492 GGTGCTCCTTTGCTTGCCCTGGG + Intronic
962394092 3:134999703-134999725 TCTGCTCCTAGCCTGGGCCTGGG - Intronic
964409937 3:156387261-156387283 TCAGCTCCCTGGCTTGGCCTCGG - Intronic
964962295 3:162441880-162441902 ATTGCTCCAGGGCTTGGTCTTGG - Intergenic
966824643 3:183953455-183953477 GCTGCTCCTGGGCTTCATCCTGG - Intronic
967960086 3:194913391-194913413 GCTGCTTCTGGGATGGGCCGTGG + Intergenic
968047152 3:195630891-195630913 GCTCCTCCTGGACTGGGCCTGGG - Intergenic
968307495 3:197659153-197659175 GCTCCTCCTGGACTGGGCCTGGG + Intergenic
968502674 4:958370-958392 CCTGCTCGTGGGCCTGGCCCTGG + Exonic
968618562 4:1593200-1593222 GCGGGTCCAGGGCTTGGCCCAGG + Intergenic
968620330 4:1601024-1601046 GCTGGCCCTGGGCGTGGCCCTGG - Intergenic
968810616 4:2798121-2798143 GCTGCTTCTGGGCCTGGTCTCGG + Intronic
969078370 4:4598867-4598889 TCTGCACCTGCCCTTGGCCTTGG - Intergenic
969461018 4:7328999-7329021 GCTCCGCATGGGCCTGGCCTCGG - Intronic
969669386 4:8581354-8581376 CCTGCTGCTGGGCTGTGCCTGGG + Exonic
970566369 4:17335825-17335847 GCTGCTCCTGGGGTTGGATGTGG - Intergenic
970586865 4:17522916-17522938 GCTGCTCCTCTTCCTGGCCTTGG + Exonic
970885215 4:20980119-20980141 GCTTCTACTGGCCATGGCCTGGG + Intronic
973296295 4:48524917-48524939 GCTGCTCCTGGCCTTGGGTAGGG + Intronic
975779082 4:77820011-77820033 GCAGAGCCTGGCCTTGGCCTTGG + Intergenic
975858064 4:78646020-78646042 GCTGTTTCTGGGCATGGCCAGGG + Intergenic
979093338 4:116515977-116515999 GCTGCCCCTGGAGTTGCCCTTGG + Intergenic
979399952 4:120237099-120237121 GCTGAGGCTGGGCTTGGCCAAGG - Intergenic
982204617 4:152988535-152988557 CCTCTGCCTGGGCTTGGCCTCGG + Intergenic
984873904 4:184350533-184350555 GTTGGTCCTGGGCTTGGGCCTGG - Intergenic
985638526 5:1052284-1052306 CCTGGGCCTGGGCTTGGCCCAGG - Exonic
985696235 5:1342192-1342214 GCAGCTTCTGGGCCTGGCCAGGG + Intronic
985707546 5:1410224-1410246 GCTGCACCTGGCCTTGTCATTGG + Intronic
985727894 5:1525233-1525255 GCTGCTGCTAGGCATGGGCTGGG - Intergenic
985733732 5:1565607-1565629 GCTGCTCCTGGGCATGGCCTTGG + Intergenic
985744452 5:1638242-1638264 GCTCCTCCTGGACTGGGCCTGGG + Intergenic
985910522 5:2876402-2876424 GCTGCTGCTGTGCTTGTCCCAGG + Intergenic
986732472 5:10645385-10645407 GCTAGTCCTGGGCCTGGCCATGG + Intronic
987536799 5:19200132-19200154 GCTGCTGCTGTGCTTGGCTGGGG - Intergenic
993546070 5:89215150-89215172 GCTGTTCTTTGGCTTGGACTGGG - Intergenic
993603291 5:89955435-89955457 CCTGCTCCTGGACTTGGGGTGGG - Intergenic
995588580 5:113674626-113674648 ACTCTTCCTGGGCATGGCCTAGG + Intergenic
996691181 5:126341933-126341955 GCTGCTTCTGGCCTTGACCTTGG - Intergenic
997531119 5:134581797-134581819 ATTGCTCCAGGGCTTGGCCTGGG - Exonic
998080857 5:139274046-139274068 GCGGCTACTGGGCGTGGCTTCGG - Exonic
998862629 5:146459108-146459130 CCTGGGCCTGGGCTTGGGCTTGG - Exonic
999734377 5:154501783-154501805 GCTTCCCCTGGGAGTGGCCTGGG + Intergenic
1002297714 5:178240581-178240603 GCAGCTCCGGGGCCTGGCCCAGG - Intronic
1002901861 6:1416475-1416497 CCTGCTCCTGGGGTTGCCTTGGG - Intergenic
1003117509 6:3293056-3293078 GCTCCTCCTGAGCCTGGTCTTGG - Intronic
1003187372 6:3843950-3843972 GCTGATGGTGGGCCTGGCCTGGG - Intergenic
1003194609 6:3903728-3903750 ACTGCACCTGGCCTTGGTCTAGG - Intergenic
1003336277 6:5175886-5175908 GCTGCTGCTGATCCTGGCCTAGG + Intronic
1005694111 6:28335596-28335618 GCTGCTGCTTAGCTTGGCCCAGG - Intronic
1006071185 6:31498907-31498929 GCTGCTCCTGTGAATGGCATTGG + Intronic
1006495129 6:34417314-34417336 GCTGCTGCTGTACTTGGCTTTGG - Intronic
1006985293 6:38172082-38172104 GTTGCCCCTGGGGCTGGCCTGGG + Exonic
1007108303 6:39298239-39298261 GCTGCTCCTGGGTCTGGCCTTGG + Intergenic
1007161524 6:39795042-39795064 GATGCTTCTGGGCTTGTACTAGG + Intronic
1007280838 6:40711120-40711142 ACTGCTGCTGGGCTGGCCCTAGG + Intergenic
1007673377 6:43575554-43575576 GCCGCTCCTGTCCTTTGCCTGGG - Intronic
1007819375 6:44549633-44549655 GCTGCTCCTGGTCATGAACTGGG - Intergenic
1014517619 6:122399483-122399505 TCGGCTCCTGGGATTGGCCAGGG + Intergenic
1015120096 6:129691969-129691991 GGGCCACCTGGGCTTGGCCTGGG + Intronic
1015695750 6:135977658-135977680 ATTGCTCCTGTTCTTGGCCTAGG - Intronic
1015759529 6:136644002-136644024 CCTGCTCCTGGACATGGTCTTGG - Intronic
1015803715 6:137087764-137087786 GCTGACCCTGGGCTTGGAGTTGG + Intergenic
1017658985 6:156655668-156655690 GCTGCTCCTGGGCACATCCTGGG - Intergenic
1017840565 6:158218891-158218913 CCTGCTGCTGGGCTCGGCATGGG + Intergenic
1018848176 6:167569665-167569687 GCTTCTCCTAGGCTTGGGCTGGG - Intergenic
1018852711 6:167652885-167652907 GCTGCTCCCAGGCTGGGCCGTGG - Intergenic
1019071110 6:169345929-169345951 CCTGAGACTGGGCTTGGCCTGGG + Intergenic
1019282491 7:207521-207543 GCTGCTCCTGAGCTGCGCCCAGG + Intronic
1019381632 7:727158-727180 GCAGCTGCTGGGCCTGGCCGTGG + Exonic
1019616680 7:1966115-1966137 AGCGCTCCTGGCCTTGGCCTGGG - Intronic
1019736492 7:2652491-2652513 TTTGCTCCTTGGATTGGCCTTGG + Intronic
1019738883 7:2663173-2663195 GCTGCCCCTGGCCTTGGCACAGG - Exonic
1020055861 7:5117267-5117289 ACTGATCCTGGGCCTGGCCCTGG + Intergenic
1020257475 7:6510213-6510235 GCAGCTCCAGGGCTGAGCCTGGG + Intronic
1020577123 7:9947358-9947380 GCAGCACCAGGGCTTGGCTTAGG - Intergenic
1021562968 7:21987156-21987178 GCAGGTCCCGAGCTTGGCCTGGG + Intergenic
1021860252 7:24898966-24898988 GCTGCTCCTAGATTTGCCCTTGG + Intronic
1022465505 7:30650479-30650501 GCTCTTCCTGGTGTTGGCCTTGG + Intergenic
1022718040 7:32916330-32916352 AATGCTCCTGTTCTTGGCCTCGG - Intergenic
1022906999 7:34867267-34867289 TCTTCTCCAGGGCTTGGCTTGGG - Intronic
1023747800 7:43338172-43338194 GCTGCTCTTGTCGTTGGCCTGGG + Intronic
1024207733 7:47178162-47178184 TCTGCTCCTGCGCTTGAACTGGG - Intergenic
1024936661 7:54718329-54718351 TCTGCACCTGGCCATGGCCTTGG - Intergenic
1025189904 7:56888447-56888469 GCTACTCTTGGGCTTGGCTGGGG - Intergenic
1025682035 7:63688474-63688496 GCTACTCTTGGGCTTGGCTGGGG + Intergenic
1026440702 7:70441256-70441278 TGTGCTCCTGGGCTTTGCTTTGG + Intronic
1027579739 7:79977908-79977930 GGTGGGCCTGGGCTTGGGCTTGG - Intergenic
1028356333 7:89914651-89914673 GCTTTTTCTGAGCTTGGCCTTGG + Intergenic
1028770594 7:94615922-94615944 GCTGTTTCTGGGCATGGTCTTGG - Intronic
1028940089 7:96512152-96512174 GGTGATCCTGGGCTTGGAGTGGG - Intronic
1029113438 7:98224675-98224697 TCTGCTCCTTGGCCAGGCCTAGG + Intronic
1029259561 7:99292595-99292617 CCTTTTCCTGGGCTTGGCCCTGG - Intergenic
1029656385 7:101927855-101927877 GCTGTTGCGGGGCTTGGCCCAGG + Intronic
1032096217 7:128939549-128939571 GCTGCTCCCAGGGTTGGTCTGGG - Intronic
1032440696 7:131940931-131940953 GCTGCTCCTGCTCTGGGCATGGG + Intergenic
1034534782 7:151719953-151719975 GCTGCCCCTGGTCTGGACCTGGG - Intronic
1034629038 7:152516393-152516415 GCGGCTCCAGGGCTGAGCCTGGG - Intergenic
1035034382 7:155885567-155885589 GCAGCTCCTGGGTGTGGGCTGGG - Intergenic
1035050091 7:155993740-155993762 GCTTCTCCTGGGGCTCGCCTTGG + Intergenic
1035266406 7:157692300-157692322 GCGCCGCCTGGGCCTGGCCTGGG - Intronic
1037438867 8:18893643-18893665 TCTGCTCCTGGGCCTGGGCCTGG - Intronic
1037438881 8:18893708-18893730 TCTGCTCCTGGGCCTGGGCCTGG - Intronic
1037778287 8:21849837-21849859 GCTGATCCTGGTGGTGGCCTGGG - Intergenic
1038492184 8:27979272-27979294 TCTGCTCCTGGGCCTGCCCTTGG - Intronic
1039330907 8:36535668-36535690 TGTGGTCCTGGGCTTGGACTTGG + Intergenic
1039438623 8:37578979-37579001 TCTGCACCAGGGCCTGGCCTTGG - Intergenic
1040564779 8:48555721-48555743 GCCGCTCCGGGGCTGCGCCTGGG + Intergenic
1040784753 8:51152263-51152285 GCTGCACCCAGACTTGGCCTAGG + Intergenic
1043147783 8:76678282-76678304 TTTCCTCCAGGGCTTGGCCTCGG - Intergenic
1044861154 8:96525263-96525285 GAAGCTTCTGTGCTTGGCCTTGG + Intronic
1049156028 8:141067349-141067371 TCAGCTCCTGGGCTGGGCCCAGG - Intergenic
1049207929 8:141372022-141372044 GCACCTCCTGGGCTGGCCCTGGG - Intergenic
1049214930 8:141403131-141403153 GCTCATCCTGGGGTTGGCCCAGG - Intronic
1049293692 8:141818179-141818201 TCTGCTCCTGGGGTTGAGCTTGG - Intergenic
1049342712 8:142121838-142121860 GCTGCCCGTGGGATTGGCTTTGG - Intergenic
1049755426 8:144309354-144309376 GCTGCTGCGGGGCTTGGCCATGG - Intronic
1051616154 9:19008813-19008835 GTTGCTCCTGGACCTGCCCTTGG - Intronic
1052158536 9:25226267-25226289 GCAGCTCCTGGCGTTGGCATAGG + Intergenic
1053046427 9:34922986-34923008 GGTGCTGCTGGGCCGGGCCTGGG + Intergenic
1053152999 9:35754662-35754684 GCAGCTCCTGGGTTTGGCTGGGG - Exonic
1053487651 9:38471824-38471846 GCTGCTCCTGGGGCTGTGCTGGG + Intergenic
1053532382 9:38895404-38895426 GCTGCCACAGGGCTTTGCCTGGG + Intergenic
1053692583 9:40593590-40593612 CCTGCTTCTGGACCTGGCCTTGG + Intergenic
1054204607 9:62119825-62119847 GCTGCCACAGGGCTTTGCCTGGG + Intergenic
1054303825 9:63394508-63394530 CCTGCTTCTGGACCTGGCCTTGG + Intergenic
1054402603 9:64721018-64721040 CCTGCTTCTGGACCTGGCCTTGG + Intergenic
1054436214 9:65205349-65205371 CCTGCTTCTGGACCTGGCCTTGG + Intergenic
1054494178 9:65816338-65816360 CCTGCTTCTGGACCTGGCCTTGG - Intergenic
1054633753 9:67468533-67468555 GCTGCCACAGGGCTTTGCCTGGG - Intergenic
1056582426 9:87901541-87901563 TCTGCTGCTGGGCTTGGGTTTGG - Intergenic
1057151560 9:92800494-92800516 GCTGCCACAGGGCTTTGCCTGGG - Intergenic
1057461501 9:95267070-95267092 GCTGCTCATGGTTTTGTCCTCGG - Intronic
1057526665 9:95808995-95809017 TCTGCTACTGGACTTGGCTTTGG - Intergenic
1058400047 9:104605306-104605328 GATGTTCCTCGGCTTGGCCATGG - Exonic
1058400879 9:104617883-104617905 GATGTTCCTTGGCTTGGCCATGG - Exonic
1059483954 9:114612689-114612711 GAGGCTCCTGGGCTTGGCAAAGG - Intronic
1061194835 9:129102135-129102157 CCTCCTCCTGGCCTTGGCCTTGG + Intronic
1061539732 9:131271680-131271702 ACTGCCCCTGACCTTGGCCTTGG + Intronic
1061777149 9:132973182-132973204 GCAGCTTCTGGCCTTGGCCCAGG - Intronic
1061836719 9:133334329-133334351 GCTGGGGCTGGGCTTGGGCTTGG - Intronic
1061862974 9:133477323-133477345 CCAGCTCCTGGGGTCGGCCTAGG - Intronic
1061868202 9:133506247-133506269 GCTCCTCCTGGGGTGAGCCTGGG + Intergenic
1062052522 9:134455001-134455023 ACTGCCCGTGTGCTTGGCCTTGG - Intergenic
1062095952 9:134703518-134703540 GGAGGTTCTGGGCTTGGCCTGGG + Intronic
1062227274 9:135459976-135459998 GATGTTCCTGGGACTGGCCTGGG - Intergenic
1062248964 9:135584595-135584617 CCTGCTCCATGGTTTGGCCTGGG + Intergenic
1062269370 9:135701659-135701681 CCACATCCTGGGCTTGGCCTGGG - Intergenic
1062361805 9:136191770-136191792 TCTTCTCCTAGGTTTGGCCTTGG + Intergenic
1062365324 9:136205467-136205489 GCTGCCCCGGGGCACGGCCTGGG - Intergenic
1062460970 9:136662452-136662474 GCTGGTCCCTGCCTTGGCCTGGG + Intronic
1062590493 9:137272435-137272457 CCTGCATCTGGGCTGGGCCTGGG + Intronic
1062617237 9:137403410-137403432 GCTGCTGCTGGGCTGGGGGTGGG - Intronic
1186426373 X:9466154-9466176 GCTGCTCCTGGGCTCTGACGGGG + Intronic
1188393153 X:29645796-29645818 GCGGCTGCTGAGCTTGGCATAGG - Intronic
1189978691 X:46488071-46488093 TTTGTTCCTGGGCTTGGTCTGGG - Intronic
1190244237 X:48680395-48680417 GCTGCTCCTGGGCTACTCCCAGG + Intronic
1190962378 X:55265206-55265228 GCTGTCCTTGGGCTGGGCCTGGG - Intronic
1191257850 X:58287506-58287528 GCAGCCCCTGCGCTGGGCCTGGG + Intergenic
1191258279 X:58289239-58289261 GCAGCTCCTGTGCCAGGCCTGGG + Intergenic
1192182443 X:68924656-68924678 TCTGCTCCTGAGCTTTGCCCAGG + Intergenic
1193651582 X:84140800-84140822 TCTTTTCCTGGGCTTGGGCTTGG - Intronic
1195862391 X:109395875-109395897 CCTGGACCTGGGCTGGGCCTGGG - Intronic
1195898450 X:109772634-109772656 GCTGCTCCTTGGCATACCCTTGG + Intergenic
1196793256 X:119482854-119482876 GCTGCTTCTCGCCTCGGCCTGGG + Intergenic
1198122531 X:133608098-133608120 GCTGGACCTGAGATTGGCCTAGG + Intronic
1199061479 X:143360448-143360470 TCTGGTCCTGGGCTTTGCTTTGG + Intergenic
1200057297 X:153468362-153468384 GCTGTTCCTGAGCATGGCCTGGG + Intronic
1200303122 X:154998565-154998587 ACTGCTCCTGATCTTGGCATGGG + Intronic
1201525993 Y:14935208-14935230 GCTGCTTCTGCCCTTGGCCTAGG - Intergenic
1201765270 Y:17569089-17569111 GCTGCTCCTGTGTGTGTCCTGGG - Intergenic
1201836282 Y:18336900-18336922 GCTGCTCCTGTGTGTGTCCTGGG + Intergenic