ID: 1149679297

View in Genome Browser
Species Human (GRCh38)
Location 17:58493990-58494012
Sequence GAGGCAGTTGAGACCCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 520}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149679297_1149679299 -2 Left 1149679297 17:58493990-58494012 CCAATCTGGGTCTCAACTGCCTC 0: 1
1: 0
2: 5
3: 45
4: 520
Right 1149679299 17:58494011-58494033 TCATTAAAATTGTACACTGTTGG 0: 1
1: 1
2: 0
3: 23
4: 293
1149679297_1149679300 -1 Left 1149679297 17:58493990-58494012 CCAATCTGGGTCTCAACTGCCTC 0: 1
1: 0
2: 5
3: 45
4: 520
Right 1149679300 17:58494012-58494034 CATTAAAATTGTACACTGTTGGG 0: 1
1: 0
2: 1
3: 15
4: 249
1149679297_1149679302 4 Left 1149679297 17:58493990-58494012 CCAATCTGGGTCTCAACTGCCTC 0: 1
1: 0
2: 5
3: 45
4: 520
Right 1149679302 17:58494017-58494039 AAATTGTACACTGTTGGGCCGGG 0: 1
1: 0
2: 2
3: 16
4: 171
1149679297_1149679301 3 Left 1149679297 17:58493990-58494012 CCAATCTGGGTCTCAACTGCCTC 0: 1
1: 0
2: 5
3: 45
4: 520
Right 1149679301 17:58494016-58494038 AAAATTGTACACTGTTGGGCCGG 0: 1
1: 0
2: 2
3: 28
4: 259
1149679297_1149679303 12 Left 1149679297 17:58493990-58494012 CCAATCTGGGTCTCAACTGCCTC 0: 1
1: 0
2: 5
3: 45
4: 520
Right 1149679303 17:58494025-58494047 CACTGTTGGGCCGGGCGCAGTGG 0: 3
1: 7
2: 85
3: 681
4: 3889

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149679297 Original CRISPR GAGGCAGTTGAGACCCAGAT TGG (reversed) Intronic
900887778 1:5427640-5427662 GAAGCTGTTGAGACACAGAAGGG - Intergenic
900905086 1:5551481-5551503 GAGGAAGTTGAGGCACAGAGTGG - Intergenic
901204623 1:7486952-7486974 GAGGAAGCTGAGGCCCAGAGAGG - Intronic
901372179 1:8808579-8808601 GAGGAAACTGAGACCCAGAAAGG + Intronic
902336214 1:15756430-15756452 GTGGCAGCTGAGACCCTGAGTGG - Intergenic
902387235 1:16082906-16082928 GAGGAAGCTGAGGCCCAGAGAGG - Intergenic
902548350 1:17204741-17204763 GAGGCAGCTGAGTCACAGAGAGG + Intergenic
902584840 1:17432392-17432414 GGGGCAGTAGAGACCCAGGAAGG + Intronic
902677467 1:18018718-18018740 GAGGAAGCTGAGACTCAGAAAGG - Intergenic
902727686 1:18348120-18348142 GAAGAAATTGAGACCCAGAGAGG + Intronic
902924126 1:19684509-19684531 GAGGAAGTTGAGAGCCAGAGGGG - Intronic
902931594 1:19735314-19735336 GAGGAAGCTGAGGCCCAGAGAGG + Intronic
903457521 1:23497987-23498009 GAGGAAATTGAGACTCAGAGAGG - Intergenic
903463256 1:23533965-23533987 GAGGAAATTGAGACTCAGAATGG - Intergenic
903650248 1:24917545-24917567 GAGGGAGCTGAGGCCCAGAGAGG + Intronic
904029203 1:27523483-27523505 GAGGCAGAAAAGACCCAGAGAGG + Intergenic
904047553 1:27617616-27617638 GAGGAAGTTGAGGCTCAGAGAGG + Intronic
904078327 1:27856509-27856531 CAGGCAGTTGAGCCCCATCTTGG - Intergenic
904299072 1:29542500-29542522 GGGGAAGCTGAGACCCAGAGAGG - Intergenic
904399960 1:30249638-30249660 GAGGAAACTGAGACCCAGAGTGG + Intergenic
904417646 1:30372980-30373002 GAGGCAGCTGAGGCCCAGAGAGG - Intergenic
904524301 1:31121042-31121064 GAGGCAGCTGAGACCCAGAAAGG - Intergenic
904808473 1:33147867-33147889 GAGGAAGATGAGGCCCAGAGAGG - Intronic
904808588 1:33148844-33148866 GAGGAAACTGAGACCCAGAGGGG + Intronic
904935978 1:34129906-34129928 GAGGGAGCTGAGACTCAGAGAGG - Intronic
905176827 1:36141635-36141657 GAGGAAACTGAGACCCAGAATGG + Intronic
905317401 1:37092197-37092219 GAGGCATCTGAGAACCAGAAGGG + Intergenic
905348873 1:37330711-37330733 GAGGAAACTGAGACCCAGAGAGG - Intergenic
905481025 1:38262093-38262115 GGGGAAGTTGAGGCCCAGAGAGG - Intergenic
905884027 1:41482171-41482193 GAGGCAGCTCAGGCCCAGAGAGG - Intronic
905890520 1:41516032-41516054 GTGGAAGTTGAGACCCAGTGGGG + Intronic
906040365 1:42784428-42784450 GAGGCAGGTGAGCAACAGATGGG - Intronic
906518223 1:46452140-46452162 GAGGCAACTGAGGCCCAGAAAGG + Intergenic
906616416 1:47235637-47235659 GGGGAGGTTGAGACCCAGACTGG + Intergenic
906694454 1:47814685-47814707 AATGCAGATGAGACCCAGAATGG + Intronic
906937669 1:50228256-50228278 GAGGAAATTGAGACTCAGAGAGG - Intergenic
907183747 1:52592843-52592865 GGGGAAGCTGAGACCCAAATAGG - Intergenic
907460906 1:54604927-54604949 GATGCAGCTGAGACTCAGAGAGG + Intronic
908277573 1:62491474-62491496 CAGTCAGATGAAACCCAGATGGG - Intronic
908498039 1:64714622-64714644 GAGGAAGCTGAGACACAGAAAGG + Intergenic
908762830 1:67527548-67527570 GAGGAAACTGAGACCCAGAGAGG - Intergenic
908815065 1:68023316-68023338 GAGGAAATTGAGACTCAGAAAGG - Intergenic
909500338 1:76328051-76328073 GAGGCAGTTGAGGCTAGGATAGG + Intronic
909917570 1:81338736-81338758 GAGGAAATTGAGACACAGAGAGG + Intronic
910252674 1:85214220-85214242 GAGATAGCTGAGACCCAGAAGGG + Intergenic
910542615 1:88378137-88378159 GAGGAATTTAAGACCCAGAAAGG + Intergenic
910759932 1:90723879-90723901 GAGGCAGTTCAGCCCGAGAGGGG + Intergenic
911647403 1:100351739-100351761 GAGGGCGTGGAGAACCAGATGGG + Intronic
911850996 1:102820328-102820350 GAGCCAGTTGACAAACAGATGGG - Intergenic
912502711 1:110132846-110132868 GAGGCAGTTGGGGCCCAGAGAGG + Intergenic
912648410 1:111416638-111416660 GAGGCAGTTAAGACACATAAGGG - Intronic
913286070 1:117228043-117228065 GAGGAAATTGAGACTCAGAAAGG + Intergenic
913317467 1:117564998-117565020 GAGGAAGTTGAAATCCAGAGAGG - Intergenic
914450939 1:147790915-147790937 AAGGAAGTTGAGACCCTGAAAGG - Intergenic
915272459 1:154764402-154764424 GAGGATGTTGAGACACAGAGAGG - Intronic
916315497 1:163443947-163443969 GGGGCAGTTGAGAACGAGGTGGG + Intergenic
916726543 1:167528591-167528613 GAGAGAATTGAGACCCAGAAAGG + Intergenic
917082559 1:171271631-171271653 GGGGCAAGTGAGAGCCAGATGGG - Intronic
917979193 1:180259034-180259056 GAGGCAGTGGAGCCCCAGTCTGG + Intronic
918244586 1:182647710-182647732 GGGGAAATTGAGACCCAGAGAGG + Intronic
919842201 1:201617880-201617902 GAGGCAGTAGAGAGTGAGATGGG + Intergenic
920044763 1:203126191-203126213 GAGACTGTGAAGACCCAGATGGG - Intronic
920641389 1:207754698-207754720 GTGGCAGCTGAGAGCCAGAAAGG + Intronic
920801648 1:209194057-209194079 GAGGAAGCTGAGGCCCAGAGAGG - Intergenic
921245728 1:213237299-213237321 GAGGAAATTGAGACACAGAAAGG - Intronic
921290430 1:213651607-213651629 GAGGCACTTGAGATTCAGAGAGG + Intergenic
922350779 1:224733230-224733252 GAGAAAGTTGAGGCTCAGATGGG + Intronic
923550363 1:234958620-234958642 GAGGAAATTGAGGCCCAGAAAGG - Intergenic
923964780 1:239125304-239125326 CAGGCAGAAGTGACCCAGATGGG + Intergenic
924467753 1:244313637-244313659 TAAGCAGTTGAGATACAGATAGG - Intergenic
1067297781 10:44984623-44984645 TAGGAAGGTGAGACCCAGACAGG - Intronic
1067828864 10:49598469-49598491 CAGGCAGTTCAGGTCCAGATGGG - Intergenic
1068063659 10:52101677-52101699 AAGACAGCTGAGACCCAGACAGG + Intronic
1068958669 10:62844730-62844752 GAGGAAACTGAGACCCAGAGAGG + Intronic
1070113041 10:73503012-73503034 GATGTATTTGAGACCCAGTTAGG - Intronic
1070355653 10:75637749-75637771 AAGACAGCTGAGACCCAGAGGGG - Intronic
1071513535 10:86282309-86282331 GAGGCAACTGAGGCCCAGAGAGG - Intronic
1071728226 10:88220882-88220904 GAGGAAACTGAGACCCAGAGAGG + Intergenic
1072665578 10:97390200-97390222 GAGGCACCAGAGACTCAGATAGG + Intronic
1073340826 10:102743410-102743432 TGGGCAGTTGAGACCAAGAGAGG + Exonic
1073458422 10:103651611-103651633 GAGGAAGTTGAAGCCCAGAGAGG - Intronic
1073461730 10:103669331-103669353 GAGGAAACTGAGGCCCAGATTGG - Intronic
1073490937 10:103852929-103852951 GAGGAAATGGAGAGCCAGATTGG - Intronic
1073578638 10:104644278-104644300 GAGGCAGTTATTCCCCAGATTGG - Intronic
1073787028 10:106900854-106900876 GAGGGAGCTGAGGCACAGATAGG + Intronic
1074198312 10:111208451-111208473 GAGGCAGCTGAGGCCCAGAGAGG + Intergenic
1074524306 10:114250935-114250957 GAGGCAGGGGAGGCCCAGAGAGG + Intronic
1075730013 10:124630497-124630519 GAGGCAGTCCAGACTCAGAAGGG - Intronic
1075763241 10:124872501-124872523 GAGGCAGCTGGGTCCCTGATGGG - Intergenic
1076106451 10:127827393-127827415 GAGGAAACTGAGACCCAGAGAGG + Intergenic
1076391365 10:130105372-130105394 GAGGCAGCTGAAACGCAGAGGGG - Intergenic
1076576297 10:131471922-131471944 GAGGCAGTCGAGTAACAGATTGG + Intergenic
1076907123 10:133368392-133368414 GAGGGAGCTGAGACCCTGAGGGG - Intronic
1077167660 11:1151042-1151064 GAGGGAGCTGAGACCCTGCTGGG - Intergenic
1078425892 11:11251043-11251065 GTGGCAGTTGAGATCCCCATCGG - Intergenic
1078527787 11:12113233-12113255 GAGGAAGCTGAGACCCAGAAAGG + Intronic
1079075878 11:17385421-17385443 GAGGCAACTGAGACACAGAGAGG + Intergenic
1079130067 11:17742088-17742110 GAGGAAGTTGAGGCCCAGAGAGG + Intronic
1079249913 11:18779881-18779903 GAGGAAATTGAGACTCAGAGAGG - Intronic
1079367523 11:19822218-19822240 GAGGCAACTGAGTCTCAGATAGG + Intronic
1080007646 11:27426750-27426772 GAGGGAACTGAGACCCAGAGGGG + Intronic
1080573991 11:33581534-33581556 GAGGAAACTGAGACCCAGAGAGG - Intronic
1080648278 11:34203091-34203113 GGGGCAGCTGAGATCAAGATCGG - Intronic
1080889426 11:36396704-36396726 GAGGAATTTGAGACTCAGAGAGG + Intronic
1081640509 11:44750099-44750121 GATGAAATTGAGACCCAGAAAGG + Intronic
1082784738 11:57310703-57310725 GAGGACGCTGAGACCCAGAGTGG - Intronic
1082814349 11:57498504-57498526 GAGACAATTGAGACCCAGGGAGG + Intronic
1082894519 11:58176034-58176056 GAGGCACTTGACTCCCAGAGAGG + Intronic
1083298222 11:61726678-61726700 CAGGCAGCTGAGGCCCAGAGAGG + Intronic
1083439671 11:62667585-62667607 GAGCCTGTTGAGTCCCAGAAGGG + Exonic
1083623509 11:64060303-64060325 GAGGAAACTGAGGCCCAGATCGG - Intronic
1083739090 11:64698459-64698481 GAGGCAGTAGGGACTCAGAGAGG - Intronic
1083792784 11:64996712-64996734 GAGGAAAGTGAGACCCAGAGAGG + Intronic
1083887750 11:65581120-65581142 CAGGCAGGTGAGACCCAGGCTGG + Exonic
1084591643 11:70093970-70093992 GGGGACGTTGAGACCCAGAGAGG - Intronic
1084913545 11:72410305-72410327 GAAGCAGTTGAGATTCAGAGAGG - Intronic
1085468213 11:76738492-76738514 GAGGCAATGGAGACACAGAAAGG + Intergenic
1085468931 11:76744403-76744425 GAGGAAGCTGAGGCCCAGAGAGG - Intergenic
1088067813 11:105742469-105742491 GAGTCAGTAGAGAGCAAGATAGG - Intronic
1088594563 11:111430734-111430756 GAGGAAACTGAGACCCAGAAAGG + Intronic
1088767528 11:112998100-112998122 GAGGAACTTGAGGCCCAGAAAGG + Intronic
1089806079 11:121091672-121091694 GAGGAAGTTGATGCACAGATAGG + Intergenic
1089965455 11:122651685-122651707 AAGGAAGTTGAGGCCCAGAGAGG + Intergenic
1090876058 11:130789825-130789847 GAGGCTCTGGAGACCCTGATGGG - Intergenic
1091681592 12:2531417-2531439 GAGGAAATTGAGGCCCAGAGAGG - Intronic
1091796779 12:3301810-3301832 CAGAAAGTTGAGACCCAGAGAGG - Intergenic
1092059513 12:5536985-5537007 GAGGGAGCTGGGATCCAGATCGG + Intronic
1092899330 12:13044196-13044218 GAGGCAAGTGAGACTCAGAGTGG + Intergenic
1094054464 12:26255607-26255629 GTGCCACTTGAGACCCACATGGG + Intronic
1094056646 12:26275058-26275080 GGGGCATTTGAAGCCCAGATGGG + Intronic
1094174884 12:27531205-27531227 GAGAAAGCTGAGACCCAGAGAGG - Intronic
1094495184 12:30984878-30984900 CAGAAAGTTGAGACCCAGAGAGG + Intronic
1095481526 12:42641178-42641200 GAGGCATTTGAGGCACAGAAAGG + Intergenic
1095964995 12:47861018-47861040 GAGGGAGCTGAGGCCCAGAGAGG + Intronic
1096484865 12:51972915-51972937 TGGGTAGTTGAGGCCCAGATAGG + Intronic
1096523540 12:52197557-52197579 CAGGCCGTTGAGGCCCAGAGAGG - Intergenic
1096965796 12:55626490-55626512 GAGGCAGAGGAGAACCAGACAGG + Intergenic
1098007875 12:66018575-66018597 GAGGAAATTGAGACTCAGAGAGG + Intergenic
1098034281 12:66286559-66286581 GAGGCAGCTGAGACCAGGGTGGG + Intergenic
1099333434 12:81322043-81322065 TAGGCATTTGAGACCCAGCCTGG - Intronic
1100682851 12:96947953-96947975 GACGCAGTGAAGACCCAGAGTGG + Intronic
1100712857 12:97276108-97276130 GAGGCAACTGAGGCCCAGAGAGG - Intergenic
1100855715 12:98755692-98755714 GAGGCAGTGGAGGCTCAGAGGGG + Intronic
1101037631 12:100720896-100720918 GAAGAAGTTGAGGCACAGATAGG + Intronic
1101330763 12:103755903-103755925 GAGGAAATTGAGTCCCAGAGAGG - Intronic
1101424409 12:104576242-104576264 GTGGAAGCTGAGACCCAGAGAGG + Intronic
1101445657 12:104735225-104735247 GAGGCAACTGAAACCCAGAGAGG - Intronic
1101648729 12:106655458-106655480 GTGGCAGTGGGGACCCAGAAAGG + Intronic
1101982726 12:109421675-109421697 GAGGAAGCTGAGACCCAGACAGG + Intronic
1102040217 12:109796213-109796235 GAAGAAGCTGAGACCCAGAGAGG + Intronic
1102050463 12:109858169-109858191 GAGGAAGCTGAGACTCAGAGGGG - Intronic
1102194511 12:111015226-111015248 GAGGAAACTGAGACTCAGATAGG + Intergenic
1102460583 12:113097315-113097337 GATGCAACTGAGACACAGATGGG - Exonic
1102601000 12:114030331-114030353 GAGGCAGTTAGGGCCCAGCTGGG + Intergenic
1102674390 12:114646963-114646985 GAGGAAACTGAGACCCAGAAGGG + Intergenic
1102915738 12:116750403-116750425 GAGGCAGCAGAGACCAACATGGG + Intronic
1103284134 12:119786153-119786175 GAGGAAATTGAGGCCCAGAGAGG + Intronic
1103720813 12:122974465-122974487 GAGGAAACTGAGACCCAGAGAGG - Intronic
1103985287 12:124762970-124762992 GAGGAAGTTGAGGCTCAGAGAGG + Intergenic
1104047384 12:125173015-125173037 GAGGAAGGTGAGGCCCAGACAGG - Intergenic
1105620543 13:22061740-22061762 TAGGCAGGTCAGGCCCAGATGGG - Intergenic
1105804305 13:23942020-23942042 GAGGAAGTTGAGGCACAGAAAGG - Intergenic
1107425251 13:40286701-40286723 GAGGCAGCTGTGAGCCACATTGG - Intergenic
1107453891 13:40536847-40536869 GAGGCAAATGTGACCCAGGTAGG - Intergenic
1107578252 13:41750991-41751013 GAGGCTGCTGAGACACAGAGAGG - Intronic
1107595553 13:41960233-41960255 GAGGTAATTGAAACCCAGAAGGG - Intronic
1107903819 13:45044083-45044105 GGTGCAGAGGAGACCCAGATGGG - Intergenic
1108622429 13:52196854-52196876 AAGGCAACTGAGACCCAGAGAGG - Intergenic
1108714114 13:53061902-53061924 AAGGAAATTGAGACCCAGAGAGG + Intergenic
1112440655 13:99422384-99422406 GAGGATGCTGAGACCCAGAGAGG + Intergenic
1112600837 13:100854372-100854394 AGGGCAGTGGAGACCCAGCTCGG + Intergenic
1113796810 13:113063189-113063211 GAGGCAGCTGAGACACAGAGTGG + Intronic
1114251023 14:20960531-20960553 GAGGCAGTAGAGAAAGAGATGGG + Intergenic
1115524311 14:34264285-34264307 GAGGAAACTGAGACCCAGAGAGG - Intronic
1117541512 14:56751000-56751022 GAGGCACTTGAGACTCAGAGAGG - Intergenic
1118554407 14:66999033-66999055 GAGGAAATTGAGACGCAGAGAGG + Intronic
1118805988 14:69237380-69237402 GAGGAAGCTAAGACACAGATGGG + Intronic
1119646994 14:76355183-76355205 GAGGCGGTAGAGACCCAAGTAGG + Intronic
1121223578 14:92304949-92304971 GAGGAAATTGAGACTCAGATGGG + Intergenic
1121436222 14:93921881-93921903 GAGGAAGTTGAGGCACAAATTGG - Intronic
1121989356 14:98540345-98540367 GAGAAAGTTGAGACCCAGGGAGG + Intergenic
1122357494 14:101132384-101132406 CAGGCATTTGAGGCCCACATGGG + Intergenic
1123030380 14:105448679-105448701 CAGGCTTTTGAGGCCCAGATAGG + Intronic
1123434751 15:20247006-20247028 GAGGAAACTGAGACCCAGAGCGG - Intergenic
1124136737 15:27042155-27042177 GAGGCAGATGGGACCCACATGGG - Intronic
1125414921 15:39442386-39442408 GAGGAAGTTAAGCCCCAGAGAGG + Intergenic
1126065822 15:44825480-44825502 GAGGAAATTGAGGCTCAGATTGG - Intergenic
1126094012 15:45075086-45075108 GAGGAAATTGAGGCTCAGATTGG + Exonic
1126732743 15:51700913-51700935 GAGGAAATTGAGGCCCAGAAAGG - Intronic
1126738635 15:51755991-51756013 CAGGCAGTTAAAACCCAGAAAGG + Intronic
1126963282 15:54022845-54022867 GAAGCAGTAGAGAACCAGCTAGG + Intronic
1127670865 15:61193747-61193769 GTGGAAATTGAGACCCAGAGAGG + Intronic
1127982321 15:64044513-64044535 GAGGAAGCTGAGATCCAGAAAGG + Intronic
1128178616 15:65580220-65580242 GAGGCCTTTGAGACCCAGAGAGG - Intronic
1128531119 15:68448697-68448719 GAAGCAGCTGAGGCTCAGATAGG - Intergenic
1128682179 15:69660185-69660207 GAGGCAGTGCTGGCCCAGATTGG + Intergenic
1129239343 15:74242399-74242421 GAGGAAATTGAGGCCCAGACAGG - Intronic
1129268547 15:74407759-74407781 GAGGCTGCTGAGGCCCAGAGAGG + Intergenic
1131025311 15:89136538-89136560 GGGGCAAGTGAGAGCCAGATGGG - Intronic
1131035640 15:89220303-89220325 GAGGAAACTGAGACCCAGAAAGG - Intronic
1132148744 15:99444677-99444699 GAGGAAATTGAGACTCAGAGAGG + Intergenic
1132367365 15:101267241-101267263 GGGGCAGTTTTGATCCAGATGGG + Intergenic
1132809995 16:1792899-1792921 CAGGCAGGTGAGACCCCGCTGGG - Intronic
1133583635 16:7170482-7170504 GAGGAATTTGAGACCAATATGGG - Intronic
1135032045 16:19046206-19046228 GAGGGAGTTTGAACCCAGATCGG - Intronic
1135139286 16:19907887-19907909 AAGGCACTTGAGACTCAGAGAGG + Intergenic
1135330469 16:21555933-21555955 GAGGAAATTGAGACGCAGAGAGG + Intergenic
1135768274 16:25196807-25196829 AAGGGAGCTGAGACCCAGAGAGG - Intergenic
1135985332 16:27179679-27179701 GCGGCAGCTGGGACCCAGTTAGG + Intergenic
1136849874 16:33604104-33604126 GAGGAAACTGAGACCCAGAGCGG + Intergenic
1136933852 16:34440741-34440763 GAGGGGGTTGAGATCCAGAGGGG - Intergenic
1136970720 16:34971073-34971095 GAGGGGGTTGAGATCCAGAGGGG + Intergenic
1137464159 16:48692860-48692882 GAGGAAATTGAGTCTCAGATAGG - Intergenic
1137524187 16:49219441-49219463 GTGGAACTTGAGACCCAGAGAGG - Intergenic
1137598882 16:49742984-49743006 GGGGCAGCTGAGGCCCAGAGAGG - Intronic
1137804993 16:51296644-51296666 GAGGCAATTGACAGCCATATCGG + Intergenic
1138186257 16:54980100-54980122 AAGGAAGCTGAGACCCAGAGAGG + Intergenic
1138193393 16:55034628-55034650 GGGGCAGTTGGGGCCCAGACCGG - Intergenic
1138233711 16:55361384-55361406 GAGGAAGCTGAGGCCCAGAGAGG - Intergenic
1138236293 16:55385965-55385987 GGGGAAGCTGAGACCCAGAAAGG - Intergenic
1138584631 16:57962059-57962081 GAGGCAGTTGAAACCAAGCAGGG + Intronic
1138591601 16:58002139-58002161 GAGGCATTTGAGGCCCAGAAAGG + Intronic
1138635543 16:58335093-58335115 GAGGCAGCTGAGGCCTAGAGAGG + Intronic
1139651473 16:68364327-68364349 GAGGAAGCTGAGACTCAGAGAGG - Intronic
1139663923 16:68442825-68442847 GAGTCAGAGCAGACCCAGATGGG + Intronic
1140472296 16:75222706-75222728 CAGGCAGGTGAGGCCCAGGTGGG + Intronic
1140872961 16:79123560-79123582 AAGGACGTTGAGACCCAGAAGGG + Intronic
1141131734 16:81442219-81442241 GAGGAAGTTGAGGCTCAGACAGG - Intergenic
1141424530 16:83936401-83936423 GAGGAAACTGAGACCCAGAGTGG + Intronic
1141428207 16:83957152-83957174 GAGGAAACTGAGACCCAGAGAGG + Intronic
1141795417 16:86270179-86270201 GAGGCAAATGAGGCCCAGAAAGG + Intergenic
1142043491 16:87910397-87910419 GAGGAAATTGAGACGCAGAGAGG + Intronic
1203111485 16_KI270728v1_random:1452557-1452579 GAGGAAACTGAGACCCAGAGCGG + Intergenic
1142769124 17:2084096-2084118 GAGGCAAGTGAGGCCCAGAGAGG - Intronic
1143007100 17:3844285-3844307 GAGGAAACTGAGACCCAGAGAGG - Intronic
1143288283 17:5808884-5808906 GTGGCAGCTGAGAGCCAGAATGG + Intronic
1143327268 17:6107625-6107647 GAGGTACCTGAGACACAGATGGG + Intronic
1143368850 17:6425891-6425913 GAGGCTGGTGAGTCCCAGCTGGG - Intronic
1143583729 17:7841081-7841103 GAGGAAATTGAGGCCCAGAGAGG - Intronic
1143599482 17:7934888-7934910 GAGGAAACTGAGACCCAGAGAGG - Intronic
1143695401 17:8611739-8611761 GAGGAATGTGAGACCCAGATGGG + Intronic
1144344188 17:14335169-14335191 GAGGAAGCTGAGGCCCAGAAAGG + Intronic
1145305277 17:21670733-21670755 GAGGAAGTGGAGACCTAGAAAGG - Intergenic
1145885685 17:28381097-28381119 GAGGCCGGTGAGGCCCAGAGAGG + Intronic
1146255795 17:31391190-31391212 GAGGAAGCTGAGGCCCAGAGAGG - Intergenic
1146641026 17:34541615-34541637 GGGGCAATTGAGGCCCAGAAAGG - Intergenic
1147038697 17:37700899-37700921 GAGAAAGTTCAGACCCAGAGAGG + Intronic
1147217212 17:38907921-38907943 GAGGAAACTGAGACCCAGAGGGG + Intronic
1147683773 17:42275157-42275179 GAGGAAACTGAGGCCCAGATAGG - Intronic
1148086149 17:44995012-44995034 GAGGCAGAGGAGGCCCAGAAGGG + Intergenic
1149277159 17:55054623-55054645 GAGGAAGCTGAGACCCATAAAGG - Intronic
1149412023 17:56418665-56418687 GAGGAAACTGAGACCCAGAAAGG + Intronic
1149432404 17:56604924-56604946 GAGGAAATTGAGACCCATAGAGG + Intergenic
1149679297 17:58493990-58494012 GAGGCAGTTGAGACCCAGATTGG - Intronic
1150487603 17:65554749-65554771 GAGGCAGATGAGCCCCACCTTGG + Intronic
1150983432 17:70169282-70169304 GAGGAAGTTGCGGCCCAGCTGGG - Intronic
1151096712 17:71507358-71507380 GAGGCAGTAGAGATTGAGATGGG - Intergenic
1151577615 17:74960614-74960636 GAGGAAGCTGAGACCCAGAGAGG + Intronic
1152272719 17:79334417-79334439 GAAGCAGTGGATACCCAGAAAGG - Intronic
1152292066 17:79445666-79445688 GAGGCAGAAGAGTCCAAGATGGG + Intronic
1153693927 18:7621167-7621189 GAGGCAGTAGAGGCACAGAGAGG + Intronic
1154104675 18:11511274-11511296 GAGGAAATTGAAACCCAGAAAGG - Intergenic
1154417066 18:14183353-14183375 GAGGAAGTTGAGACACAGAAAGG + Intergenic
1155422587 18:25671152-25671174 GAGGCAGTTAATAGACAGATGGG + Intergenic
1157284760 18:46370119-46370141 AAGGAAGTGGGGACCCAGATTGG - Intronic
1157496381 18:48160489-48160511 GAGGCCCTTGAGACCCAGAGCGG - Intronic
1157678043 18:49582066-49582088 GAGGAAGTTGAGGCTCAGAGAGG + Intronic
1157701511 18:49763922-49763944 GAGGCTCCTGAGACCCAGAGAGG - Intergenic
1157731554 18:50008560-50008582 GAGGGAGTTGAGCCTCAGACAGG + Intronic
1157747764 18:50151396-50151418 GAGGGTGCTGAGACCCAGAATGG - Intronic
1158195876 18:54884465-54884487 AAGGCAGTTGAGTCCCAAAGCGG - Intronic
1158687345 18:59626625-59626647 GAAGCAATTGAGGCCCAGAGAGG + Intronic
1158908111 18:62033945-62033967 GAATCAGTTGAGACTCAGAGGGG + Intergenic
1160754932 19:752126-752148 GAGGGAGCTGGGACCCAGAGAGG - Intronic
1160991445 19:1862004-1862026 GAGAAAATTGAGACCCAGATCGG + Intronic
1161082334 19:2317514-2317536 GAGGCAGCTGAGGCCCAGAGAGG - Intronic
1161347504 19:3775583-3775605 GAGGCTGCTGAGGCCCAGAGAGG + Intergenic
1161356612 19:3822784-3822806 GCGGCAGTTCAGACCCCGGTTGG - Intronic
1161512148 19:4677773-4677795 CAGGCAGCTGGGACCCAGAGTGG - Intronic
1161845623 19:6710469-6710491 GAGACAGTTGAGAGACAGAGAGG + Intronic
1161867548 19:6844613-6844635 GAGGAAATTGAGGCCCAGAGAGG + Intronic
1162137466 19:8564553-8564575 CAGGCAGGGGAGGCCCAGATGGG + Intronic
1162997698 19:14346743-14346765 GAGGCAACTGAGGCCCAGACAGG + Intergenic
1163092727 19:15032284-15032306 GAAGCTGCTGAAACCCAGATAGG + Intergenic
1163522511 19:17799844-17799866 GAGGAAACTGAGGCCCAGATAGG - Intronic
1164290363 19:23862819-23862841 GAGGGAATAGAGACCCAGAGAGG - Intergenic
1164888795 19:31805467-31805489 GAAGCAGGTGAAACCCAGAGAGG - Intergenic
1165030990 19:32998137-32998159 GAGGAAACTGAGACCCAGAGAGG - Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1166154369 19:40899872-40899894 GAGGCAGCTGAGGCCCAGTGGGG + Intergenic
1166301868 19:41915616-41915638 GAGACAGATGAGACAGAGATGGG - Intronic
1166992070 19:46698597-46698619 GAGGGAGGTGAGGCCCAGAGAGG - Intronic
1167526338 19:49986456-49986478 GAGACAGATGAGACGCAGAGTGG + Intronic
1167668702 19:50837635-50837657 GAGGCAGCTGAGGCACAGAGAGG - Intergenic
1167793416 19:51694153-51694175 GAGGGAATAGAGACCCAGAGAGG + Intergenic
1167803846 19:51765343-51765365 GAGGAAGTTAAGACTTAGATGGG - Intronic
1168079309 19:53997976-53997998 GAGGAACTAGAGACCCAGAGAGG + Intronic
1168325234 19:55535535-55535557 GAGGAAGCTGAGACTCAGAGAGG + Intronic
1168407970 19:56120718-56120740 GGGGAAGTTGAGGCCCAGGTGGG - Intronic
1168652095 19:58097949-58097971 GAGGTGGCTGAGATCCAGATCGG - Intronic
925171659 2:1753997-1754019 GAGGAACATGAGACACAGATGGG + Intergenic
925915325 2:8600461-8600483 TAGGCAGTTGTGGCCCAGAAGGG - Intergenic
926339257 2:11891208-11891230 AAGGCAGATGAGGCCCAGAAAGG - Intergenic
926518082 2:13874865-13874887 GAGGCAGTTGAGCCTGGGATAGG - Intergenic
926729124 2:16021765-16021787 GAGGGAGCTGAGGCCCAGAGAGG + Intergenic
927004891 2:18837953-18837975 GAGGAAATTGAGGCCCAGATTGG - Intergenic
927054352 2:19355876-19355898 GAGGAAGCTGAGACCCATTTGGG + Intronic
929423212 2:41816231-41816253 GGGACAGGTGAGAACCAGATGGG + Intergenic
929553503 2:42909052-42909074 GAGGGAGTTGGGACCAAGGTGGG + Intergenic
930463174 2:51710053-51710075 GAGACAGTGGAGACTCAGAAGGG + Intergenic
930731187 2:54729547-54729569 GAGGCAGCTGAGGCACAGAGAGG + Intronic
931867092 2:66425322-66425344 AAGCAAGCTGAGACCCAGATAGG - Intergenic
932071649 2:68626571-68626593 GAGAAAATTGAGACCCAGAGAGG + Intronic
932381400 2:71287133-71287155 GAGGCTGTTAAGACCCAGCTAGG + Intronic
933748822 2:85590211-85590233 CAGGCATTTGAAACCCAAATAGG - Intronic
934500176 2:94853927-94853949 GAGGAAGTTGAGGCACAGAAAGG - Intergenic
935173243 2:100626942-100626964 GAGGCAGTAGATATCCACATAGG + Intergenic
935824519 2:106931349-106931371 GAGGGACTTGAGACCCAGCGAGG - Intergenic
936096594 2:109534986-109535008 GAGTGAGTTGAGAGCCAAATGGG - Intergenic
936528561 2:113259020-113259042 GAGGCAAGTGAGACACACATGGG + Intronic
936529822 2:113268409-113268431 GAGGAAACTGAGACCCAGAGAGG - Intronic
936715994 2:115188292-115188314 GAGCTAGTTGAGACTAAGATTGG + Intronic
937049576 2:118877210-118877232 GAGGCAGTCTAGAGCCAGATGGG - Intergenic
938065899 2:128281893-128281915 GAGGAAACTGAGACCCAGAGAGG + Intronic
939471124 2:142621932-142621954 GAAGAAGTTGAGACCCAGATAGG + Intergenic
940213612 2:151281556-151281578 GAAGCAGGTAAGACCCAGAAGGG - Intronic
940887318 2:159000970-159000992 GAGGCAGCTGAGGCCCAGAGAGG + Intronic
942506277 2:176644879-176644901 GAGGAAACTGAGACCCAGAGAGG + Intergenic
943305345 2:186254934-186254956 GAGGAAATTGAAACACAGATAGG - Intergenic
944528353 2:200642878-200642900 GAGGAATTTGAGACCCAGAGGGG + Intronic
946707042 2:222468458-222468480 GAGGCTGTTGAGGCTCAGAAAGG + Intronic
947284845 2:228502402-228502424 AAGGCAGTAGATTCCCAGATCGG - Intergenic
947533126 2:230925259-230925281 AAGGAAGTCGAGACCCAGAGAGG - Intronic
947576372 2:231278210-231278232 GAGGAAACTGAGGCCCAGATTGG + Intronic
947650499 2:231782103-231782125 GAGGAAATTGAGGCCCAGAGAGG + Intronic
948514827 2:238497448-238497470 GAGGCAGCTGGTACCCTGATGGG + Intergenic
1168760974 20:349251-349273 GAGGAAACTGAGACCCAGAAAGG + Exonic
1170217842 20:13910155-13910177 GAGGAAATTGAGACCCAGAGAGG + Intronic
1171357566 20:24561217-24561239 GAGGCAGAAGAGAGCCAGACAGG - Intronic
1171891397 20:30720609-30720631 GAGGAAGTTGAGACACAGAAAGG - Intronic
1172013047 20:31857553-31857575 GAGGCAGATGAGGCCCAGGAGGG - Intronic
1172014791 20:31866893-31866915 TTGGCAGTTGAGGCCCAGAGAGG - Intronic
1172201048 20:33126198-33126220 GAGGGAATTGAGGCCCAGAGAGG + Intergenic
1172225673 20:33303808-33303830 GAGGCAGGTGAGGCCCAGAGAGG + Intronic
1172623168 20:36332715-36332737 GAGGAAGTGGAGACTCAGAGGGG + Intronic
1172767901 20:37360877-37360899 GAGGCAGTGGAGGCACAGAGAGG + Intronic
1172773752 20:37395854-37395876 GAGGAAACTGAGGCCCAGATAGG + Intronic
1173396703 20:42686959-42686981 GAGGCAGTTTAGACACAAAGAGG - Intronic
1173736306 20:45363821-45363843 GAGGCAGCTGAGGCTCAGAAAGG - Intronic
1173848246 20:46201394-46201416 GGGGGAGTTGAGGCCCAGAGAGG - Intronic
1173895569 20:46548200-46548222 GAGACAGCTGAGACACAGAAAGG - Intronic
1174736885 20:52973198-52973220 GAGGCGGAGGAGACCCAGAGAGG + Exonic
1175104457 20:56604642-56604664 GTGGCAGTTGGGACCCCCATGGG - Intergenic
1175245253 20:57578368-57578390 GAGGGAGTTGAGACACAGAGAGG - Intergenic
1175471103 20:59229332-59229354 AAGGCCCTTGAGACCTAGATTGG + Intronic
1175864086 20:62165340-62165362 GAGGCAACTGAGACCCAGGCTGG - Intronic
1176856269 21:13975917-13975939 GAGGAAGTTGAGGCACAGAAAGG - Intergenic
1176868322 21:14068332-14068354 GAGGAAGTTGAGGCACAGAAAGG + Intergenic
1177145196 21:17399647-17399669 GAGGCAGTAGAGACACATCTAGG + Intergenic
1177168315 21:17627825-17627847 GAGAAAATTAAGACCCAGATTGG + Intergenic
1178339764 21:31776227-31776249 GAGGAAGCTGAGGCCCAGAGAGG + Intergenic
1178508920 21:33185807-33185829 GAAGTAGTTGAGTCCCAGAGTGG - Intergenic
1178881516 21:36453862-36453884 GAGGCAGTGAAGGCCCAGAATGG - Intergenic
1178965884 21:37117291-37117313 GAAGCAATTGAGTCCCAGAGAGG + Intronic
1181533224 22:23528955-23528977 GAGGAAACTGAGGCCCAGATAGG + Intergenic
1181857443 22:25792211-25792233 GAGGCAATGGAGACTCAGAGAGG - Intronic
1182031367 22:27161955-27161977 GGGGAAGTTGAAACCCAGAGAGG + Intergenic
1182097418 22:27635444-27635466 GAGGCAACTGAGACCAAGAGAGG - Intergenic
1182361979 22:29752097-29752119 GAGGCAACTGAGGCCCAGACAGG + Intronic
1182565930 22:31199271-31199293 GAGGAAACTGAGGCCCAGATAGG + Intronic
1182639407 22:31754287-31754309 GAGGCCGTTGAGGCTCAGAGAGG - Intronic
1182830935 22:33304092-33304114 GGGGCAGCAGAGACCCAGAAAGG - Intronic
1182941459 22:34281396-34281418 GTGGTAGTAGAGAACCAGATTGG + Intergenic
1183015653 22:34984277-34984299 CAGTGAGTTGAGGCCCAGATAGG + Intergenic
1183090902 22:35521157-35521179 GAGGAAACTGAGACACAGATGGG - Intergenic
1183301722 22:37062101-37062123 GAGGCAATTGTGGCCCAGAGAGG - Intronic
1183660782 22:39219890-39219912 GGGGCAAGTGAGCCCCAGATTGG - Intergenic
1184688296 22:46106206-46106228 GAGGCAGCTGAGGCCCAGAGGGG + Intronic
1184715823 22:46281227-46281249 GCGGCAGCTGAGGCCCAGAGAGG + Intronic
1184799555 22:46751414-46751436 GGGGAAGGTGAGACCCAGAGAGG + Intergenic
1184887888 22:47357532-47357554 GAGGCAGTTGAGGCCCATGGAGG + Intergenic
950171332 3:10840941-10840963 GAGGAAGCTGAGACTCAGAGAGG + Intronic
950202635 3:11055853-11055875 GAGGAAGATGAGGCCCAGAGAGG - Intergenic
950486207 3:13275442-13275464 GGGCCAGGTGAGGCCCAGATGGG - Intergenic
950660872 3:14466332-14466354 GAGGCAGCTGAGACCCAGAGTGG + Intronic
950722118 3:14890943-14890965 GAGGAAATTGAGACTCAGACAGG + Intronic
951870841 3:27360469-27360491 GAGGAAATTAAGACCCAGAGAGG + Intronic
952844835 3:37679537-37679559 GAAGAAGTTGAGCCCCAGAAAGG - Intronic
953341327 3:42136414-42136436 AAGGCATTTGAGACCAAGCTGGG + Intronic
953395267 3:42564320-42564342 GAGTCAGTAGACACACAGATAGG - Intronic
954330728 3:49888825-49888847 GAGGAAATTGAGGCCCAGAGAGG + Intronic
955095311 3:55790988-55791010 GAGGAAGCTGAGGCCCAGGTGGG - Intronic
955801143 3:62687913-62687935 GAGGAAATTGAGACCCAGAAAGG + Intronic
956606626 3:71079258-71079280 GAGCCAGTTGAGACCTAGGTGGG - Intronic
957909783 3:86606391-86606413 GAGGAAACTGAGCCCCAGATTGG - Intergenic
958683009 3:97354654-97354676 GAGGCAGTAGAGAGAGAGATCGG + Intronic
959576407 3:107939068-107939090 GAGGCTGCTGAGACCAAGGTAGG + Intergenic
959597642 3:108145430-108145452 GTGACAGTGGAGAACCAGATAGG - Intergenic
960423787 3:117481435-117481457 GAGGAAGTTGAGGCTCAGAGAGG + Intergenic
960952103 3:123005984-123006006 GAGGAAGTTGAGGCTCAGAGAGG - Intronic
961002081 3:123380675-123380697 GAGGCAGCTGAGGCACAGACAGG - Intronic
961123672 3:124396539-124396561 GAAGCAGCTGAGGCCCAGAGAGG - Intronic
961325876 3:126109037-126109059 GAGGCAGAGGAGGCCCAGAGTGG + Intronic
961379528 3:126487970-126487992 GTGGCAGGGGAGACCCAGAGAGG + Intronic
961386834 3:126527529-126527551 CGGGCACTTGAGACCCAGACCGG - Intronic
961594220 3:128004456-128004478 GAGGAAGTTGAGGCACAGAGAGG - Intergenic
961664823 3:128488624-128488646 GAGGCCGTGGAGACCCGGACTGG + Intronic
962216995 3:133531289-133531311 GAGGAAATTGAGACCCAGAGAGG - Intergenic
962929588 3:140024074-140024096 GAAGTAACTGAGACCCAGATTGG - Intronic
963718323 3:148830419-148830441 GAGGAAGTTGAGACCCAGAGAGG - Intronic
966678482 3:182614901-182614923 GAAGGAATTGAGGCCCAGATAGG - Intergenic
967000176 3:185326598-185326620 GAGTCAGCTGAGACCCAGAGAGG + Intronic
967070419 3:185958024-185958046 GGGGAAATTGAGACACAGATAGG - Intergenic
967370400 3:188738383-188738405 GAGGTAGTTTATACCCAGATAGG + Intronic
967666358 3:192177188-192177210 GAGGAAGTTGAGGCTCAGAGAGG - Intronic
967882880 3:194314215-194314237 GGGGAAATTGAGACCCAGAGAGG - Intergenic
967988349 3:195112967-195112989 GCTGCAGTTGAAACCCAGATTGG - Intronic
969319032 4:6399888-6399910 GGGGCAGTTGAGCCAAAGATGGG + Intronic
969323975 4:6430285-6430307 GAGGAAGCTGAGGCCCAGAGAGG + Intronic
969377229 4:6770943-6770965 GAGGCAATTGAGGCTCAGAGAGG - Intergenic
969564728 4:7971097-7971119 GAGGCAGTGGAGACTCAGCCAGG - Intronic
969840157 4:9875688-9875710 GAGGAAGTTGAGACTCAGAGCGG - Intronic
970324350 4:14907807-14907829 GAGGAAAGTGAGACTCAGATGGG + Intergenic
970876283 4:20874180-20874202 GAGGAAATTGAGGCCCAGAAGGG + Intronic
972890487 4:43551424-43551446 GAGGCAGCTGAGGCCCAGCGTGG - Intergenic
972936748 4:44145800-44145822 GAGGAAACTGAGACCCAGAAAGG + Intergenic
973032923 4:45366336-45366358 AAGGAAGTTGAGACCCAGAGAGG + Intergenic
973345691 4:49052324-49052346 GAGGCACTTGAGGCTCAGAGAGG - Intronic
973768453 4:54185507-54185529 GAGGCAATTGAGGCTCAGAGTGG + Intronic
973775530 4:54237991-54238013 GTGGCAGTTGAGGCTCAGAGAGG - Intronic
973777285 4:54255136-54255158 GGGGCAGTTGAGGCTCAGAGAGG - Intronic
975250325 4:72170815-72170837 GAGGCAGTTGACATCTAAATAGG + Intergenic
975695655 4:77010189-77010211 GAGGAAATTGAGACACAGAGAGG + Intronic
975792047 4:77963875-77963897 GGGGCAAGTGAGAGCCAGATGGG + Intergenic
975886541 4:78973065-78973087 GATGGGCTTGAGACCCAGATTGG + Intergenic
977954817 4:103014898-103014920 GAGGAAATTGAGACTCAGAGAGG - Intronic
978238405 4:106487755-106487777 GAGGTGGTTGAGACCCTAATTGG + Intergenic
980204428 4:129699126-129699148 GAAGAAGTTGAGGCCCAGAGAGG - Intergenic
981070794 4:140535966-140535988 GGAGCAGTTGAGATCCAGAGAGG + Intronic
981084277 4:140667104-140667126 GAAGCAGGTGAGACCCAAGTTGG + Intronic
982162128 4:152580922-152580944 GAGGAAATTGAGGCCCAGAAAGG + Intergenic
983908405 4:173208645-173208667 GAAGCAGATGAGAGCCAGCTGGG - Intronic
985855826 5:2425908-2425930 GATGCAGGTGAGACTCAGAGTGG + Intergenic
985989723 5:3545731-3545753 GAGGCAGCTGAGGCCTAGAGAGG + Intergenic
989362873 5:40623520-40623542 GAGGCAGTTGAGAGAGGGATAGG + Intergenic
992418973 5:76582106-76582128 AAGGCAGTTGAGGCACAGAGAGG + Intronic
993148112 5:84122538-84122560 GAGGCAATTGAGACTCAGAGAGG + Intronic
994228353 5:97281794-97281816 GAGACAATGGAGACTCAGATGGG - Intergenic
996501442 5:124221129-124221151 AGGGCAGGTGAGAGCCAGATGGG - Intergenic
997354667 5:133254587-133254609 GATGCAGTTGTGATGCAGATAGG - Intronic
997387731 5:133486875-133486897 GAGGAAATTGAGGCCCAGAGAGG + Intronic
997480437 5:134180425-134180447 GAGGAAGGTGAGGCCCAGAGAGG - Intronic
997484487 5:134218603-134218625 GAGGAAACTGAGACCCAGAGTGG - Intronic
997786319 5:136717286-136717308 GAGGAAGCTGAGACTCAGAGAGG + Intergenic
998396722 5:141823482-141823504 AAGGCACCTGAGGCCCAGATGGG - Intergenic
998988905 5:147793143-147793165 GAGTAAGTGGAGACCCAGAAAGG + Intergenic
999321150 5:150615865-150615887 GAGGAAATTGAGGCTCAGATAGG - Intronic
999324769 5:150637071-150637093 GATGAAGTTGAGACTCAGAGAGG + Intronic
999486538 5:152002674-152002696 GAGGCAAATAAGACCCAGAGAGG - Intergenic
1000646480 5:163766172-163766194 AGGGCAGGTGAGACCCAAATTGG + Intergenic
1000665368 5:163988551-163988573 GAGGAAACTGAGACTCAGATAGG + Intergenic
1000987136 5:167873487-167873509 GAGGAAACTGAGACCCAGAGAGG - Intronic
1001038786 5:168317109-168317131 GAGGCAGCTGTGGCCCAGAGAGG + Intronic
1001127759 5:169035735-169035757 GAGGCATCTGAGGCCCAGAGAGG + Intronic
1001268808 5:170295470-170295492 GAGGAAGTTGAGGCACAGAGAGG + Intronic
1001292290 5:170472179-170472201 GAGACAGCTGAGGCCCAGAGAGG - Intronic
1001397447 5:171427529-171427551 GAGGAAGTGGAGACTCAGAGAGG - Intronic
1002049345 5:176561217-176561239 GAGGAAGCTGAGGCCCAGAGAGG + Intronic
1002081855 5:176742145-176742167 GAGGCAGCTGAGGCACGGATGGG - Intergenic
1002340698 5:178515106-178515128 GAGGCAGCTGAGCTGCAGATGGG + Intronic
1002566597 5:180115728-180115750 GAGGAAGCTGAGGCCCAGAGAGG + Intronic
1002892320 6:1346025-1346047 GGGGTAGTTAAGAGCCAGATAGG + Intergenic
1004027747 6:11835723-11835745 GAGGAAATTGAGGCTCAGATGGG - Intergenic
1004892506 6:20114975-20114997 GAGGAAAGTGAGACCCAGAGAGG - Intronic
1005194302 6:23265270-23265292 GAAGCAGTTGAGTCACAGGTTGG - Intergenic
1005241291 6:23832019-23832041 GAAGAAGTTGAGAACCAGAGGGG - Intergenic
1005727704 6:28665731-28665753 AAGGCAGTTGAGCCCCGGTTGGG - Intergenic
1007070036 6:39029680-39029702 GATGAAGTTGAGACACAGGTTGG + Intronic
1007208124 6:40169417-40169439 GAGGAAGCTGAGCCCCAGAAAGG + Intergenic
1008543773 6:52568067-52568089 GAAGCAGGTGAGCCCCAGAGAGG + Intronic
1010948365 6:82005449-82005471 CAGGCATTTTAGACTCAGATTGG + Intergenic
1012326287 6:97922438-97922460 GAGGGAGTTGAGGCACAGATTGG + Intergenic
1012388453 6:98708808-98708830 GAGGCTGTTGAAAGCCAGGTGGG - Intergenic
1016073112 6:139764277-139764299 GAGGAGGATGAGGCCCAGATGGG - Intergenic
1016151761 6:140749576-140749598 GAGGAAGTAGAGAACGAGATAGG + Intergenic
1016743664 6:147554697-147554719 GAGCCAGATGAGAGCCAGAAGGG + Intronic
1017723925 6:157263776-157263798 GAGGCAGGTGACCCTCAGATTGG + Intergenic
1018037352 6:159892918-159892940 GAAGCAGTTGAGACCCAGTGGGG + Intergenic
1018145650 6:160885056-160885078 GAGGCAGTTGATAGCTAAATAGG - Intergenic
1019304464 7:326422-326444 GGGGCGGTTGAGACAGAGATGGG + Intergenic
1019754822 7:2761255-2761277 GAGGAAACTGAGACCCAGAGGGG - Intronic
1021851771 7:24815500-24815522 GAGGCAATTCAGAGCCAGAGGGG + Intronic
1022241350 7:28515617-28515639 GAGGGAGCTGAGTCCCAGAGTGG - Intronic
1023044555 7:36199656-36199678 GAAGCAGCTGAGACTCAGAGAGG - Intronic
1023102370 7:36732019-36732041 GAGGCAGATGAGAGACAGAAAGG - Intergenic
1023427112 7:40049473-40049495 GAGCGAATTGAGACCCAGAAAGG + Intronic
1023478572 7:40607804-40607826 GAGGAAATTCAGACCCAGAGAGG + Intronic
1023594694 7:41816477-41816499 GGGGTTGCTGAGACCCAGATAGG - Intergenic
1024954550 7:54902794-54902816 GAGGAAGCTGAGACCCAAAGCGG - Intergenic
1026030060 7:66784343-66784365 GAGGAAGTTGAGAGCCAAAGAGG + Intronic
1026310586 7:69180407-69180429 TATGCAGTAGAGAGCCAGATGGG + Intergenic
1027047066 7:74998109-74998131 GAGGCAGTTCAGCCCCGGCTCGG + Intronic
1027207860 7:76117202-76117224 GAGGAAGTTGAGAGCCAAAGAGG - Intergenic
1029600899 7:101562955-101562977 GAGTCAGCTGAGCCCCAGAGAGG + Intergenic
1030536330 7:110771527-110771549 AAGGAACTTGAGACCCAGCTAGG - Intronic
1030825227 7:114147825-114147847 GGAGCAGTGGAAACCCAGATTGG + Intronic
1032400720 7:131622548-131622570 GAGGAAGTTGAGACCAACCTGGG + Intergenic
1033274701 7:139962595-139962617 GAGGCAGGTGTGAGCCAGAAAGG + Intronic
1034752805 7:153586748-153586770 GAGGCAGCTGAGACCCAGAGAGG - Intergenic
1035742270 8:1937411-1937433 CAGACAATTGAGACCCAGGTAGG - Intronic
1036272822 8:7322978-7323000 CAGGCTTTTGAGACCCAGAATGG + Intergenic
1036348528 8:7987370-7987392 CAGGCTTTTGAGACCCAGAATGG - Intergenic
1036599996 8:10251894-10251916 AAGGCATTTGAGACCTAGAAGGG + Intronic
1036967029 8:13311191-13311213 GAGGACGTTGAGACCCAGACAGG + Intronic
1037910692 8:22741996-22742018 GAGGCAGGGGAGCCCCAGATAGG - Intronic
1038622072 8:29153822-29153844 GAGGAAGTAGAAACCCAGCTGGG - Intronic
1040476363 8:47781760-47781782 GAGGAAGCTGAGGCCCAGAAAGG - Intronic
1042354283 8:67809254-67809276 GAGGAAATTGAGGCACAGATAGG + Intergenic
1046520937 8:115324772-115324794 GAGGCTGTTGACAGCCAGAGAGG + Intergenic
1046528148 8:115407908-115407930 GAGGCAGAACAGATCCAGATAGG - Intergenic
1047238579 8:123064393-123064415 GAGGAAGATGAGACTCAGAGAGG + Intronic
1047949254 8:129916072-129916094 GGGAAAGTTGAGACCCAGAAAGG + Intronic
1049018056 8:139935372-139935394 GAGGAAATTGAGACCCAGAGAGG - Intronic
1049299691 8:141862975-141862997 GAGCCAGCTGAGGCCCAGTTGGG + Intergenic
1052669048 9:31532162-31532184 GAGGAAATTGAGACTCAGAGAGG + Intergenic
1053309392 9:37006785-37006807 GAGGCACTTGAAGCCCAGAGAGG - Intronic
1053426180 9:38011630-38011652 AAGGGAGTTGAGTCTCAGATGGG - Intronic
1053907360 9:42855902-42855924 GAGGAAGTTGAGGCACAGAAAGG + Intergenic
1055030003 9:71764515-71764537 AAGGAAGTTGGGACCCAGAGAGG - Intronic
1055323549 9:75105163-75105185 GAGGAAGTCATGACCCAGATTGG + Intronic
1055690642 9:78826722-78826744 GAGGCAGGTGGCAGCCAGATGGG + Intergenic
1056453111 9:86735526-86735548 AAACCAGTTGAGACCCTGATGGG + Intergenic
1056838914 9:89982012-89982034 GAGGCATGTGAGCCACAGATGGG - Intergenic
1056960435 9:91117901-91117923 GAGGCAGGTGGGCACCAGATGGG - Intergenic
1057741850 9:97718930-97718952 AAGGAAATTGAGACCCAGACTGG - Intergenic
1058058388 9:100472444-100472466 GAGGAAGTAGGGACCCAGAGAGG - Intronic
1058505346 9:105660823-105660845 GAGGCATTTGAAACACAGAGAGG + Intergenic
1059422144 9:114198867-114198889 GAGGCAGCTGAGGCCCAGCAAGG - Intronic
1059429077 9:114239425-114239447 GAGGAAGCTGAGGCCCAGAGAGG + Intronic
1060013469 9:120065340-120065362 GAGGTAACTGAGACCCAGAGGGG + Intergenic
1060179141 9:121520426-121520448 GGGGCAAGTGAGAGCCAGATGGG - Intergenic
1060206967 9:121687899-121687921 GAGGATGTTGAGGCCCAGAGAGG + Intronic
1060303418 9:122389986-122390008 GAGGAAGCTGAGACTCAGAGGGG + Intronic
1060549286 9:124477518-124477540 GAGGAAGTTGAGGCACAGAAAGG + Intronic
1060979010 9:127781910-127781932 GGGGAAATTGAGGCCCAGATTGG - Intergenic
1061238761 9:129357297-129357319 GAGGATGCTGAGACCCAGAGAGG - Intergenic
1061377382 9:130234489-130234511 GGGGCAACTGAGACCCAGAGAGG - Exonic
1061768595 9:132899439-132899461 GAGGCAGGTGAGTTCCAGGTTGG - Intronic
1061780363 9:132992467-132992489 GAGGAAGCTGAGCCCCAGAGAGG - Intergenic
1061934109 9:133847700-133847722 GAGGAAGTTGAGGCTCAGAGAGG - Intronic
1062078705 9:134607070-134607092 AAGGCAGGTGAGCCCCAAATTGG + Intergenic
1203561017 Un_KI270744v1:58406-58428 GAGGAAGTTGAGACACAGAAAGG - Intergenic
1186763992 X:12752203-12752225 AAGGAAGTTGAGACTCAGAGTGG - Intergenic
1187528826 X:20078325-20078347 GAGGAAATTGAGACTCAGAGAGG + Intronic
1189316321 X:40059319-40059341 AAGGAAGTTGAGGCCCAGAGAGG + Intronic
1189986389 X:46557332-46557354 GAGGTAGATGAGAGCCAGACTGG + Intergenic
1190123491 X:47683271-47683293 GGGGCAGGTGAGACGCAGAGAGG + Intergenic
1190324189 X:49196611-49196633 GAGGAAATTGAGACCCAGAGTGG + Intronic
1190470945 X:50778893-50778915 GAGGCAATTGAGGCACATATAGG - Intronic
1190797734 X:53760218-53760240 GAGGAAGCTGAGGCCCAGAGAGG + Intergenic
1191054223 X:56225739-56225761 GAGGAAGCCGAGGCCCAGATAGG + Intergenic
1192564205 X:72149869-72149891 GAGGAAGCTGAGGCCCAGAAAGG + Intergenic
1192828891 X:74729444-74729466 GAGGAAATTGAGGCCCAGAAGGG + Intergenic
1195674722 X:107499189-107499211 GAGGCAGATGAGGTTCAGATAGG + Intergenic
1195753645 X:108180246-108180268 GAGGAAACTGAGGCCCAGATGGG - Intronic
1196786587 X:119426319-119426341 GAGGAAGATGAGGCTCAGATGGG - Intronic
1196899617 X:120369864-120369886 GAGGAAATTGAGGCCCAGAGAGG + Intronic
1197706989 X:129641165-129641187 GAGGAGGCTGAGACCCAGAAAGG + Intergenic
1198505466 X:137296860-137296882 GAGCAAATTGAGACCCAGGTAGG + Intergenic
1198526585 X:137507527-137507549 GAGGAAACTGAGACACAGATTGG + Intergenic
1200092187 X:153641222-153641244 CAGGAAATGGAGACCCAGATGGG + Intergenic