ID: 1149680385

View in Genome Browser
Species Human (GRCh38)
Location 17:58503015-58503037
Sequence ATGGGTTCCCAGCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149680385_1149680391 2 Left 1149680385 17:58503015-58503037 CCATCCTCCTGCTGGGAACCCAT 0: 1
1: 0
2: 3
3: 37
4: 293
Right 1149680391 17:58503040-58503062 CCCTGAGAGTCAGATGTTTCTGG 0: 1
1: 0
2: 1
3: 14
4: 219
1149680385_1149680394 27 Left 1149680385 17:58503015-58503037 CCATCCTCCTGCTGGGAACCCAT 0: 1
1: 0
2: 3
3: 37
4: 293
Right 1149680394 17:58503065-58503087 GCTAATGCTGGACACAACAAAGG 0: 1
1: 0
2: 2
3: 5
4: 90
1149680385_1149680393 15 Left 1149680385 17:58503015-58503037 CCATCCTCCTGCTGGGAACCCAT 0: 1
1: 0
2: 3
3: 37
4: 293
Right 1149680393 17:58503053-58503075 ATGTTTCTGGAAGCTAATGCTGG 0: 1
1: 0
2: 3
3: 13
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149680385 Original CRISPR ATGGGTTCCCAGCAGGAGGA TGG (reversed) Intronic
900510939 1:3060799-3060821 AGGGGTCCCCAGCAGGATGGGGG - Intergenic
900656970 1:3763237-3763259 ATGGGATCCGTGCATGAGGAGGG + Exonic
902361586 1:15945085-15945107 GAGGGTTCCCAGCTGGAGAACGG - Exonic
902548932 1:17208004-17208026 CTGGGCTGGCAGCAGGAGGAAGG + Intronic
902782700 1:18714994-18715016 TGGGGTCCCCTGCAGGAGGAAGG + Intronic
902909209 1:19582762-19582784 ATGGGGTTCAAGTAGGAGGAAGG - Intergenic
904884217 1:33724368-33724390 ATGGGGTCCCAGGAGGATGACGG - Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904950759 1:34236712-34236734 ATGGTTTGTCAGCAGGAAGATGG + Intergenic
905800484 1:40839275-40839297 GTGGCCACCCAGCAGGAGGAGGG - Exonic
906147901 1:43570701-43570723 CTTGGTGCCCAGCAGGAGGAGGG + Intronic
907549168 1:55289487-55289509 GTGAGTTCCCAGCAGGAAGCAGG - Intergenic
907848800 1:58234553-58234575 AGGTGGGCCCAGCAGGAGGAGGG - Intronic
908408856 1:63843074-63843096 GGGGGATCCCAGCAGGGGGAGGG - Intronic
908456379 1:64308623-64308645 GTGGCTCCTCAGCAGGAGGAAGG - Intergenic
909059405 1:70862870-70862892 AATGGTTCTTAGCAGGAGGATGG + Intronic
909272837 1:73645930-73645952 AAGGGATCCTAGCAGGAAGACGG + Intergenic
912567688 1:110599994-110600016 CTAGGTTTCAAGCAGGAGGATGG - Intronic
914333907 1:146698028-146698050 AAGGCTTCCCTGCAGAAGGATGG - Intergenic
914425017 1:147567778-147567800 ATTGGTTCCTAGCAGGGGGAGGG - Intronic
914679702 1:149930487-149930509 AAGAGTTCCCAGCTGGAGGCTGG + Exonic
915709591 1:157882808-157882830 GTGGCTTCCCAGAAGAAGGAAGG - Intronic
915762638 1:158330415-158330437 GGAGGTTCCCAGCAAGAGGAGGG + Intronic
915791296 1:158674507-158674529 AAGGCTGCCCAGTAGGAGGAGGG - Intronic
919972152 1:202588003-202588025 ATGATTTCCCTGCAGAAGGAAGG + Exonic
920054256 1:203181139-203181161 GTGAGTTCCCAGAAGGAGGGAGG - Intronic
920249571 1:204614593-204614615 GTGTGTTTCGAGCAGGAGGAAGG - Intergenic
920783001 1:209012771-209012793 ACGGGTTCCCAACAGGAAAAGGG - Intergenic
921165538 1:212504223-212504245 AAGGGGTCCCAGCAGCAAGAGGG - Intergenic
921900909 1:220449606-220449628 AGGGGTTGCCAGCAGGATGAGGG - Intergenic
922322880 1:224503467-224503489 GTGGCTCCCCTGCAGGAGGAGGG + Intronic
923564302 1:235065199-235065221 TTGGGTTTCTAGCACGAGGAAGG + Intergenic
924226331 1:241924857-241924879 TTGGATTTTCAGCAGGAGGAGGG + Intergenic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1063722482 10:8598351-8598373 TTGGATTTCCAGCAGGATGAAGG - Intergenic
1064131519 10:12713974-12713996 ATGGGATCAGAGCAGGAGGAGGG + Intronic
1065635076 10:27723679-27723701 ATGGCTTCAGAGCAAGAGGATGG - Intronic
1065898961 10:30188110-30188132 AGGGGGTCCCAGGAGGAGGCTGG - Intergenic
1067318871 10:45198763-45198785 GTGGGTCCCCAGCTGCAGGAGGG - Intergenic
1067319544 10:45205214-45205236 ATGGGTTCCCAGCTGCAGGAGGG - Intergenic
1067557087 10:47279889-47279911 ATGGGTTCAGAGCAGGAGCATGG + Intergenic
1067760200 10:49039251-49039273 TTGGGGTCTCAGCAGGATGAGGG + Intronic
1068950306 10:62770027-62770049 GGGGCTTCCCAGCAGCAGGAGGG - Intergenic
1069647164 10:70009082-70009104 TTGGGCTTCCAGCAGGAAGAGGG + Intergenic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1072085574 10:92076258-92076280 CTGGGCTCCCATCAGAAGGAAGG + Intronic
1073469961 10:103716259-103716281 TGGGGTTCCCCGCAGGAGGCAGG + Intronic
1073835642 10:107438010-107438032 TTGGGTTTCCAGCAGAGGGAGGG - Intergenic
1073935774 10:108630071-108630093 ATTGCTTCCCAGCAAGAGAAAGG - Intergenic
1074382950 10:112995140-112995162 AGGGGTTCCCCTGAGGAGGAGGG - Intronic
1074997490 10:118770426-118770448 ATGGCTGGCCAGCAGGAGGATGG + Intergenic
1075070837 10:119319080-119319102 GTGGGGGCCCCGCAGGAGGAGGG - Intronic
1075080625 10:119381264-119381286 ATGGGTTCTCAGCTGGAGGAAGG - Intronic
1075555602 10:123429281-123429303 ATGAGCTTCCAGGAGGAGGACGG + Intergenic
1075795527 10:125116970-125116992 ATGGGTTCCCTGAAGGACCAGGG + Intronic
1076340951 10:129744539-129744561 TGGGGTTCACAGCAGGGGGAAGG - Intronic
1078551289 11:12282083-12282105 ATGGTTTCCCAGGAAGACGAGGG + Intronic
1079758775 11:24302302-24302324 ATGAGGTCAGAGCAGGAGGAAGG - Intergenic
1081762125 11:45584030-45584052 AATGGTTTCCAGCAGGGGGAGGG - Intergenic
1082796331 11:57380664-57380686 AACTGTTCCCAGCAGGAGAAAGG + Exonic
1082856824 11:57815903-57815925 ATGTGTTCACAGCAGGACGAGGG + Exonic
1083606678 11:63982968-63982990 ATGGGATTCCATCAGGTGGAGGG - Intronic
1083696362 11:64445399-64445421 AAGGTTTGCCAGCAGGAAGAAGG + Intergenic
1083800683 11:65044711-65044733 CTGGGTCCCCAGCCTGAGGAGGG + Exonic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1083932809 11:65855219-65855241 GGGGGATCCCAGCAGGGGGAGGG - Exonic
1084665542 11:70574294-70574316 ATGAGTTCCCAGCAGGCTGTGGG - Intronic
1085037853 11:73310451-73310473 ATGGGTGCCCAACAAGATGATGG + Exonic
1087692585 11:101338796-101338818 ATGGGTTCAGGGTAGGAGGAAGG + Intergenic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1090805815 11:130201428-130201450 ATGGGCCCACAGCAGGAGGGAGG + Intronic
1094753435 12:33439500-33439522 ATGAGTTTCCACAAGGAGGACGG - Exonic
1095584463 12:43835673-43835695 ATTGGTTCCCTGCAGGATGGTGG + Intergenic
1097086637 12:56473538-56473560 ATTGGGTACCACCAGGAGGATGG + Exonic
1097118578 12:56716950-56716972 ATGGGGTCCCTTCTGGAGGATGG + Intronic
1098234603 12:68406461-68406483 ATGGGTTCCCACCTAGTGGAGGG - Intergenic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1101570821 12:105952040-105952062 ATGTTCCCCCAGCAGGAGGAAGG - Intergenic
1104315228 12:127692692-127692714 ATGCGGTCCCAGCGGGAGAAGGG - Intergenic
1104464877 12:128982210-128982232 AGGGGCTCCCAGCATGAAGAAGG - Intronic
1106099136 13:26679339-26679361 AAGGGTGCCCATCAGGAGGACGG - Intronic
1107691325 13:42956485-42956507 ATGGGGTCCCAGCAGGCAGGAGG + Intronic
1108605989 13:52039080-52039102 ATGGGCTTTCAGCAGGAAGAGGG + Intronic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1112345372 13:98584862-98584884 ATTAGTACTCAGCAGGAGGAGGG + Intergenic
1112533558 13:100227803-100227825 ATGGTTTCCAATCAGGAGGTAGG - Intronic
1113091280 13:106619398-106619420 AAGGGATCCCGGGAGGAGGAAGG - Intergenic
1115850003 14:37583780-37583802 ATGGCTTCCCAGCTGGAGGCCGG + Intergenic
1119133607 14:72196505-72196527 TTGGGTTCCCAGGAGGAACAGGG - Intronic
1119323735 14:73746430-73746452 CAGGGATCCCAGCAGGAGTAGGG + Intronic
1119552503 14:75525234-75525256 AAGGGTTCCCAGATGGCGGAGGG - Intronic
1119662082 14:76459367-76459389 ATGGGTTATCAGCAGGGAGAAGG + Intronic
1120169197 14:81232167-81232189 ATGGGTTTCCGGCAGGGGGGTGG + Intergenic
1120180371 14:81336875-81336897 ATGAGTGATCAGCAGGAGGAGGG + Intronic
1120234400 14:81874541-81874563 ATCTTATCCCAGCAGGAGGAAGG + Intergenic
1121278308 14:92682593-92682615 CTGGGTTCCAGGCAGAAGGAAGG + Intronic
1121907989 14:97765006-97765028 ATGGGTTTCCTGCAGGAGGCAGG + Intergenic
1121916526 14:97840771-97840793 AAGGGTTCTCAGCGGGATGAAGG + Intergenic
1123023452 14:105412680-105412702 ATGGGTTCCCAGCCCGGGGTGGG + Exonic
1202919095 14_KI270723v1_random:14332-14354 ATGGGTCCCTACCAGCAGGAAGG - Intergenic
1202925535 14_KI270724v1_random:20663-20685 ATGGGTCCCTACCAGCAGGAAGG + Intergenic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1127525462 15:59788041-59788063 GTGGGTTAGCAGCAAGAGGAGGG + Intergenic
1127627067 15:60790029-60790051 ATAGGTTCTCAGATGGAGGAAGG - Intronic
1128058506 15:64718499-64718521 ATGGGTCCCCAGCAGGCCGTGGG - Intergenic
1129669361 15:77598599-77598621 ATCGCTTCCCACCTGGAGGAAGG + Intergenic
1130984677 15:88837101-88837123 ATGGTGTCCCCGTAGGAGGATGG - Intronic
1131260461 15:90884873-90884895 ATGGGTACCCAGCAGCAGCCTGG - Intronic
1132396629 15:101479620-101479642 CTGGTTTCCCATCTGGAGGACGG + Intronic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1133267340 16:4593122-4593144 AAGCCTTCCCAGCAGGAGGAAGG - Intronic
1133544598 16:6793382-6793404 ATAGGTTCACTGCAGGAGGGTGG + Intronic
1133978668 16:10618039-10618061 ATGCCCTCCCAGCAGGAGGTGGG + Intergenic
1134224197 16:12379044-12379066 ATGGTTTCCCAACAGGAGAGTGG + Intronic
1135114070 16:19711176-19711198 AAGGGCCCCCAGCATGAGGATGG + Intronic
1138505563 16:57476663-57476685 TTGGGTTCCCAGCTGGAGCAGGG - Intronic
1139653807 16:68375655-68375677 CTGGGATCACAGCAGGAGAAAGG - Intronic
1139999711 16:71013221-71013243 AAGGCTTCCCTGCAGAAGGATGG + Intronic
1141777172 16:86132044-86132066 AGGGGATGCCAACAGGAGGATGG + Intergenic
1141852795 16:86658843-86658865 ATGGCTTCCCAATAGGAGAAAGG - Intergenic
1142116920 16:88362302-88362324 ATGGGTGAACAGCATGAGGATGG - Intergenic
1142186996 16:88699345-88699367 ATCGCCTCCCAGCAGGTGGATGG - Intronic
1142247387 16:88976281-88976303 AGGGCATCCCAGGAGGAGGAGGG + Intronic
1143405577 17:6675202-6675224 CTGGGTTACCAGCAGGAGTCAGG + Intergenic
1144808652 17:17984546-17984568 ATGGGTCCCTAGCAGGGAGAAGG + Intronic
1145280694 17:21464790-21464812 ATGATTTCCCAGCAGGAGCAAGG - Intergenic
1146173657 17:30651079-30651101 CTGGGTTCTGAGCGGGAGGAGGG - Intergenic
1147656754 17:42095490-42095512 ATGGGGCCGCAGCAGCAGGAGGG - Intergenic
1147878598 17:43639360-43639382 TTGAGTTTCCAGCAGGAGGGTGG + Intergenic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1149457829 17:56802601-56802623 TTGGGATCCCAGCAGGAGACTGG - Intronic
1149680385 17:58503015-58503037 ATGGGTTCCCAGCAGGAGGATGG - Intronic
1150392450 17:64797911-64797933 ATGGGTAGCCAGCAGGGGGCAGG + Intergenic
1150905391 17:69330708-69330730 ATTGTTCACCAGCAGGAGGAGGG - Intergenic
1152070906 17:78133164-78133186 ATGGCTTCCCAGGATGAGGGTGG - Intronic
1152234172 17:79129966-79129988 ATGGGAGCTCTGCAGGAGGAGGG + Intronic
1152645436 17:81466531-81466553 GTGGGGTCCCTCCAGGAGGAGGG + Intergenic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1152744734 17:82033477-82033499 CTTGGTGCCCACCAGGAGGATGG - Exonic
1154465765 18:14641822-14641844 AAGGGTGCCGAGTAGGAGGAAGG - Intergenic
1154529891 18:15332272-15332294 ATGGTTCCCCAGCTGCAGGAGGG + Intergenic
1155323954 18:24647353-24647375 AAGAGTTCCCAGGAGCAGGAAGG - Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1159564260 18:70031359-70031381 ATGTGTCCCCAGAAGGAGAAAGG - Intronic
1159779314 18:72642868-72642890 TTTTGTTTCCAGCAGGAGGAAGG - Intergenic
1160694153 19:474522-474544 CTGGGAGCCCAGCAGGAGGCAGG - Intronic
1160857710 19:1224765-1224787 AGGAGTACCCAGCAGGGGGAAGG + Intronic
1160929521 19:1563605-1563627 TTGGGGTCTCAGCAGGAGCAGGG + Intronic
1161718673 19:5891732-5891754 ATGTGTACCCAGCGGGAGGCTGG - Exonic
1162451444 19:10757468-10757490 AGGGGTTCCCAGCATGGGTAGGG + Intronic
1162469562 19:10864381-10864403 ATGGGTGACAAGCAGGAGGTGGG + Intronic
1162785673 19:13033232-13033254 ATAGGGTCCCAGGAGGAGGAGGG + Intronic
1163203742 19:15787394-15787416 AGGGGTCCCAGGCAGGAGGAAGG + Intergenic
1163358339 19:16829554-16829576 ATGGGTTCCCCGAGGGAGGGCGG - Intronic
1164011184 19:21204711-21204733 ATGGGATAAAAGCAGGAGGAAGG - Intergenic
1164015836 19:21255250-21255272 ATGGGATAAAAGCAGGAGGAAGG + Intronic
1164630013 19:29755913-29755935 ATGTGTCCTCAGCAGCAGGAGGG - Intergenic
1165155124 19:33782225-33782247 ATGAGTTCACAGCAGGAAGAGGG - Intergenic
1165475597 19:36028665-36028687 ATGGGTTGGGAGCTGGAGGAGGG - Intronic
1166200033 19:41231361-41231383 GTGGGTTCCCAGGGAGAGGATGG - Intronic
1166414478 19:42583780-42583802 AGGGGCTCCCAGCAGGGGTATGG + Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1167581653 19:50347720-50347742 ATTGGTTCCCAGCAATAGGAGGG - Intronic
1167867388 19:52339314-52339336 ATGGGTTCCAGGCTGGGGGATGG + Intronic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
925058389 2:872519-872541 ATGGGGTCCGGGGAGGAGGATGG - Intergenic
926127898 2:10283147-10283169 AAGGGTTCCCAGCATGGGGATGG + Intergenic
927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG + Intergenic
927849783 2:26491617-26491639 GTGGATTTTCAGCAGGAGGAAGG + Intronic
930296430 2:49560416-49560438 AAGGCTTCCCAGCAGAATGAAGG + Intergenic
931369239 2:61646865-61646887 ATTGGTTGCCAGAAGGAGGAGGG + Intergenic
932813697 2:74844763-74844785 ATGGGATCCCCGCAGCAGCATGG - Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
937509344 2:122576187-122576209 ATGGCTTCCCAGAAGGGGTAAGG + Intergenic
938059643 2:128242265-128242287 TTGTGTTTCTAGCAGGAGGAGGG + Intronic
938528988 2:132163712-132163734 ATGGGTCCCCAGCTGCAGGAGGG + Intronic
940854855 2:158722187-158722209 ATGGGTTCCAAGGATTAGGATGG + Intergenic
941515090 2:166463726-166463748 ATGGGAGCCCAGCAGGAGCTGGG + Intronic
942612366 2:177755544-177755566 ATGGGGTCGCAGCAGAAGGAGGG - Intronic
943739528 2:191396301-191396323 ATTGGTTTCCAGAAGGAGTATGG + Intronic
945831778 2:214795912-214795934 AGGGATATCCAGCAGGAGGATGG - Intronic
946023994 2:216660833-216660855 GTGGGGTCTCAGCTGGAGGAGGG + Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
947844910 2:233236238-233236260 AAGGGCCCCTAGCAGGAGGAGGG - Intronic
948317266 2:237037837-237037859 TGGGGCTCCCACCAGGAGGAGGG - Intergenic
949024768 2:241761928-241761950 GTTGCTTCCCAGCAGCAGGAGGG + Intronic
1169026077 20:2372540-2372562 ATGGATTACCTGCAGGAGGCAGG - Intergenic
1171487986 20:25497707-25497729 CTGGGCTGTCAGCAGGAGGAAGG - Intronic
1173872847 20:46352539-46352561 ATGGGATCCTAGCGGGATGATGG + Intronic
1173872888 20:46352708-46352730 ATGGGATCCTAGCGGGATGAAGG + Intronic
1174417437 20:50376869-50376891 ATGGTGTCCCAGCAGGTGAAGGG + Intergenic
1174688354 20:52477573-52477595 ATTCATTCCCAGCACGAGGAAGG - Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1176052114 20:63125342-63125364 TGGGGCTCCCAGCAGGAGGGAGG + Intergenic
1176446924 21:6829532-6829554 ATTGGTCCCCAGCTGCAGGAGGG - Intergenic
1176767520 21:13036204-13036226 ATGGGTCCCCAGCTGCAGGAGGG - Intergenic
1176825095 21:13694558-13694580 ATTGGTCCCCAGCTGCAGGAGGG - Intergenic
1178102379 21:29283671-29283693 ATATGTTCAGAGCAGGAGGAAGG + Intronic
1178534727 21:33402792-33402814 ATGGCCTCCGAGCAGGGGGAGGG - Intergenic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180922053 22:19526047-19526069 ATGGGTCTGCAGCAGGAGGAAGG - Intronic
1181806501 22:25377730-25377752 AGAGGTTCCCAGCAGGTGAATGG - Intronic
1182565811 22:31198268-31198290 ATGGGTTCCCAGCAATAGCATGG - Intronic
1183373808 22:37450626-37450648 AGGGGTTCTCAGCAGGAAGTCGG + Intergenic
1184582076 22:45424658-45424680 AGAGGATCCCTGCAGGAGGAGGG + Intronic
1185035219 22:48472135-48472157 GTGGCTTCTCAGCCGGAGGAAGG - Intergenic
950431682 3:12954500-12954522 AGGGGTTCCCCTCAGCAGGAGGG + Intronic
953377603 3:42441849-42441871 ATGTGTTCCAAGCAGCAAGAGGG + Intergenic
954100397 3:48367935-48367957 AAGGGGTCCCTGCAGGGGGAAGG - Intergenic
956087003 3:65622081-65622103 ATGTATTTCCTGCAGGAGGAAGG - Exonic
956770588 3:72522724-72522746 AGGGTTTCCAAGCTGGAGGAGGG - Intergenic
957082426 3:75647960-75647982 ATGGGTCCCTACCAGCAGGAAGG + Intergenic
959603924 3:108222031-108222053 ACTGGTTCCCAGCAGGACCAAGG + Intronic
960378549 3:116932438-116932460 CTGGGTTCCAGGCAGGAGAAAGG - Intronic
960953668 3:123016056-123016078 ATAGGGTCCCAGGAGGATGAGGG + Intronic
962814822 3:138988323-138988345 ATGAGGTCCCAGGAGGAGAAGGG + Intergenic
962842543 3:139249003-139249025 ATGTGTTGCAAGGAGGAGGATGG - Intronic
963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG + Intergenic
963656401 3:148056934-148056956 ATGGGATAGCAGCAAGAGGAGGG - Intergenic
964275869 3:155008496-155008518 ATGGGTTTCCACCAGGAGCTTGG - Intergenic
966885886 3:184377996-184378018 ATGGGCTCCCAGCTGGGGGAGGG - Intronic
968966319 4:3770739-3770761 ATGGGGTGCCAGCATGGGGAGGG + Intergenic
969313160 4:6366133-6366155 ATTGGAGCCCAGCAAGAGGATGG - Intronic
969670826 4:8589358-8589380 AGGGGTTCCAAGCAGGAGGTGGG + Intronic
971481990 4:27123294-27123316 AAGGTTTCCCAGCAGGGAGAGGG - Intergenic
973369563 4:49234733-49234755 ATGGGTTCCCTGCAGCAGCCAGG - Intergenic
973391469 4:49560683-49560705 ATGGGTTCCCTGCAGCAGCCAGG + Intergenic
975496463 4:75040972-75040994 AGGAGTTCCCAGTAGGAGGTGGG - Intronic
978104955 4:104890809-104890831 GGGCATTCCCAGCAGGAGGAAGG + Intergenic
979594424 4:122518527-122518549 ATGTATACCCAGCAGTAGGATGG + Intergenic
980232609 4:130063717-130063739 ATGGGTCCACACCAGAAGGAGGG - Intergenic
980730449 4:136816887-136816909 ATGGCTTCCCAGCATGGTGATGG + Intergenic
980847708 4:138343782-138343804 AGCTGTTCCAAGCAGGAGGAAGG + Intergenic
981162633 4:141517033-141517055 ATGCCTCCCCAGCAGGAGCAAGG + Intergenic
981797092 4:148607854-148607876 TAGTGTTCCCAACAGGAGGAAGG - Intergenic
982036148 4:151348035-151348057 GTGGGTTCACAGGAGTAGGAAGG + Intergenic
982060661 4:151601203-151601225 ATGGGGTTCCAGCAGGAGACTGG - Intronic
982518394 4:156381610-156381632 ATGGCTTCCCAGGATGAGGAAGG + Intergenic
984799982 4:183705799-183705821 ATGTGCTCCCACCAGGAGGCAGG + Intronic
985935062 5:3091188-3091210 ATGTGTTCTCATTAGGAGGAAGG + Intergenic
986635063 5:9812941-9812963 ATGGGTTATGAGCAGAAGGAAGG + Intergenic
986786025 5:11114536-11114558 TTGGGATCCTAGCAGGAGGGTGG + Intronic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
987079942 5:14417568-14417590 AATGTTTCCCAGCAGGAGGCTGG + Intronic
987748417 5:22007716-22007738 ATGGTTTCCCAGGAAGAAGATGG + Intronic
989708386 5:44366170-44366192 ATTGGTTTCCATTAGGAGGAGGG - Intronic
990157163 5:52890164-52890186 ATGGTTACCCAGGTGGAGGAAGG - Intronic
990352642 5:54934275-54934297 ATGGGGTGGCAGCAGGGGGAAGG + Intergenic
991323338 5:65401453-65401475 TTGTGTTCCCAGCAGCAGAAGGG - Intronic
991768593 5:70017503-70017525 ATGGTTTCCCAGGAAGAAGATGG + Intergenic
991847831 5:70892585-70892607 ATGGTTTCCCAGGAAGAAGATGG + Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992944896 5:81800345-81800367 ATGGGATCCCAGTAGTAGGAGGG + Intergenic
998511692 5:142719058-142719080 ATGGGCTCCCAGATGGAGGAGGG + Intergenic
998707721 5:144782929-144782951 AAGGGTTTGCAGCAGGAGGTGGG + Intergenic
999371259 5:151056681-151056703 GTGGATTCCCAGGAGCAGGAAGG + Intronic
999443364 5:151620065-151620087 ATGCCTCCCCAGCAGCAGGAGGG + Intergenic
1001863828 5:175085187-175085209 ATAGGCTCCCAAAAGGAGGAAGG + Intergenic
1001910829 5:175516133-175516155 AGGGCTGCCCAGCAGGAGGAGGG - Intronic
1003108199 6:3231354-3231376 CTGGCTTCCCAGGCGGAGGAGGG - Intronic
1003167733 6:3695975-3695997 ATTGTTCCCCAGCTGGAGGAAGG - Intergenic
1003570130 6:7250545-7250567 AGGGGTCCCCAGCAGCAGGCTGG - Exonic
1004879804 6:19996275-19996297 GTGGGTCCCCTGCAGGAGGCTGG + Intergenic
1004905003 6:20229332-20229354 ATGGGCTCTCAGGAGGAGGGTGG - Intergenic
1005988868 6:30891203-30891225 ACAGCTTCCCAGCAGGAGAAGGG - Intronic
1007284965 6:40741063-40741085 ATTGGTGCCCAGCAAGATGAGGG + Intergenic
1007588990 6:43010160-43010182 ATGGCCTCCCAGCAGCATGATGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1011756156 6:90500214-90500236 ATGGTTTCAGAGCAGGAGGTTGG + Intergenic
1013974870 6:116065419-116065441 ATGGGTTCACAGCAAGAGTTTGG - Intergenic
1014538408 6:122645499-122645521 ATGGTGTCCCAGCAGGTGGGTGG + Intronic
1017962323 6:159233195-159233217 ATGGGCTGCCTGGAGGAGGAAGG - Exonic
1018939973 6:168302623-168302645 AAGGGTTTGCAGCAGGAGGGAGG + Intronic
1019427764 7:985370-985392 ATGGGCGTGCAGCAGGAGGACGG + Intronic
1020106109 7:5423148-5423170 CTCGGTTCCCAGCAGGCGGCGGG - Intronic
1021058383 7:16079351-16079373 ATGTGTTCCCAGTAAGAGCAAGG + Intergenic
1021627362 7:22607317-22607339 ATGGGTTGCCATCTGGAAGAGGG + Intronic
1023138127 7:37074527-37074549 CTGGGTTCCCAGGAGGGCGAGGG + Intronic
1023595268 7:41822866-41822888 ATGGGTTCCCTCTGGGAGGATGG - Intergenic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1024887684 7:54163115-54163137 TTGGGTTCCCAGCAGGGGACAGG + Intergenic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1024948329 7:54833907-54833929 ATGGGTTCAAAGCAGGCGCAGGG + Intergenic
1025253202 7:57365667-57365689 ATGGTGTCCCAGCAGGTGAAGGG - Intergenic
1026616740 7:71911880-71911902 ATGAGTTTCCATCAGGAGCATGG + Intronic
1027297983 7:76798155-76798177 ATGGGTTCCCAAGATGAGCAGGG - Intergenic
1029502772 7:100943896-100943918 CTGGGATCCCAGCAGGGGTATGG - Intergenic
1029514672 7:101017826-101017848 AAGGGGTCCCAGGGGGAGGAAGG - Intronic
1030190729 7:106807728-106807750 GTGAGTTCTCAGCAGGAGGTTGG - Intergenic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1034744601 7:153512851-153512873 ATGGTATCCCAGCAGGGGAATGG - Intergenic
1035390544 7:158501452-158501474 AGGGCTTCCCAGCAGAAGGCAGG - Intronic
1035395069 7:158529393-158529415 AGGGGAGGCCAGCAGGAGGACGG + Intronic
1035632798 8:1121185-1121207 ATGGGTTCCAAAGGGGAGGACGG - Intergenic
1037701023 8:21273899-21273921 ATGGGTTTTCAGCTGGAGGAGGG + Intergenic
1038437229 8:27544559-27544581 ATGGTGCCCCAGCAGGTGGAAGG - Exonic
1039355991 8:36816245-36816267 ATGTGTTCCCAGGAGGAAAATGG + Intronic
1039669975 8:39584770-39584792 ATGGGATCCCAGAAGGGAGAGGG - Intronic
1040024645 8:42770565-42770587 AAGGGTGCAGAGCAGGAGGATGG + Intronic
1040550286 8:48432187-48432209 ATGGGCTTCCTGGAGGAGGAGGG + Intergenic
1042933244 8:74033454-74033476 ATGGGCCCCCAGCAGGGGGTTGG - Intergenic
1043051788 8:75394135-75394157 CTGGGTTCCAAACAGGAAGAGGG - Intergenic
1046097548 8:109579060-109579082 AGGGATGCCCAGCAGGAAGAAGG + Intronic
1046953600 8:120041407-120041429 TTGGCTTCCTATCAGGAGGAAGG + Intronic
1049343375 8:142125747-142125769 AAAGATTCCCAGCTGGAGGAGGG - Intergenic
1049695969 8:143984487-143984509 TTGAGTCCCCAGTAGGAGGAGGG + Intronic
1049807843 8:144548896-144548918 AGGTGAGCCCAGCAGGAGGAAGG + Intronic
1051505412 9:17821888-17821910 ATGGATACCCAGCAGCAGGTGGG + Intergenic
1051589831 9:18766440-18766462 TGGGGTTTCCAACAGGAGGAAGG + Intronic
1051876753 9:21802135-21802157 GTGGGTTCGCAGCCGCAGGAAGG + Intergenic
1053352934 9:37425142-37425164 AGGGGTTCACAGCAGGAGGGAGG - Intronic
1055582077 9:77716482-77716504 AAGGGTTTCCAACAGGATGATGG + Exonic
1056238579 9:84620650-84620672 ATGGTTTCCCAGCTTGAGCAAGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1057796725 9:98163059-98163081 ATGGGATCACAGCAGCAGAATGG - Intronic
1058770451 9:108226275-108226297 AAGTGTTCCATGCAGGAGGAAGG - Intergenic
1059197533 9:112384436-112384458 ATTGATTCCCAGTAGGAGAAAGG - Intronic
1060765863 9:126294698-126294720 ATGAGTTCCCTGCAAGTGGAGGG - Intergenic
1060798139 9:126526488-126526510 CTGGGATCACGGCAGGAGGAAGG + Intergenic
1060828963 9:126702040-126702062 ATGAGTTCCCCAGAGGAGGACGG + Intergenic
1061943357 9:133894602-133894624 ACAGGCTCCCAGGAGGAGGAGGG + Intronic
1203522266 Un_GL000213v1:54999-55021 ATTGGTCCCCAGCTGCAGGAGGG + Intergenic
1203443075 Un_GL000219v1:29472-29494 ATGGGTCCCTACCAGCAGGAAGG - Intergenic
1203513883 Un_KI270741v1:148381-148403 ATGGGTCCCTACCAGCAGGAAGG - Intergenic
1185816076 X:3157241-3157263 AGGGGTTCCTAGCAGGAAGGTGG + Intergenic
1190159604 X:48021763-48021785 ACAGTTTCCCAGGAGGAGGATGG - Intronic
1191677592 X:63807943-63807965 AAGGGTTCCCAGGAGGACCATGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1199763038 X:150919798-150919820 ATGGGTTCCAACCAGCAGCAGGG + Intergenic
1201265181 Y:12199409-12199431 AGGGGTTCCCAGCAGGAAGGTGG + Intergenic
1201265374 Y:12201343-12201365 AGGGGTTCCTAGCAGGAAGATGG - Intergenic