ID: 1149685261

View in Genome Browser
Species Human (GRCh38)
Location 17:58531402-58531424
Sequence TTCCCAAAGGGACCCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 210}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149685261_1149685268 3 Left 1149685261 17:58531402-58531424 CCTCTCTGGGGTCCCTTTGGGAA 0: 1
1: 0
2: 4
3: 19
4: 210
Right 1149685268 17:58531428-58531450 GCCAGGGACTGCCCCTTGTCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
1149685261_1149685277 18 Left 1149685261 17:58531402-58531424 CCTCTCTGGGGTCCCTTTGGGAA 0: 1
1: 0
2: 4
3: 19
4: 210
Right 1149685277 17:58531443-58531465 TTGTCAGGCTGAGGGAAGGAGGG 0: 1
1: 0
2: 3
3: 55
4: 409
1149685261_1149685270 9 Left 1149685261 17:58531402-58531424 CCTCTCTGGGGTCCCTTTGGGAA 0: 1
1: 0
2: 4
3: 19
4: 210
Right 1149685270 17:58531434-58531456 GACTGCCCCTTGTCAGGCTGAGG 0: 1
1: 0
2: 2
3: 16
4: 178
1149685261_1149685278 19 Left 1149685261 17:58531402-58531424 CCTCTCTGGGGTCCCTTTGGGAA 0: 1
1: 0
2: 4
3: 19
4: 210
Right 1149685278 17:58531444-58531466 TGTCAGGCTGAGGGAAGGAGGGG 0: 1
1: 0
2: 2
3: 68
4: 661
1149685261_1149685271 10 Left 1149685261 17:58531402-58531424 CCTCTCTGGGGTCCCTTTGGGAA 0: 1
1: 0
2: 4
3: 19
4: 210
Right 1149685271 17:58531435-58531457 ACTGCCCCTTGTCAGGCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 172
1149685261_1149685273 14 Left 1149685261 17:58531402-58531424 CCTCTCTGGGGTCCCTTTGGGAA 0: 1
1: 0
2: 4
3: 19
4: 210
Right 1149685273 17:58531439-58531461 CCCCTTGTCAGGCTGAGGGAAGG 0: 1
1: 0
2: 0
3: 32
4: 470
1149685261_1149685276 17 Left 1149685261 17:58531402-58531424 CCTCTCTGGGGTCCCTTTGGGAA 0: 1
1: 0
2: 4
3: 19
4: 210
Right 1149685276 17:58531442-58531464 CTTGTCAGGCTGAGGGAAGGAGG 0: 1
1: 0
2: 1
3: 72
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149685261 Original CRISPR TTCCCAAAGGGACCCCAGAG AGG (reversed) Intronic
900287472 1:1908584-1908606 TCCCAAAAGGGACCGCAGATGGG - Intergenic
900845182 1:5092664-5092686 TTTCCAAGGGCTCCCCAGAGTGG - Intergenic
900898260 1:5498774-5498796 TGCCAAAACTGACCCCAGAGAGG + Intergenic
903043106 1:20546840-20546862 TTCCAGATGGGAGCCCAGAGAGG + Intergenic
903790012 1:25886371-25886393 TTTCCAAATGAAGCCCAGAGAGG - Intronic
905170773 1:36108408-36108430 TTCCCAAGGGGTCACCAGAGAGG - Intronic
905769125 1:40625963-40625985 TTCCCAGAGGGCCCTCAGTGTGG + Exonic
905891949 1:41523322-41523344 GTCCCAAAGGTTGCCCAGAGAGG - Intronic
906113624 1:43340692-43340714 TTCCCAATGGGAACAGAGAGGGG - Intronic
906696884 1:47829084-47829106 TGGCCCCAGGGACCCCAGAGAGG + Intronic
906697843 1:47836761-47836783 TTACAAAAGAGACCCCAGAGAGG + Intronic
907518710 1:55009351-55009373 GTCCCAAAGGCAGCGCAGAGAGG - Exonic
907765194 1:57403040-57403062 TTCCCAAAGGAAAATCAGAGTGG - Intronic
907775766 1:57512915-57512937 TTCCCAGACAGTCCCCAGAGAGG - Intronic
910191364 1:84599201-84599223 TTCCTAAAGGGAGCCCAGAGAGG - Intergenic
912501472 1:110125316-110125338 TTCCCTATGGGACCCCAGGGAGG + Intergenic
913045322 1:115069105-115069127 TTTCCTAAGGCAGCCCAGAGTGG - Intronic
915516473 1:156415712-156415734 TACCCAGAGGGTCCCCAGGGAGG + Intronic
916921430 1:169471879-169471901 ATCCCAAAGCAACCCCAGTGTGG + Intronic
923546865 1:234929571-234929593 TTATCAAAGGGACCCCAGAGAGG + Intergenic
1065607974 10:27440767-27440789 TTCCCGAAGGGAGCTCACAGAGG - Intergenic
1066206086 10:33190668-33190690 TCCCAAAAGGTACCCCAGGGGGG - Intronic
1067057574 10:43061266-43061288 TTGCCAAGTGGACCCCAGTGAGG - Intergenic
1067290448 10:44935745-44935767 TTCCCACAGTGAGCACAGAGCGG - Exonic
1067510199 10:46888358-46888380 TTCCCAAAAGGCCATCAGAGAGG + Intergenic
1067652055 10:48163506-48163528 TTCCCAAAAGGCCATCAGAGAGG - Exonic
1069509300 10:69029687-69029709 TTCCCAAGGGGAACCCAGCCTGG + Intergenic
1070278787 10:75033724-75033746 TGGCCAAAGGGAACACAGAGGGG - Intergenic
1070322645 10:75365948-75365970 TTCCCAGAGGAGCCCCAGTGAGG + Intergenic
1070570954 10:77638744-77638766 TCCCCAAAGAGCCCCCAGTGGGG + Intergenic
1074743610 10:116508679-116508701 TTCCCATCTGGACCCCAGAGAGG - Intergenic
1074887532 10:117705764-117705786 TTCCCAAAGAAAGCCCAAAGAGG + Intergenic
1075445490 10:122509923-122509945 TTTCCCAAGGTCCCCCAGAGGGG + Intronic
1075764228 10:124879866-124879888 CTCCCAAGGTGAGCCCAGAGGGG - Intergenic
1076659805 10:132048022-132048044 TTCATAAAGGGTCCCCAGTGTGG + Intergenic
1077310444 11:1886596-1886618 TTCCCAATGCAGCCCCAGAGTGG - Intronic
1080601822 11:33828804-33828826 TTCCCAAATGCAACGCAGAGAGG - Intergenic
1082636954 11:55607833-55607855 TTCCAAAAGGGACACTTGAGGGG - Intergenic
1083404716 11:62448641-62448663 TTCCCAAATGGAACTCAAAGTGG - Intronic
1084401030 11:68942969-68942991 TGCCCAGAGGGATCCCAGAGTGG + Intergenic
1084401294 11:68944977-68944999 TGCCCAGAGGGATCCCAGAGTGG - Intergenic
1084456392 11:69270302-69270324 GTCCCACAGGGACCCCATGGTGG + Intergenic
1086783319 11:90934186-90934208 TCCCCAAATGGGCCCCAGTGTGG - Intergenic
1088009616 11:104984248-104984270 TTATAAAAGAGACCCCAGAGAGG + Intergenic
1088310911 11:108459487-108459509 TTGCCATTGGAACCCCAGAGAGG - Intronic
1088805127 11:113345439-113345461 TTCCCACTGGGAACACAGAGCGG - Intronic
1090599954 11:128359665-128359687 TTCCCTAAGGGATCGCAGACAGG + Intergenic
1090726169 11:129529280-129529302 TTACAAAAGGGGCCCAAGAGAGG - Intergenic
1091129264 11:133131070-133131092 TTACACAAGGGACCCTAGAGAGG + Intronic
1091218511 11:133917850-133917872 ATACCAGAGGGGCCCCAGAGAGG + Intronic
1097443998 12:59646603-59646625 TCCCCACAGAGACCCCACAGGGG + Intronic
1102743567 12:115229833-115229855 TTCCCAAAGTGATTCCACAGAGG - Intergenic
1102775723 12:115516966-115516988 TTCTCAATGGGTCCCCAGGGAGG - Intergenic
1102983420 12:117260196-117260218 TTCCCAAACTGACCTCAGAATGG + Intronic
1104381518 12:128311997-128312019 TGCTGAAAGGGACCCCGGAGCGG + Intronic
1107437133 13:40389951-40389973 TCCCCAGAGGTACCACAGAGAGG - Intergenic
1108178998 13:47822455-47822477 TCCCCACATGGACCCCAGGGAGG - Intergenic
1108704533 13:52973356-52973378 TTCAGCAAGGGTCCCCAGAGTGG - Intergenic
1110727297 13:78840061-78840083 TTATAAAAGGGACCCCAGGGAGG - Intergenic
1111826001 13:93268705-93268727 TTGCCTAAGGGAAGCCAGAGAGG + Intronic
1112366222 13:98757534-98757556 TCCCCAAAGGGACCCAAGTCTGG + Intergenic
1114669495 14:24401288-24401310 TTCCCAAAGGGAAGACAAAGGGG - Intronic
1116941070 14:50791324-50791346 TTCGCAAAGAGACCCAAGAAAGG + Intronic
1120299056 14:82682093-82682115 TTCCCAAAGAAACCACAGAGGGG + Intergenic
1121326291 14:93021738-93021760 TTCTCAAAGGTGCTCCAGAGAGG + Intronic
1121341571 14:93108129-93108151 CTCCCCAAGGGCCACCAGAGTGG + Intronic
1121727683 14:96165209-96165231 TTCCCCAGGGGACCCCAGCCTGG + Intergenic
1124438694 15:29671754-29671776 AGCCCACAAGGACCCCAGAGAGG - Intergenic
1124440026 15:29678868-29678890 TCCCCTAAGGGACCTCAGACTGG + Intergenic
1127734911 15:61831226-61831248 ACCCCACAGGGACCCCAGTGTGG + Intergenic
1128946545 15:71826673-71826695 AAACCAAAGAGACCCCAGAGGGG - Exonic
1129167309 15:73786056-73786078 TTCCCAAAGAGGCATCAGAGGGG + Intergenic
1129454805 15:75670897-75670919 TTCCCCAGGGGACTCCAGTGAGG - Intergenic
1129711482 15:77822489-77822511 GACACAAGGGGACCCCAGAGAGG - Intergenic
1131717784 15:95132278-95132300 TTATATAAGGGACCCCAGAGAGG + Intergenic
1132859061 16:2061125-2061147 TTCCCAGAGGGATGCCAGTGTGG + Intronic
1135275051 16:21105087-21105109 TTCACAAAGGAAACCCAGGGTGG - Intronic
1137023436 16:35452143-35452165 TTCCCCAGGTGTCCCCAGAGGGG + Intergenic
1137252943 16:46753178-46753200 TTCCCTGTAGGACCCCAGAGAGG + Intronic
1139836602 16:69843883-69843905 TTCCCAAACAGACCCTAGGGAGG + Intronic
1140886675 16:79250396-79250418 TTCCCAAAGAGACTGCGGAGAGG + Intergenic
1141708840 16:85685795-85685817 GTCTTAAACGGACCCCAGAGTGG + Intronic
1143251503 17:5526504-5526526 TTCCCACAGGCAGCACAGAGAGG + Intronic
1148395040 17:47301093-47301115 TTTCAAAAGGGGCCCCAGAGAGG - Intronic
1148617752 17:49013656-49013678 TTTACTAAAGGACCCCAGAGCGG + Intronic
1149685261 17:58531402-58531424 TTCCCAAAGGGACCCCAGAGAGG - Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1151426171 17:74032432-74032454 TTCCCAAAGGCACACCTGGGAGG + Intergenic
1154412013 18:14146713-14146735 TCCCCACAGGGCTCCCAGAGGGG + Intergenic
1155914089 18:31538994-31539016 TTCCCAAAAGCACAACAGAGTGG - Intronic
1158318428 18:56237461-56237483 CTCCCCAAGGGCCCCCAGAAAGG + Intergenic
1161044294 19:2126873-2126895 TACCCAAGGGGACTCCAGAGTGG + Intronic
1162047307 19:8008855-8008877 TTCGCAGAGGGACCCAAAAGAGG + Intronic
1164788775 19:30958810-30958832 TCCCCAAAGGGAGCTCAGATGGG + Intergenic
1165141458 19:33702677-33702699 TTCCCCAGAGGACCCCCGAGGGG + Intronic
1165426211 19:35746788-35746810 TCCCCAAGGGCACCCCAGCGGGG - Exonic
1166144685 19:40826009-40826031 AACCCACAGGGACCCCAGATGGG - Intronic
1166183058 19:41122198-41122220 AACCCACAGGGACCCCAGATGGG + Intronic
1168261539 19:55197811-55197833 TTCCCACAGGAACCCCAGGTAGG + Intronic
928758373 2:34553169-34553191 TTATAAAAGGGCCCCCAGAGAGG - Intergenic
931631984 2:64310214-64310236 GTCCCAAAGGGAGGCCAGGGAGG + Intergenic
933157551 2:78992590-78992612 TTACCAAACGGCCACCAGAGGGG + Intergenic
934714635 2:96536663-96536685 TTACCAATGGGAGCCCGGAGTGG + Intergenic
936119141 2:109726478-109726500 TTCACAAAGGGATCCTGGAGGGG - Intergenic
937206529 2:120240203-120240225 TTGCCAAAGGAAGCTCAGAGAGG + Intronic
937792785 2:125980083-125980105 TTCCCAAGGGAATCCCAGAAAGG + Intergenic
938383668 2:130850208-130850230 TTCCCAAGAGGCCCCTAGAGAGG - Intronic
939623780 2:144451622-144451644 TTCCCAAATGAACCACAGAAGGG - Intronic
940271187 2:151892211-151892233 TTCTCACATGGCCCCCAGAGTGG + Intronic
940950799 2:159671441-159671463 TTTTCAAAGTGAACCCAGAGAGG + Intergenic
942201702 2:173577885-173577907 TCTCCAAAGTCACCCCAGAGTGG + Intergenic
945929950 2:215844741-215844763 TTCCCGAAGGGAAACCAGAAGGG - Intergenic
946460128 2:219861595-219861617 TTCCCAAATGGACCACATACTGG + Intergenic
947811996 2:233010678-233010700 TTCCCAAAAGCAGCCCACAGAGG + Intronic
947812348 2:233012441-233012463 TTCTGAAAGGGGCCCCTGAGCGG + Intronic
947822656 2:233082904-233082926 TTCCCCAGGGGACTCCAGACAGG - Intronic
1170512146 20:17088579-17088601 TTCCAAGAGGCATCCCAGAGTGG + Intergenic
1171949764 20:31410694-31410716 TTCCAGAAGGGACTGCAGAGAGG + Intronic
1171968837 20:31550446-31550468 GTGCCAAGGGGACCCCAGTGAGG - Intronic
1172901786 20:38340497-38340519 TTCCAAAAGGAACCCCAGGAAGG - Intergenic
1173116116 20:40244717-40244739 TTCCCAAAGGGATCCCTTTGTGG + Intergenic
1173758953 20:45543025-45543047 TTTGCAAGGAGACCCCAGAGTGG + Intronic
1174839112 20:53885041-53885063 TTGCCAAAGGCATCCCAGACAGG - Intergenic
1175720242 20:61281336-61281358 TTACAAAAGGGACCCCAGAGAGG + Intronic
1175905613 20:62378014-62378036 CCTGCAAAGGGACCCCAGAGAGG - Intergenic
1175912718 20:62412462-62412484 TCCCCAAATGAACCCCACAGAGG - Intronic
1176307324 21:5130578-5130600 TTCCCAAGGGCACTGCAGAGGGG + Intergenic
1176861020 21:14011614-14011636 TCCCCACAGGGCTCCCAGAGGGG - Intergenic
1177383194 21:20372149-20372171 TTCCCCTAGAGACCCCAGAAAGG + Intergenic
1178347633 21:31845283-31845305 TTATAAAAGGGATCCCAGAGAGG + Intergenic
1179849735 21:44131452-44131474 TTCCCAAGGGCACTGCAGAGGGG - Intergenic
1179888017 21:44322702-44322724 TTCCCACGGGGAGCCCAGCGGGG + Intronic
1180235778 21:46458735-46458757 CTCCCAATGGGAGCCCGGAGCGG + Intergenic
1181020691 22:20100646-20100668 TTCACAGAAGAACCCCAGAGTGG - Intronic
1181027046 22:20132384-20132406 CTCCCCATGGGACCCCCGAGGGG + Intronic
1181680648 22:24494246-24494268 TTCTCAATAGGACCCCAAAGAGG + Intronic
1182005247 22:26954415-26954437 TTGCCAAAGGGACTCCCAAGAGG - Intergenic
1182546762 22:31081210-31081232 TTCCCAATGGGGCACGAGAGTGG + Intronic
1182749210 22:32628215-32628237 TTCCAAAAGGCTCCACAGAGAGG + Intronic
1183003835 22:34883791-34883813 CTCCCCAAGGGACCCTGGAGGGG - Intergenic
1184080266 22:42214370-42214392 TTCCACAAGGGACCCAACAGGGG - Exonic
1184742842 22:46439145-46439167 TTCCTAAAGAGACCCCCGTGTGG + Intronic
950810327 3:15644800-15644822 GTACCAAAAGGACTCCAGAGGGG - Exonic
952638358 3:35558770-35558792 TTGCCAAAAGGACCCCAAATAGG + Intergenic
952926934 3:38326995-38327017 TTTCCAGAAGGACTCCAGAGAGG - Intergenic
952977076 3:38705567-38705589 TTCAAAAAGGGACCCTGGAGAGG - Intronic
956170664 3:66431147-66431169 TTCTCAAAGGGAAATCAGAGGGG - Intronic
956527848 3:70184766-70184788 TTCCCAAAGATTCCCCAGAAAGG - Intergenic
959535224 3:107477161-107477183 TTCTCAAAGGCACCTCTGAGTGG - Intergenic
959580447 3:107977730-107977752 TTTCCCAAGGGACTGCAGAGAGG - Intergenic
960945691 3:122964915-122964937 TTCCCAGAGGGGCTCCACAGTGG + Intronic
961352770 3:126314609-126314631 TTCCCACAGTGACCCCAGCAGGG + Intergenic
961946311 3:130692703-130692725 TGCCCACAGGGGCCCCACAGGGG + Intronic
962707840 3:138062431-138062453 TCCCCAAAAGGACCCCAGATAGG + Exonic
962807197 3:138936273-138936295 TTCTCACTGGGTCCCCAGAGTGG - Intergenic
963727267 3:148936533-148936555 TTGCCAAAGTGCCCCCAAAGGGG + Intergenic
967895246 3:194390111-194390133 TACTCAATGGAACCCCAGAGAGG + Intergenic
968626873 4:1629723-1629745 CTCCCAAAGGGACCCCAGGTTGG - Intronic
969206271 4:5648905-5648927 TTCCCAAAGGGCTGCAAGAGAGG + Intronic
969396721 4:6926546-6926568 TTCCCAAAGGTAGTTCAGAGAGG - Intronic
970075192 4:12210530-12210552 TTATAAAAGGGACTCCAGAGAGG + Intergenic
972187627 4:36550905-36550927 TTATAAAAGGAACCCCAGAGAGG - Intergenic
976338386 4:83917469-83917491 TGATCAAAGGGACCCCAGGGTGG - Intergenic
976838792 4:89407172-89407194 TTATAAAGGGGACCCCAGAGAGG + Intergenic
978514420 4:109556283-109556305 TTCCTAAAAGCACCCCAGATAGG - Intergenic
981296140 4:143134003-143134025 TTGCCAAAGGGATACCAGGGTGG - Intergenic
981704877 4:147648411-147648433 TTCCTAGAGGGTGCCCAGAGAGG + Intronic
981764771 4:148236079-148236101 TTCCCAAGGGGACGTCAGATGGG - Intronic
982115328 4:152094203-152094225 TTACCAAAGAGACTGCAGAGAGG + Intergenic
984700177 4:182814044-182814066 ATGCCAAAGGGACCCCACAGGGG + Intergenic
985675985 5:1231546-1231568 TTCCCCCAGGGACCCCAGGGCGG - Intronic
987311104 5:16681895-16681917 GTCCAAAGGGGACACCAGAGTGG - Exonic
989983247 5:50667287-50667309 TTGCCAAATGAACCCCAGAATGG - Intronic
991633215 5:68677788-68677810 TTACAAAAGAGACCCTAGAGAGG + Intergenic
992996566 5:82339805-82339827 TTCGTAAGGGGACCTCAGAGTGG - Intronic
993772059 5:91940723-91940745 TTTTCAAAAGGACCCAAGAGCGG + Intergenic
995458283 5:112375187-112375209 GTCCCAGAGTGAGCCCAGAGTGG + Intronic
995574061 5:113511543-113511565 TTCCCAAGGGAAGGCCAGAGAGG - Intergenic
997200654 5:132008258-132008280 GTCCTAATGGGAGCCCAGAGTGG + Intronic
999490221 5:152042904-152042926 TTACAAAAGAGACCTCAGAGAGG - Intergenic
1001293931 5:170485642-170485664 TTCCCAAAGGGGCCAGGGAGAGG + Intronic
1001419318 5:171574573-171574595 GGGCCAATGGGACCCCAGAGGGG - Intergenic
1001798803 5:174525868-174525890 TTCCCAAAGGGACATCTGGGTGG - Intergenic
1002860276 6:1073990-1074012 TTTCTAAAGGGACCCCAGAGAGG + Intergenic
1004241991 6:13931920-13931942 TTATAAAAGAGACCCCAGAGAGG + Intronic
1005363670 6:25056153-25056175 TTCCCAAAGGCAGGCCTGAGGGG + Intergenic
1005976501 6:30804125-30804147 TTCACACAAGAACCCCAGAGGGG - Intergenic
1006682904 6:35810150-35810172 TTATAAAAGGGACCCCAGAGGGG - Intronic
1008644732 6:53502359-53502381 TTCCCACATGTATCCCAGAGGGG - Intronic
1010836100 6:80588897-80588919 TTCCCAAAGGGACTCCTGCTTGG - Intergenic
1011240146 6:85263379-85263401 TTTCTAAAGGGGCCACAGAGAGG + Intergenic
1012759975 6:103287820-103287842 TTCCCAGAGAGACCTCATAGAGG - Intergenic
1015561250 6:134518479-134518501 TTCCCAAGGGCACCCTAGAAGGG + Intergenic
1017575485 6:155797738-155797760 TTCCGAAAGGGTAGCCAGAGTGG + Intergenic
1020199078 7:6065135-6065157 TGTCCAAAGGGAACCTAGAGGGG - Intergenic
1022041605 7:26587101-26587123 TTGCCAAGGGGACCCCAGTGGGG - Intergenic
1022560044 7:31338364-31338386 TGCCCAAGGGGACCCCTGGGTGG + Exonic
1030354730 7:108529516-108529538 TTGCCATAGGGAACCAAGAGCGG + Intronic
1030865998 7:114702416-114702438 TTACAAAAGAGGCCCCAGAGAGG + Intergenic
1032920711 7:136543348-136543370 TTGCCAAATGTCCCCCAGAGGGG + Intergenic
1034781341 7:153885447-153885469 TGATAAAAGGGACCCCAGAGAGG + Intergenic
1035463624 7:159061906-159061928 CTCCCACCGGGATCCCAGAGCGG - Intronic
1035744647 8:1952813-1952835 TTCCCAAAGTGACCGGTGAGTGG + Exonic
1040551216 8:48439040-48439062 TTCCCACAGGGAGCACACAGTGG - Intergenic
1041303580 8:56437908-56437930 CTCTCAGAGGGAGCCCAGAGCGG + Intronic
1043419918 8:80087760-80087782 TTCCCAGAGGGAGACCAGTGGGG + Intronic
1044941132 8:97345082-97345104 TTCCCAGAGGGACCTCAGTTTGG + Intergenic
1051351800 9:16204531-16204553 TTCAAAAAGGGACCCAAGATTGG - Intronic
1052829369 9:33202561-33202583 TGCCCAGAGGCACCCCAGTGTGG - Intergenic
1053268909 9:36736512-36736534 TTCCCCAGGGGAGCCCACAGAGG - Intergenic
1053442744 9:38129477-38129499 CTCCCTAAGAGCCCCCAGAGAGG - Intergenic
1053526118 9:38832701-38832723 TTGCCAGAGGAAGCCCAGAGAGG + Intergenic
1054198345 9:62057126-62057148 TTGCCAGAGGAAGCCCAGAGAGG + Intergenic
1054640009 9:67531237-67531259 TTGCCAGAGGAAGCCCAGAGAGG - Intergenic
1056395172 9:86175292-86175314 TTCCCAAGGGGACCAGACAGAGG - Intergenic
1057847930 9:98539658-98539680 TTCCCAAAGTGCTCCCAAAGTGG - Intronic
1058185369 9:101848378-101848400 TTTCCAAAGAAACCCCAGAAAGG - Intergenic
1058743571 9:107967987-107968009 TTCCCCATGGGACTCAAGAGGGG - Intergenic
1061234704 9:129335663-129335685 TCCCCAGAGGTCCCCCAGAGAGG - Intergenic
1061315828 9:129795275-129795297 TGCCCAGAGGGTCCCCAAAGGGG + Intergenic
1061791521 9:133061637-133061659 TCCCCAAAGGGGCTTCAGAGGGG - Intergenic
1061830667 9:133292027-133292049 TTCCCAAAAGGAGCCTAGAGAGG + Intergenic
1185481866 X:452187-452209 TGGCCAAACAGACCCCAGAGTGG - Intergenic
1185978874 X:4753408-4753430 TACACAAAGGGATCCCTGAGTGG + Intergenic
1186275011 X:7928931-7928953 TTAGAAAAGGGACCCCAGAGAGG + Intergenic
1186351951 X:8749091-8749113 TTGCCAAAGGGACCCCGGTGGGG + Intergenic
1186621899 X:11250537-11250559 TTCCCAAGGGGCCTCCAGAAAGG - Intronic
1187648331 X:21374180-21374202 TTCCCGGACGGCCCCCAGAGCGG + Intergenic
1192202484 X:69075513-69075535 GGCTCAAAGGGACCCCAGAAAGG - Intergenic
1195223776 X:102771369-102771391 CTGCCCAAGGAACCCCAGAGAGG - Intergenic
1196822974 X:119718111-119718133 TTATAAAAGAGACCCCAGAGAGG - Intergenic
1200282017 X:154785095-154785117 TTCCCAAAGGGACTGCAGCTCGG + Exonic
1200632691 Y:5609590-5609612 TTCCAAAATTGACCACAGAGTGG - Intronic
1201597140 Y:15682925-15682947 TTATAAAAGGGACCCCAGAGAGG + Intergenic