ID: 1149694879

View in Genome Browser
Species Human (GRCh38)
Location 17:58608988-58609010
Sequence CTTTTAACTCAGATTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 383}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149694873_1149694879 30 Left 1149694873 17:58608935-58608957 CCCTGAAAATGGGTCTGGACTTA 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1149694879 17:58608988-58609010 CTTTTAACTCAGATTAAAAATGG 0: 1
1: 0
2: 2
3: 32
4: 383
1149694874_1149694879 29 Left 1149694874 17:58608936-58608958 CCTGAAAATGGGTCTGGACTTAA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1149694879 17:58608988-58609010 CTTTTAACTCAGATTAAAAATGG 0: 1
1: 0
2: 2
3: 32
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149694879 Original CRISPR CTTTTAACTCAGATTAAAAA TGG Intronic
901653193 1:10754848-10754870 CTCTTAACACAGATTACTAAGGG + Intronic
901727193 1:11251073-11251095 CATTTAACTCATATTTCAAAAGG - Intronic
902340664 1:15781583-15781605 CTGTTAACTAAGAAGAAAAATGG + Intronic
902945495 1:19834165-19834187 CTTTTAGCTCAGGAGAAAAAAGG - Intergenic
903587991 1:24431682-24431704 CCTTTAATTCAGTTTTAAAAGGG - Intronic
904949142 1:34222088-34222110 CTATAAATTCAAATTAAAAAAGG + Intergenic
908475240 1:64480998-64481020 CTTTGAACTCAGAAAAAAAGAGG - Intronic
908795852 1:67831015-67831037 CTTATAAATCAGACTGAAAAAGG + Intronic
908905239 1:69000942-69000964 CTTCTGACTCAGATAAAAACTGG + Intergenic
909101233 1:71351923-71351945 ATTTTATATCAGTTTAAAAATGG - Intergenic
909140310 1:71856058-71856080 CTTCTGACTGAGATTAAGAATGG + Intronic
909660851 1:78080004-78080026 CTATTAACCCAATTTAAAAAGGG - Intronic
910422540 1:87082040-87082062 CTTTTAGCCCAGGATAAAAAGGG + Intronic
910652528 1:89584936-89584958 CTTGTAATTTAGGTTAAAAATGG - Intronic
910726022 1:90339871-90339893 CTGTCAATTCACATTAAAAATGG - Intergenic
910889607 1:92003549-92003571 CTTTTAATTAAAATTTAAAATGG + Intronic
911721859 1:101199797-101199819 TTTTTAACCCAAATCAAAAATGG + Intergenic
913160326 1:116139402-116139424 CTTAAAACTCAGATTTTAAAAGG + Intergenic
915981433 1:160422418-160422440 CTTTTATCTCAGGTAAACAAAGG - Intronic
916316759 1:163457280-163457302 TTTTTAACTGTTATTAAAAATGG + Intergenic
916521994 1:165571860-165571882 CTTTTCCCTCAAATTAAAATGGG + Intergenic
916902254 1:169240136-169240158 GTTTTAACTCATAATAAATATGG - Intronic
916936797 1:169637366-169637388 CATATAACTCAATTTAAAAATGG + Intergenic
916946710 1:169736488-169736510 CTTTGAACTAATTTTAAAAAGGG - Intronic
917297307 1:173533964-173533986 ATTTTAAATCAAATTATAAATGG - Intronic
918312279 1:183293302-183293324 ATTTTAAATCAGATTATAAAAGG + Intronic
918775127 1:188618781-188618803 CTTTAAAACCAGATTAATAAAGG - Intergenic
918903991 1:190466481-190466503 CTTTTTACTAAGATAAAAAGAGG + Intronic
920040685 1:203093734-203093756 CATTTAACTGAGATTACAAAAGG + Intronic
921150935 1:212402492-212402514 CAAATAACTCAGTTTAAAAATGG - Intronic
921200109 1:212796597-212796619 CTTTTAATTAAGATTTTAAAGGG + Intronic
921200757 1:212803519-212803541 CTTTTGTCTCTAATTAAAAATGG - Intronic
921558750 1:216631108-216631130 CTTTTCTATCACATTAAAAACGG + Intronic
921578646 1:216868617-216868639 CTTTTAACTGTATTTAAAAAGGG + Intronic
921608498 1:217182723-217182745 ATTTTAAAACAGAATAAAAATGG + Intergenic
921995169 1:221410289-221410311 CTTCTAACTGAGACTAAAAAGGG + Intergenic
923283950 1:232472805-232472827 TTTTAAACTCAGATACAAAAAGG + Intronic
923457986 1:234182060-234182082 TTTTTAAATCAGTTAAAAAAAGG - Intronic
923960483 1:239077076-239077098 CTATTAATTCAATTTAAAAATGG + Intergenic
1063511315 10:6647504-6647526 CTTTTAAGTCACATTATTAATGG + Intergenic
1063816651 10:9782892-9782914 CTTTTAAGTCACTTTGAAAATGG + Intergenic
1064438936 10:15335830-15335852 TTTCTAATACAGATTAAAAAGGG + Intronic
1064542517 10:16419420-16419442 GGTTTTACTCAGATTAAAAAAGG + Intergenic
1065049349 10:21775153-21775175 CTTTTAAGTGAGAAAAAAAAAGG - Intronic
1065343850 10:24729611-24729633 TTTATAATCCAGATTAAAAAAGG - Intergenic
1065393337 10:25207354-25207376 CTTATGATTCAGTTTAAAAAGGG - Intronic
1065778038 10:29140750-29140772 TTTTTAAGTCAAATTCAAAATGG - Intergenic
1066520041 10:36207350-36207372 CTTATAACACAGAATAAGAAAGG - Intergenic
1067949859 10:50723660-50723682 CTTTTAAATCACTGTAAAAATGG - Intergenic
1067976685 10:51033758-51033780 CAATTAGCTTAGATTAAAAATGG - Intronic
1068204761 10:53835986-53836008 CCTTTATCTCAGATGAAACAAGG + Intronic
1068954505 10:62810089-62810111 ATTTCAATTCATATTAAAAATGG - Intergenic
1069141362 10:64830105-64830127 CTTTTACCTCAGTATAGAAATGG - Intergenic
1069289977 10:66766665-66766687 CCTGGAAGTCAGATTAAAAATGG + Intronic
1069460288 10:68588778-68588800 ATTTTAAGTAAAATTAAAAATGG - Intronic
1071073662 10:81726308-81726330 CTTTTACCAAAGATTAAAGAGGG - Intergenic
1071750215 10:88466999-88467021 CTTAAAACTCAGATTTATAATGG + Intronic
1072831313 10:98661651-98661673 ATACTAATTCAGATTAAAAAGGG - Intronic
1074001415 10:109377374-109377396 TTTTATACTCAGATTAAAGAAGG + Intergenic
1074473498 10:113748544-113748566 CTTTTAGATTATATTAAAAATGG - Intergenic
1075864331 10:125704736-125704758 TTTTGAACTCAGATTTCAAAAGG - Intergenic
1076743625 10:132501009-132501031 ATTTTAACTCAGTCTTAAAAAGG + Intergenic
1077992683 11:7425947-7425969 CATTTAAATCACATTAAAATAGG + Intronic
1078769793 11:14338716-14338738 TTTTTAAACCACATTAAAAAGGG + Intronic
1078982803 11:16556979-16557001 CATTTAACTGACATTGAAAAAGG - Intronic
1081066452 11:38546725-38546747 CTTTTGACTACTATTAAAAAGGG + Intergenic
1081235183 11:40638609-40638631 CATTTAATTAAGATTGAAAATGG - Intronic
1081412897 11:42780973-42780995 CATATAACTCAGTTAAAAAATGG + Intergenic
1082055390 11:47810890-47810912 ATTTTAAGTCAGAATTAAAATGG + Intronic
1085822397 11:79806684-79806706 CGTTTAAGTCAGATGAAAGAAGG - Intergenic
1086074290 11:82833863-82833885 CTTTTAGCTCAGTGTAAGAAAGG - Intronic
1086209738 11:84304955-84304977 ATTTTATTTCAGATGAAAAAAGG - Intronic
1086559752 11:88154238-88154260 CTATGCACTCGGATTAAAAATGG - Intronic
1086609364 11:88736106-88736128 CCTTTAACTGAGACTAAAAGTGG - Intronic
1088795390 11:113263139-113263161 CTTTTTACTGCCATTAAAAAGGG - Intronic
1092076985 12:5681995-5682017 CTTTCAACTTACTTTAAAAATGG + Intronic
1093316956 12:17664221-17664243 TTTTTAATTCAGATAAAAAATGG + Intergenic
1094699893 12:32859331-32859353 CTTTAAACTTAAACTAAAAATGG + Intronic
1095627398 12:44332502-44332524 CTTTTAACTTAGATTACAACAGG - Intronic
1097511903 12:60553566-60553588 CTTTGGACTCAGAATAAATACGG - Intergenic
1097653675 12:62335316-62335338 CTTCTGACTCAGATTACACATGG - Intronic
1098405165 12:70117340-70117362 CTCTGAACTCATTTTAAAAATGG - Intergenic
1098611498 12:72464067-72464089 CTATTAAGCCAGATTAAAAGGGG + Intronic
1099546152 12:83982684-83982706 CTCTTAACTCTGATAATAAATGG + Intergenic
1099698054 12:86045859-86045881 TTTTTAATTCACAATAAAAAAGG - Intronic
1099849377 12:88073359-88073381 CTTTGAACTCACATTAATGAAGG + Intronic
1100903328 12:99268694-99268716 TTTTTAATTTAGAATAAAAAAGG - Intronic
1102977001 12:117213953-117213975 CCCTCAACTCAGATCAAAAATGG - Exonic
1103435215 12:120920171-120920193 CTGTTTCCTCAGTTTAAAAATGG - Intergenic
1104122443 12:125812287-125812309 CTTTTTACTCAGAGTAAAATGGG - Intergenic
1104564619 12:129869686-129869708 CTCCTAACTCAGACAAAAAAAGG - Intronic
1105961248 13:25342728-25342750 CTTTTAAGACATATTTAAAAGGG - Intronic
1106090659 13:26590379-26590401 CTTTTTTCTCAAATAAAAAAAGG - Intronic
1107260559 13:38485504-38485526 GGATTAACGCAGATTAAAAAAGG - Intergenic
1107583399 13:41817050-41817072 CCTTTAACTCAATTTAAAACTGG + Intronic
1108067600 13:46594226-46594248 TTTTTCACTGAGATTAAAAGAGG - Intronic
1108236366 13:48410977-48410999 GTTTTAATTCAAAATAAAAATGG + Intronic
1108373099 13:49790515-49790537 CTTGTTACACAGATTAAATAAGG + Intronic
1109110392 13:58311039-58311061 CTTTTAATTCATATAAGAAAAGG + Intergenic
1109534201 13:63694672-63694694 CTTTGAACTCAGACTCAAACTGG - Intergenic
1110031879 13:70625912-70625934 CTTTTCACTCAAAATAACAAGGG - Intergenic
1110697516 13:78508900-78508922 CTTTTAAAGCAGATATAAAATGG + Intergenic
1111110537 13:83702978-83703000 CTTTTAACTCACAATAACACTGG - Intergenic
1111311023 13:86486240-86486262 CTTTTAACTAAAATCAAAAATGG - Intergenic
1111401608 13:87744117-87744139 CTTTTAAATTAGGTTAACAATGG - Intergenic
1112632349 13:101176129-101176151 CTTTTATCTAATATTAACAAGGG - Intronic
1114006314 14:18317535-18317557 CTTATAAGTAACATTAAAAATGG + Intergenic
1116190990 14:41666087-41666109 CATTTTACTAACATTAAAAAGGG + Intronic
1116423606 14:44762790-44762812 CTTTTAGATCAAAATAAAAATGG - Intergenic
1116468302 14:45257955-45257977 CTTTTAAATCATATAAAAAAAGG + Intergenic
1117567612 14:57011210-57011232 CTTTTCTCTGAGACTAAAAAAGG + Intergenic
1118255874 14:64205420-64205442 TTTTTAACCCAGACCAAAAATGG - Intronic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1118861385 14:69666940-69666962 CTTGTTACTCAGAATAACAAAGG - Intronic
1119005179 14:70919425-70919447 CATTTAACTCAGATAACAGAAGG - Intronic
1120150277 14:81024590-81024612 TTTTTATCTCATATTGAAAATGG - Intronic
1120384217 14:83823671-83823693 GTTTTATCTGCGATTAAAAACGG + Intergenic
1120794562 14:88618332-88618354 CTTTTTCATCAGATTAAAATGGG + Exonic
1123663129 15:22583573-22583595 CTTGTAACTCAGAATATATAAGG + Intergenic
1123951369 15:25280277-25280299 CTTTGATCTCAGACTAAAAAAGG - Intergenic
1124316931 15:28677876-28677898 CTTGTAACTCAGAATATATAAGG + Intergenic
1124643467 15:31416251-31416273 CTAATATCTCACATTAAAAAAGG + Intronic
1124916610 15:33981475-33981497 CTTTTAACAGATACTAAAAATGG + Intronic
1125130271 15:36276487-36276509 CTTTAAACTCACAGTAAAAAAGG - Intergenic
1126075873 15:44908960-44908982 CAATTAACCCAGATTAAAAATGG + Intergenic
1126214581 15:46140108-46140130 CTTTTAATTCAGAGAATAAAAGG + Intergenic
1127108014 15:55637872-55637894 CTTTTAGCTTATATTAAACATGG - Intronic
1130787814 15:87119693-87119715 TTTTTAAATCAGCTTAAAAGTGG - Intergenic
1131844182 15:96471329-96471351 CTTTGAAGACAGATTAAAAACGG - Intergenic
1132283774 15:100643945-100643967 CTTTTTATTAATATTAAAAAGGG + Intronic
1133545573 16:6802978-6803000 CTTTTAGAACAGATTAGAAAAGG - Intronic
1134671412 16:16058219-16058241 TTTTTAACTGTGCTTAAAAAGGG - Intronic
1140227130 16:73087577-73087599 ATTATAACTCTAATTAAAAATGG + Intergenic
1140960809 16:79910692-79910714 CTTATAAGTCAAATTAGAAATGG + Intergenic
1142837627 17:2600250-2600272 TCTTTACCTTAGATTAAAAATGG - Intronic
1143244593 17:5472910-5472932 CTTTTTAAGCAGTTTAAAAAAGG - Exonic
1144375051 17:14631023-14631045 CTTTAAAATCAGCTTCAAAATGG + Intergenic
1144430869 17:15190737-15190759 CTTTTAATTTAGATCAGAAAGGG - Intergenic
1146437128 17:32860614-32860636 CTTTTAAGTGAGAATAATAAAGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146758663 17:35455801-35455823 CCTTTAAGTCAGACTAAGAAGGG + Intergenic
1148160449 17:45447032-45447054 TTTTGAATTCAGATTAAAAGAGG + Intronic
1149031001 17:52081900-52081922 CTAGTCACTCAGACTAAAAAGGG - Intronic
1149228893 17:54508986-54509008 ATTTTAACTCAAATTAACACAGG - Intergenic
1149445913 17:56713349-56713371 CTATTAACTCATATGTAAAATGG + Intergenic
1149694879 17:58608988-58609010 CTTTTAACTCAGATTAAAAATGG + Intronic
1149741280 17:59048246-59048268 CCTTTAACTCAGTTTATCAAAGG + Intronic
1150391738 17:64793911-64793933 TTTTGAATTCAGATTAAAAGAGG + Intergenic
1151551118 17:74823066-74823088 CTTTTAAGACAGAATGAAAAGGG - Intronic
1153316416 18:3726981-3727003 GATTCAACTTAGATTAAAAATGG + Intronic
1155123326 18:22844636-22844658 CTTTTGCCTTAGATTAAAAATGG - Intronic
1155264843 18:24081801-24081823 CTATTAATTCACATTAATAAAGG - Intronic
1155590842 18:27425348-27425370 CACTTAACTAAGAATAAAAAAGG - Intergenic
1155901059 18:31390934-31390956 CTTTTAATTTTTATTAAAAATGG - Intronic
1156041212 18:32825057-32825079 CTTTTCACTCAGATCAAGAGAGG - Intergenic
1156201151 18:34833763-34833785 TTTGAAACTCAGATTAGAAAAGG + Intronic
1156262802 18:35460287-35460309 CTTTTTACTCAGAGTAAGCAGGG - Intronic
1156582049 18:38388945-38388967 CTTTTTATTCTAATTAAAAATGG + Intergenic
1156616817 18:38796382-38796404 GTTTTAGGTCAGATTATAAAGGG - Intergenic
1157839974 18:50948278-50948300 CATTTTACTGGGATTAAAAAAGG - Exonic
1160523078 18:79520080-79520102 CTTGGAAGTCAGATTTAAAATGG + Intronic
1162596206 19:11631190-11631212 CTAATAATTCAAATTAAAAATGG + Intergenic
1164450891 19:28363457-28363479 CTATGACCTCAGATTAAACAAGG + Intergenic
1164897317 19:31888191-31888213 CAGTTAACTCAGCTTCAAAATGG + Intergenic
1164899582 19:31907095-31907117 CCTCTAACTCATGTTAAAAATGG + Intergenic
1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG + Intergenic
1166823607 19:45595868-45595890 CTTTTAAAACATGTTAAAAATGG + Intronic
1167874533 19:52400467-52400489 CTGGTGACTCAGATAAAAAAAGG - Intronic
1168529381 19:57115690-57115712 ATTTTAACTTAGATAAATAAAGG - Intergenic
926302549 2:11614837-11614859 CTTTTGGGTCAGATAAAAAAGGG - Intronic
927041471 2:19234811-19234833 TTTCTAACACAGATTGAAAATGG + Intergenic
928216277 2:29364050-29364072 CTATAAACACAGATTCAAAATGG + Intronic
929731787 2:44502434-44502456 CTTTTAACTTTCTTTAAAAATGG + Intronic
930916760 2:56700676-56700698 CTTTACATTCAAATTAAAAAAGG - Intergenic
931996403 2:67843208-67843230 CTTTTAAATCGGAATAGAAAGGG - Intergenic
931999839 2:67874885-67874907 CTTTTAACTAGCATTTAAAATGG + Intergenic
932201422 2:69831231-69831253 CTTTAAAAGCAGATTCAAAAAGG + Intronic
933258906 2:80109932-80109954 GTATTAATTCAGATTAAAAAAGG - Intronic
933318435 2:80742599-80742621 TTTTTAAAAAAGATTAAAAAGGG - Intergenic
934094859 2:88591715-88591737 CTTTTCACTTAGATATAAAATGG + Intronic
934129337 2:88932433-88932455 CTTTTATCTCAGACTCACAAGGG + Intergenic
934144587 2:89078839-89078861 CTTTTATCTCAGACTCACAAGGG + Intergenic
934149234 2:89129537-89129559 CTTTTATCTCAGACTCACAATGG + Intergenic
934158162 2:89222486-89222508 CTTTTATCTCAGACTCACAAGGG + Intergenic
934197512 2:89851681-89851703 CTTTTATCTCAGACTCACAAGGG - Intergenic
934209101 2:89959938-89959960 CTTTTATCTCAGACTCACAAGGG - Intergenic
934218058 2:90052505-90052527 CTTTTATCTCAGACTCACAATGG - Intergenic
934224665 2:90121710-90121732 CTTTTATCTCAGACTCACAAGGG - Intergenic
934789411 2:97046074-97046096 CTTTTATCTCAGACTCACAATGG - Intergenic
934789905 2:97050236-97050258 CTTTTACCTCAGACTCACAAGGG - Intergenic
934816563 2:97332303-97332325 CTTTTACCTCAGACTCACAAGGG + Intergenic
934817065 2:97336466-97336488 CTTTTATCTCAGACTCACAATGG + Intergenic
934820631 2:97372018-97372040 CTTTTATCTCAGACTCACAATGG - Intergenic
934821133 2:97376181-97376203 CTTTTACCTCAGACTCACAAGGG - Intergenic
935009834 2:99123818-99123840 AATATAACTCAGATTCAAAAAGG - Intronic
935374594 2:102381844-102381866 CTTTTAAGTCAGGTTAAAAGTGG - Intronic
935414516 2:102801682-102801704 CTATAAACTCATACTAAAAAGGG + Intronic
936896075 2:117429110-117429132 CATGAAACTCAGATTCAAAAAGG + Intergenic
938637546 2:133245854-133245876 TTTATAACTCAGAGCAAAAAAGG + Intronic
939299407 2:140315990-140316012 ATTTTGACTCAGAATAAAAAAGG + Intronic
939400701 2:141689619-141689641 CTATTATCTCAGATTAAATTTGG - Intronic
939491873 2:142886276-142886298 ATTTTTATTCAGATTAAATAAGG + Intronic
940338616 2:152556063-152556085 CTTTCAACTCCAATTGAAAATGG + Intronic
940404449 2:153284464-153284486 ATATGCACTCAGATTAAAAATGG + Intergenic
941938149 2:171002944-171002966 CTTTTATCTCTAATTGAAAATGG - Intronic
942647260 2:178126190-178126212 TTTAAAATTCAGATTAAAAAGGG - Intronic
942705200 2:178763906-178763928 TTTTTCACTAATATTAAAAAAGG - Intronic
942809007 2:179974386-179974408 CTTGTAACTCATTTTGAAAATGG + Intronic
943145599 2:184040830-184040852 ATTTTCACACAGATTAAAAATGG + Intergenic
943804797 2:192111078-192111100 TCTTTAACACAGCTTAAAAATGG + Intronic
944199106 2:197086432-197086454 CTTTTAACTGAAAAAAAAAAGGG + Intronic
944918888 2:204389924-204389946 CTTTTAATTCAGAATAAAAAGGG - Intergenic
944974373 2:205031449-205031471 CTTTCATCTCAAATTAAAGAAGG + Intronic
945446753 2:209947492-209947514 CTTTTAACTCACAATGACAAGGG - Intronic
945562267 2:211353725-211353747 ATTTTAAATGAGAATAAAAAAGG + Intergenic
945768435 2:214009546-214009568 CTTTTATCTAACAATAAAAATGG - Intronic
945986199 2:216355819-216355841 TTTTTAACACAGAAGAAAAAAGG - Intronic
947110872 2:226718255-226718277 TTATTAAGTCAGTTTAAAAAAGG - Intergenic
947121574 2:226820849-226820871 CTATTAACACAGATCAAAAAGGG + Intergenic
947151585 2:227121683-227121705 AGCTTAATTCAGATTAAAAAGGG - Intronic
947158876 2:227192109-227192131 CTTTTGACACAGAGTATAAACGG + Intronic
947162545 2:227228722-227228744 CTTTTAACGAACAATAAAAATGG + Intronic
948400019 2:237677372-237677394 AATTTAACTCAGAATTAAAAAGG - Intronic
1169699052 20:8426050-8426072 CTTTCAACTCAGCTAAAAAGTGG - Intronic
1169829216 20:9805036-9805058 CAATTAACTCAATTTAAAAATGG + Intronic
1171368904 20:24647711-24647733 TTTTTATCTCAAATGAAAAAGGG - Intronic
1176373200 21:6074760-6074782 CTTTTAACTTAAAAGAAAAAAGG - Intergenic
1176692491 21:9932889-9932911 CTGTTAAATCAAATTAAATATGG - Intergenic
1177761989 21:25412518-25412540 CCTGTAATTCAGATTATAAATGG - Intergenic
1179750277 21:43463483-43463505 CTTTTAACTTAAAAGAAAAAAGG + Intergenic
1180430824 22:15248348-15248370 CTTATAAGTAACATTAAAAATGG + Intergenic
1180588479 22:16915034-16915056 CTTTTATCTCAGACTCACAAGGG + Intergenic
1180589256 22:16922228-16922250 CTTTTATCTCAGACTCACAAGGG + Intergenic
1183816273 22:40303567-40303589 CTTATAAGGCAGATTATAAATGG - Intronic
1185011702 22:48318181-48318203 ATTTTACCACAGTTTAAAAAAGG - Intergenic
1185374467 22:50475569-50475591 CATTTAACACAGCTTAAAAACGG + Intergenic
949326692 3:2874069-2874091 CTATTAAATCAGATTAGCAATGG - Intronic
950587127 3:13901503-13901525 CTTTGAGCTCAGATAAAAACTGG - Intergenic
951193899 3:19803369-19803391 GTATGCACTCAGATTAAAAACGG - Intergenic
951369979 3:21833922-21833944 CTTTTAAATCATTTCAAAAATGG - Intronic
951706445 3:25548690-25548712 CTGATAACACATATTAAAAAAGG - Intronic
952039303 3:29242119-29242141 CTGATAACTGAGATGAAAAAAGG + Intergenic
952692667 3:36228060-36228082 CTTTGCACACAGATTAAAAGCGG - Intergenic
953126776 3:40098019-40098041 CTAATAACTCTGATTTAAAAGGG - Intronic
954008576 3:47614169-47614191 CTTTTACCTCAGGTATAAAAAGG - Intronic
954592816 3:51798391-51798413 GTTTGAAATCAAATTAAAAAGGG - Intergenic
955782392 3:62499036-62499058 CTTTTAACTGGGATTGCAAAGGG - Intronic
955795017 3:62626770-62626792 TTTTTAACTTAGATTTTAAAAGG - Intronic
955928087 3:64027648-64027670 CTTGCAACACAGATAAAAAAAGG - Intergenic
957549325 3:81683545-81683567 CTTTTTACTCAAATGAAAATAGG + Intronic
958256763 3:91333528-91333550 GTGTGTACTCAGATTAAAAATGG + Intergenic
958670083 3:97192456-97192478 CTGATAACCCAGTTTAAAAATGG - Intronic
958821959 3:98985547-98985569 CTCTTAAATCAGCTTAAGAAAGG - Intergenic
959628473 3:108481008-108481030 CCTTTAGCTCATTTTAAAAATGG - Intronic
962057277 3:131885882-131885904 CTATTAATTCAGTTTTAAAAGGG + Intronic
962101011 3:132342629-132342651 CTTTTACCTCACAATATAAAGGG - Exonic
963719137 3:148839897-148839919 CTTTTCACTCAAAGTAGAAAGGG + Intronic
966251721 3:177873619-177873641 CTATTTATTCAAATTAAAAATGG - Intergenic
967635286 3:191793899-191793921 CATTTAACTTATATTAAGAAAGG - Intergenic
967712490 3:192725201-192725223 CTTGGCAATCAGATTAAAAATGG - Intronic
970213539 4:13735247-13735269 GTTTTTATTCAGATTATAAATGG + Intergenic
971669476 4:29538031-29538053 TTTTTATCTGAGATTGAAAAAGG - Intergenic
971928498 4:33047225-33047247 ATGTAAACTCAGGTTAAAAATGG + Intergenic
972036056 4:34522854-34522876 CTTTTAAATCAGATTATTTAGGG + Intergenic
973033676 4:45377710-45377732 CTTAGATCTCAGAATAAAAAGGG - Intergenic
974171307 4:58270339-58270361 CTTTAAACTCATGTTTAAAAGGG + Intergenic
975113559 4:70653326-70653348 CATTTAATTCAAATTAAAAAGGG + Intronic
975233599 4:71964482-71964504 CTTTTAACTCACCTTTAACATGG + Intergenic
975985032 4:80194662-80194684 TATTTAACTCATAATAAAAAGGG + Intronic
976723232 4:88190923-88190945 CAAATAACTCAGTTTAAAAAGGG + Intronic
976910535 4:90299798-90299820 CATTTAACCCAGATTTAAACAGG - Intronic
976942703 4:90725295-90725317 TTTTTAACAGAGGTTAAAAAAGG + Intronic
977095108 4:92732642-92732664 CTTTTAACCAAGATTTCAAATGG + Intronic
978270826 4:106888087-106888109 CTTTTAAATCAGCAGAAAAAAGG + Intergenic
978824657 4:113007152-113007174 ATTTTAACTTATAATAAAAATGG + Intronic
979042805 4:115819464-115819486 CTATTAATTCAGTTTAAAAATGG - Intergenic
979565350 4:122148569-122148591 CTTCTGAGTCAGATTAAATAAGG - Intergenic
980031292 4:127835103-127835125 ATTTTAATGCAGATTAAAATTGG - Exonic
980364881 4:131789717-131789739 TTTTTATCTCAGATTATGAATGG - Intergenic
980365079 4:131793110-131793132 CTGTTAAATCAAATTAAATATGG - Intergenic
981813741 4:148805073-148805095 GTTTACACTCAGATTCAAAAAGG + Intergenic
982289982 4:153770313-153770335 CTAATAACTCAATTTAAAAATGG - Intergenic
982455055 4:155599605-155599627 CTTTTACCTCATAATACAAATGG + Intergenic
982595397 4:157377224-157377246 CTATTTACTGAGATTAGAAATGG + Intergenic
983383988 4:167034635-167034657 CTTTTAATCCAGATAAAATATGG + Intronic
983442703 4:167807774-167807796 CTTTAAATTCTGATAAAAAATGG - Intergenic
983473402 4:168184723-168184745 CTTTTATCTCAGTTTCAAAAAGG - Intronic
984232666 4:177117732-177117754 ATTTTAACTCATGTTAAAGAGGG - Intergenic
984470625 4:180167996-180168018 CTTTTCACACTGAATAAAAATGG - Intergenic
985384249 4:189428785-189428807 CTTTTATCTCAAATTTCAAATGG + Intergenic
986918552 5:12657183-12657205 CTTTCAACTCATAGAAAAAAGGG + Intergenic
987311893 5:16689013-16689035 CTTTTGACTGAGATTAGAAGAGG - Intronic
987624495 5:20380758-20380780 CTTTTAAACAAAATTAAAAATGG + Intronic
988098761 5:26652166-26652188 CTTTTAAATCAGATTTGAATAGG - Intergenic
988383283 5:30527314-30527336 TTTTTAACTTAGTTAAAAAAAGG + Intergenic
990472153 5:56125667-56125689 CTTTTAACTCAGGGAAAAAATGG - Intronic
992459644 5:76948490-76948512 CTATTAAGTCATTTTAAAAATGG + Intergenic
994008487 5:94870963-94870985 CTTTTCCCGCAGATTCAAAATGG - Exonic
995001650 5:107138586-107138608 ATTTCAACTCAGGGTAAAAAGGG - Intergenic
995074300 5:107963482-107963504 CTTTGAAGTCAGAAAAAAAATGG + Intronic
995235946 5:109830648-109830670 CTTTTAAATCAAACTAAATATGG - Intronic
995515256 5:112948460-112948482 ATTTTAACTAAAATTAAAAATGG + Intergenic
995886200 5:116896840-116896862 TTTTTAAATCAGAATATAAAAGG - Intergenic
996175913 5:120357345-120357367 CTTTTCCCAAAGATTAAAAAAGG + Intergenic
996460676 5:123738077-123738099 CTATTAAATCAGGTTAATAATGG - Intergenic
998084794 5:139311334-139311356 CTGTAAAATCAGATTAATAAAGG - Intronic
998592831 5:143496185-143496207 TTTTTAATACAGATTTAAAAAGG + Intergenic
999772312 5:154784959-154784981 CTTTTTACTCAGAACAGAAAAGG - Intronic
999875029 5:155795082-155795104 CTTTTTACTGAGAGTGAAAATGG + Intergenic
1000507331 5:162137537-162137559 TTTTTAACTAAGCTAAAAAAAGG - Intronic
1001262872 5:170247309-170247331 CTTTTAACTGATGATAAAAATGG - Exonic
1003316045 6:5012965-5012987 CTTGTAACTGGGATTAAAATGGG - Intergenic
1003506949 6:6747979-6748001 ATTTTAAATCAGTTTAAAACAGG - Intergenic
1003742489 6:8958362-8958384 AATTTAACTCAGATTATGAAAGG - Intergenic
1004196386 6:13509758-13509780 CTGATACCTCACATTAAAAACGG + Intergenic
1004683768 6:17921965-17921987 CTTTTAAATCAGGTAAAAAGGGG + Intronic
1005132015 6:22520340-22520362 CTTTTAACTTGGTTTAAAGATGG - Intergenic
1005246220 6:23888447-23888469 TTTTTAAGTCAGACTAGAAATGG + Intergenic
1005313048 6:24577225-24577247 CTCTTAACGGAGACTAAAAATGG + Intronic
1007868578 6:45005367-45005389 TTTTTAACTTAGATAACAAAGGG - Intronic
1008198015 6:48549499-48549521 TTTTTAGCTCATTTTAAAAATGG - Intergenic
1008244529 6:49153793-49153815 CTTTTCTCTCAGATTATACATGG + Intergenic
1008453382 6:51679517-51679539 TCTTTATCTCAGAATAAAAAGGG - Intronic
1008998573 6:57687634-57687656 GTGTGTACTCAGATTAAAAATGG - Intergenic
1009639923 6:66321256-66321278 CTATGCACTCAGAATAAAAAAGG + Intergenic
1010107441 6:72186543-72186565 CTGTTCACTCAGATTTAAAGTGG + Intronic
1010648029 6:78417110-78417132 CTATTAACTGAGAGTAAATAGGG + Intergenic
1010741887 6:79516495-79516517 ATTTTTAGTCAGATAAAAAAGGG + Intronic
1013275597 6:108581958-108581980 CATTTATCTCAGAAAAAAAATGG - Intronic
1013674310 6:112440474-112440496 CTTTTAACTCAGAATACCTACGG + Intergenic
1013971867 6:116029876-116029898 CTTAAAAATCAGGTTAAAAAAGG - Intronic
1014017020 6:116543886-116543908 CTTTTTACTTAGAGAAAAAAGGG + Intronic
1014326619 6:120004416-120004438 TTTATAACTCAGATTTGAAAAGG - Intergenic
1015096940 6:129427110-129427132 GTTTAGACTCAGATTAAAAAAGG - Intronic
1017305054 6:152908176-152908198 CTTTTAACTGATATTTCAAATGG - Intergenic
1017310985 6:152977391-152977413 TTTTTAACTCAAAGTAGAAATGG + Intronic
1018637271 6:165873733-165873755 TTTTTTATTCAAATTAAAAAGGG - Intronic
1020447941 7:8289107-8289129 CTGTTAGCTCAAATTAATAAGGG + Intergenic
1020454396 7:8354876-8354898 CTTTAAGCTGAGATTAAGAAGGG - Intergenic
1021051228 7:15987789-15987811 CTTTGAACTCAAATTAGAATTGG + Intergenic
1021294388 7:18886828-18886850 CTTTGAGCTCAGACAAAAAATGG + Intronic
1021390057 7:20081809-20081831 CTTTTGAGTCAGATTAACCAGGG - Intergenic
1021675815 7:23080031-23080053 TTTTTAACTAAGAGGAAAAATGG - Intergenic
1023780841 7:43653632-43653654 TTCTTAACTCAGCTTAACAAAGG - Intronic
1025726657 7:64068714-64068736 TTTTTAACTCTGAGAAAAAATGG - Intronic
1025793060 7:64710934-64710956 ATTTTAACTAAGATTAAAAATGG - Exonic
1027419298 7:78004299-78004321 TTGTTGACTCAGATTAAAAACGG + Intergenic
1027757852 7:82238376-82238398 CTAATAAGTCACATTAAAAATGG + Intronic
1027879999 7:83822505-83822527 CATTTATATCAGTTTAAAAAAGG - Intergenic
1027969677 7:85062745-85062767 CTTTTAATCTAGAATAAAAATGG + Intronic
1029171552 7:98633146-98633168 CTTTTAAATCAGATAAAAGAAGG - Intergenic
1030239383 7:107304368-107304390 CATTTAACTCACATTTTAAAGGG - Intronic
1031255763 7:119446211-119446233 TTTTTAATTCAAATTCAAAATGG - Intergenic
1031504685 7:122567338-122567360 CTTTTAATTTATATGAAAAAAGG + Intronic
1032564115 7:132923220-132923242 TTTTTAATTTAGATTCAAAAAGG + Intronic
1032600066 7:133284421-133284443 ATTTGAACTAAGATTTAAAATGG + Intronic
1033322055 7:140348821-140348843 CTTTTAAATGACATTAAAAATGG - Intronic
1034371010 7:150596942-150596964 CTTTTAAATCAGTTAACAAAAGG - Intergenic
1034371816 7:150605445-150605467 CTTTTAAATCAGTTAATAAAAGG - Intergenic
1035465704 7:159075149-159075171 CTGTTAAATAAGAATAAAAATGG + Intronic
1035888900 8:3323495-3323517 CTTTTAACTCCTTCTAAAAATGG - Intronic
1035899047 8:3437671-3437693 CTTTTGACTGTGATTAGAAAGGG - Intronic
1036372551 8:8173634-8173656 TCTTTAACACAGATGAAAAATGG + Intergenic
1036878352 8:12492007-12492029 TCTTTAACACAGATGAAAAATGG - Intergenic
1037852992 8:22347962-22347984 CATGGAACTCAAATTAAAAAGGG - Intronic
1038331998 8:26616483-26616505 CATTTATCTGAGATGAAAAAGGG + Intronic
1038891435 8:31728953-31728975 CTTCTAACTCAGAGTCAACATGG - Intronic
1039926502 8:41938490-41938512 TTTTCAAATTAGATTAAAAATGG + Intronic
1040600848 8:48882744-48882766 CTTTTGACACAAATGAAAAATGG - Intergenic
1040680488 8:49802529-49802551 GTGTTAACTCTGATTAAAGAAGG - Intergenic
1041111097 8:54483238-54483260 CAAATAACTCAGTTTAAAAATGG + Intergenic
1044366173 8:91348714-91348736 TTTTTTCCTGAGATTAAAAAAGG + Intronic
1044366466 8:91352838-91352860 ATTTTAACTTAAATTTAAAAGGG - Intronic
1044865558 8:96567695-96567717 ATTCTTAATCAGATTAAAAATGG - Intronic
1045128921 8:99126241-99126263 CTCTTAACTCAGAGTAAGCATGG + Intronic
1045264150 8:100604699-100604721 TTTTAAACTCAGGTTAAAAGAGG + Intronic
1045415429 8:101961742-101961764 CTTTTAATTCAAATTTACAAAGG + Intronic
1048227779 8:132605977-132605999 CCTTTAACTCTGAATAAAATGGG + Intronic
1049987723 9:967847-967869 CTTTCAACTCAGAATAGAAATGG + Intronic
1050051398 9:1605624-1605646 TTTGTAATTGAGATTAAAAAAGG + Intergenic
1050479107 9:6071769-6071791 TCTTTAAATAAGATTAAAAATGG - Intergenic
1050788285 9:9432467-9432489 CTAATACCTCAGTTTAAAAAAGG + Intronic
1051209452 9:14726344-14726366 TTTTTAACTCAGAAGAAAACAGG + Intergenic
1051829584 9:21260643-21260665 CATTTAACTTAATTTAAAAAGGG + Intergenic
1052141033 9:24983875-24983897 CATTTAATTTACATTAAAAAAGG - Intergenic
1053235367 9:36449090-36449112 CTTGTAACTCTTATTAATAATGG + Intronic
1053629437 9:39918961-39918983 CTGTTAAATCAAATTAAATATGG - Intergenic
1053776331 9:41544589-41544611 CTGTTAAATCAAATTAAATATGG + Intergenic
1054214450 9:62331741-62331763 CTGTTAAATCAAATTAAATATGG + Intergenic
1054365403 9:64333898-64333920 CTGTTAAATCAAATTAAATATGG - Intergenic
1054812088 9:69443006-69443028 CCTGTAACTCAGATACAAAAGGG - Intronic
1054909442 9:70440726-70440748 CTGTTAACTAAAATAAAAAAGGG + Intergenic
1055105518 9:72508069-72508091 CTTTAAGTTAAGATTAAAAAAGG - Intergenic
1055203791 9:73701434-73701456 CTTTTAACACAGTTCCAAAATGG - Intergenic
1055278760 9:74649882-74649904 GTTTCAACTCAAAATAAAAACGG - Intronic
1055837446 9:80460407-80460429 TTTTAAAATCTGATTAAAAATGG + Intergenic
1056063840 9:82912906-82912928 ATTTTAACTGAAATTAAAACTGG - Intergenic
1056079598 9:83077968-83077990 CCTTTATCTCAGAGTCAAAAAGG + Intergenic
1056407445 9:86288343-86288365 CTTTCAAAGCACATTAAAAATGG - Exonic
1056955805 9:91080157-91080179 GTAATAACTCAGATTAGAAATGG + Intergenic
1058544646 9:106047916-106047938 CAGTTAACTGAGATTAAAACAGG - Intergenic
1059014123 9:110495519-110495541 CTTTTAAATCTGATTTGAAAAGG - Intronic
1186718457 X:12277899-12277921 CTTTTGACTAAGGTTTAAAAGGG + Intronic
1187129268 X:16486035-16486057 CTAATAACTCAATTTAAAAATGG + Intergenic
1187550463 X:20297870-20297892 TTTTTAACTCAATATAAAAATGG + Intergenic
1187856484 X:23641433-23641455 CAAATAACTCAGTTTAAAAATGG + Intergenic
1189027989 X:37418540-37418562 CTTTTAAATCATGTTTAAAAAGG - Intronic
1190112381 X:47601128-47601150 CTTTAGACTAAGAATAAAAAAGG + Intronic
1190270124 X:48856488-48856510 TCTTTAACACAGATTATAAAAGG + Intergenic
1192280914 X:69684039-69684061 CTAAGAACTCAGATGAAAAAAGG + Intronic
1193031746 X:76906443-76906465 CTATGTACCCAGATTAAAAATGG - Intergenic
1194595014 X:95847213-95847235 GTTTTTACTTTGATTAAAAAAGG - Intergenic
1194919781 X:99750700-99750722 CTTTGAACTTATATTTAAAAGGG + Intergenic
1195461310 X:105128540-105128562 CATATAACTCATATTAAAAAAGG + Intronic
1196017242 X:110953140-110953162 TTTTTAACTCTGATTAGAACTGG + Intronic
1197183195 X:123559435-123559457 TATTTAACTCAGATAAACAAAGG + Intergenic
1200376858 X:155791176-155791198 TTTTTAAATCAGAGTAAAACTGG - Intergenic
1200933043 Y:8714489-8714511 CTTTTAACACAGATTAAAGGAGG + Intergenic