ID: 1149697676

View in Genome Browser
Species Human (GRCh38)
Location 17:58629215-58629237
Sequence CTGTGGGAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149697670_1149697676 -8 Left 1149697670 17:58629200-58629222 CCTGTAATCCCAGCACTGTGGGA 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
Right 1149697676 17:58629215-58629237 CTGTGGGAGGCCAAGGTGGATGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
1149697667_1149697676 11 Left 1149697667 17:58629181-58629203 CCAAGTACAGTGGCTCACACCTG 0: 32
1: 1216
2: 15280
3: 51286
4: 109533
Right 1149697676 17:58629215-58629237 CTGTGGGAGGCCAAGGTGGATGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149697676 Original CRISPR CTGTGGGAGGCCAAGGTGGA TGG Intronic
Too many off-targets to display for this crispr