ID: 1149705569

View in Genome Browser
Species Human (GRCh38)
Location 17:58691788-58691810
Sequence CCCGAAGTTCTGTAATTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149705564_1149705569 1 Left 1149705564 17:58691764-58691786 CCTTCTAAACTGCTTGCCTTCCT 0: 1
1: 0
2: 3
3: 24
4: 346
Right 1149705569 17:58691788-58691810 CCCGAAGTTCTGTAATTTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 165
1149705563_1149705569 4 Left 1149705563 17:58691761-58691783 CCACCTTCTAAACTGCTTGCCTT 0: 1
1: 0
2: 1
3: 27
4: 272
Right 1149705569 17:58691788-58691810 CCCGAAGTTCTGTAATTTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 165
1149705562_1149705569 29 Left 1149705562 17:58691736-58691758 CCTAGGCAAGGAAGGAACTCATA 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1149705569 17:58691788-58691810 CCCGAAGTTCTGTAATTTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149705569 Original CRISPR CCCGAAGTTCTGTAATTTAG AGG Intronic
910352564 1:86315486-86315508 CCCGAAGTTCTGGGATTTACAGG - Intergenic
915553723 1:156649660-156649682 CCCGAAGTGCTGGGATTTATAGG + Intronic
917719504 1:177773572-177773594 CCACAAGTTCTGGAATTTTGGGG - Intergenic
917761185 1:178160373-178160395 CCCGAAGTTCTGGAATTACAGGG - Intronic
918754978 1:188328770-188328792 ATTGAAGTTCTGTACTTTAGGGG + Intergenic
919253168 1:195085579-195085601 CAGGAAGTTGTGTAACTTAGAGG - Intergenic
924696051 1:246401235-246401257 CCCAAAGTGCTGAGATTTAGAGG - Intronic
1063196966 10:3752717-3752739 CCCAAAGTTCTGAGATTTATAGG + Intergenic
1063672307 10:8109181-8109203 TCCGAAGTGCTGGAATTTACAGG + Intergenic
1063762119 10:9091401-9091423 TCAGAAGTTCTTTGATTTAGAGG - Intergenic
1064048405 10:12039877-12039899 CCCAAAGTTCTGGGATTTACAGG + Intronic
1065977591 10:30856587-30856609 CTGTAAGATCTGTAATTTAGTGG - Intronic
1066311942 10:34205910-34205932 CATGAAGTGCTGTAGTTTAGTGG - Intronic
1071664730 10:87543393-87543415 CCCAAAGTTCTGGAATTAACAGG - Intronic
1071780189 10:88835949-88835971 CCTTAAGCTCTGTAATTTGGGGG + Intronic
1072073259 10:91942013-91942035 CCCAAAGTGCTGGAATTTACAGG - Intronic
1072592058 10:96835156-96835178 CCCAAAGTGCTGAAATTTACAGG + Intronic
1076400409 10:130180300-130180322 CCCAAAGTGCTGGAATTTACAGG + Exonic
1077067956 11:652822-652844 CCCAAAGTGCTGGGATTTAGAGG - Intronic
1077944950 11:6887056-6887078 CCCAAAGTGCTGGGATTTAGAGG - Intergenic
1078775256 11:14388078-14388100 CCCAAAGTTCTGGGATTTACAGG + Intergenic
1082816138 11:57510731-57510753 CCCAAAGTGCTGGAATTTACAGG - Intronic
1082929709 11:58589321-58589343 CCCAAAGTGCTGGAATTTATAGG + Intronic
1085732534 11:79011738-79011760 CCTGAAATAATGTAATTTAGAGG + Intronic
1086783485 11:90935950-90935972 CCCGAAGTGCTGGGATTTACAGG + Intergenic
1087581123 11:100055242-100055264 CCTGAAGTTCTTTCATTTTGGGG - Intronic
1090764306 11:129863563-129863585 CCCAAAGTGCTGGGATTTAGAGG + Intergenic
1093518183 12:20015917-20015939 CCCAAAGTGCTGGGATTTAGAGG + Intergenic
1095299245 12:40562906-40562928 CCCAAAGTGCTGCAATTTACAGG + Intronic
1098943670 12:76565934-76565956 CCCAAAGTGCTGTGATTTACAGG - Intergenic
1099595238 12:84654770-84654792 CCCAAAGTGCTGGGATTTAGAGG - Intergenic
1099751800 12:86783650-86783672 CCTGAAGTTTTGTATTTTGGAGG + Intronic
1102103647 12:110301124-110301146 CCCAAAGTTCTGGGATTTACAGG + Intronic
1102258973 12:111431863-111431885 CCCAAAGTTCTGGGATTTACAGG + Intronic
1102872751 12:116426825-116426847 CCCAAAGTGCTGGGATTTAGAGG - Intergenic
1108042192 13:46349556-46349578 CCCAAAGTTCTGTAAGTTTTAGG - Intronic
1108486457 13:50931290-50931312 CCAGAAGTTCTGTAATATTTTGG + Intronic
1109177833 13:59177388-59177410 CCCGAAGTGCTGGGATTAAGGGG - Intergenic
1111598863 13:90446437-90446459 CCTGCATTTGTGTAATTTAGTGG - Intergenic
1111684752 13:91488215-91488237 ACTGATGTTCTGTATTTTAGGGG + Intronic
1112085598 13:96028884-96028906 CCCAAAGTTCTGGGATTTACAGG - Intronic
1114296858 14:21337699-21337721 CCCAAAGTGCTGGAATTTACAGG + Intronic
1114620435 14:24093418-24093440 CCCAAAGTGCTGGAATTTACAGG - Intronic
1116832985 14:49740833-49740855 CCCAAAGTGCTGGGATTTAGAGG - Intronic
1118283982 14:64454370-64454392 CCCAAAGTGCTGGAATTTATAGG + Intronic
1119341569 14:73883451-73883473 CCCAAAGTGCTGGAATTTACAGG + Intronic
1120338106 14:83184988-83185010 CCCAAAGTTCTGGGATTTACAGG - Intergenic
1121226930 14:92328029-92328051 CACGAAGTTCAGAAGTTTAGTGG + Intronic
1122604445 14:102938885-102938907 CCCAAAGTGCTGGAATTAAGAGG + Intronic
1126597680 15:50398262-50398284 CCCGAAGTGCTGGGATTTATAGG - Intergenic
1128622627 15:69162842-69162864 CCCAAAGTACTGGGATTTAGAGG + Intronic
1130840427 15:87694737-87694759 TCCTAATTTCTGTAATTTGGTGG - Intergenic
1131216207 15:90537641-90537663 CCCAAAGTTCTGGGATTTACAGG + Intronic
1133407635 16:5538141-5538163 CTAGAAGGTCTGTAATCTAGGGG + Intergenic
1135022482 16:18974346-18974368 CCCAAAGTGCTGGAATTTACAGG + Intergenic
1135523149 16:23192807-23192829 CCCAAAGTGCTGGGATTTAGAGG - Intronic
1138323292 16:56138060-56138082 CCCAAAGTGCTGTGATTTAAAGG - Intergenic
1138803396 16:60062624-60062646 CCCAAAGTGCTGCAATTTACAGG + Intergenic
1138916475 16:61471129-61471151 CCCTAAGGACTGTAACTTAGAGG + Intergenic
1139811794 16:69625159-69625181 CCCGGAGTGCTGGAATTTACAGG + Intronic
1140089410 16:71825388-71825410 CCCAAAGTTCTGGGATTTACAGG - Intergenic
1140810955 16:78577386-78577408 GCCGCAGTGCTGGAATTTAGGGG - Intronic
1142302358 16:89266093-89266115 ACCAAAGTTCTGTGATTGAGGGG + Intergenic
1142772487 17:2108679-2108701 CCCAAAGTTCTGGAATTAAAGGG - Intronic
1143048584 17:4103281-4103303 CCCAAAGTGCTGGAATTTACAGG - Intronic
1143646038 17:8230875-8230897 CCCAAAGTGCTGGGATTTAGGGG - Intronic
1143729806 17:8874701-8874723 CCAGTAGTTCTTTAATTTACGGG + Intergenic
1147865645 17:43550257-43550279 CCAGAAGCCCTGTAATTTAGAGG - Intronic
1148175270 17:45558460-45558482 CCTGAAGTTCTGTGCTTTAGAGG - Intergenic
1148296101 17:46504534-46504556 CCTGAAGTTCTGTGCTTTAGAGG + Intergenic
1148951085 17:51313271-51313293 CCCGAAGTGCTGGCATTTAGAGG - Intergenic
1149705569 17:58691788-58691810 CCCGAAGTTCTGTAATTTAGAGG + Intronic
1150406487 17:64905404-64905426 GCTGAAGTTCTGTGCTTTAGAGG - Intronic
1150785356 17:68158415-68158437 CCTGAAGTTCTGTGCTTTAGAGG - Intergenic
1150845286 17:68650980-68651002 CCCAAAGTGCTGGAATTTACAGG - Intergenic
1155001355 18:21690340-21690362 CCCGAAGTGCTGTAATTACAGGG - Intronic
1157991053 18:52496992-52497014 CCCAAAGTGCTGTGATTTACAGG - Intronic
1161882537 19:6966412-6966434 CCTGAAGTTCTGTGTGTTAGGGG + Intergenic
1162639642 19:11998074-11998096 CCCAAAGTGCTGGAATTTACAGG + Intergenic
1165346635 19:35252751-35252773 CCCAAAGTGCTGAAATTTACAGG - Intronic
1166933085 19:46313361-46313383 CCCAAAGTTCTGGGATTTACAGG - Intronic
1167891696 19:52545039-52545061 CCCAAAGTTCTGGGATTTACAGG + Intronic
1168521119 19:57051289-57051311 CCAGAAGTTCTGGAAGGTAGAGG - Intergenic
934098491 2:88628779-88628801 CCCAAAGTGCTGCAATTTACGGG + Intergenic
935468163 2:103424500-103424522 CTAGAAGTTCTGCAAGTTAGTGG + Intergenic
941134181 2:161693145-161693167 AAAGAAGTTTTGTAATTTAGGGG - Intronic
944709160 2:202320212-202320234 CCCAAAGTGCTGCAATTTACAGG + Intergenic
944776067 2:202966450-202966472 CCCAAAGGGCTGTGATTTAGAGG - Intronic
945545574 2:211146613-211146635 CCCAAATTTGTGGAATTTAGAGG - Intergenic
947646433 2:231745002-231745024 CTCTAAGTTCTGTAATTTTAGGG + Intronic
947779642 2:232746635-232746657 CCCCAAGTTCTGTTCTTTAGAGG + Intronic
948407128 2:237730657-237730679 CCCGAAGTGCTGGGATTTATAGG - Intronic
1169126646 20:3132860-3132882 CCCAAAGTGCTGGAATTTATAGG - Intronic
1170183312 20:13557828-13557850 CCCAAAGTACTGTGATTTACAGG + Intronic
1170641861 20:18161312-18161334 CCCAAAGTTCTGGGATTAAGAGG + Intronic
1173095818 20:40027259-40027281 CCCTAAGGTCTGTCATTTGGAGG - Intergenic
1175382422 20:58572856-58572878 CCCAAAGTGCTGGAATTTAGAGG + Intergenic
1175556638 20:59865024-59865046 CCAGAAAGTCTGTAGTTTAGTGG - Intronic
1177076067 21:16575272-16575294 CCCAAAGTGCTGTGATTTACAGG - Intergenic
1181318421 22:21986173-21986195 CCCAAAGTTCTGGGATTTATGGG + Intergenic
1183085544 22:35484692-35484714 CCCAAAGTTCTGGGATTTACAGG + Intergenic
951734461 3:25849068-25849090 CCCAAACCTCTGTGATTTAGCGG - Intergenic
952100420 3:30005581-30005603 CCAGAGGTGTTGTAATTTAGAGG - Intronic
952262865 3:31757338-31757360 CCCAAAGTGCTGGAATTTACAGG - Intronic
954229013 3:49201655-49201677 CCCAAAGTGCTGTGATTTACAGG - Intronic
956115976 3:65919301-65919323 CCCAAAGTGCTGGAATTTACAGG - Intronic
964731346 3:159869222-159869244 CCAGAAGTTCTGAATTTTATAGG + Intronic
965414889 3:168380745-168380767 CCCAAAGTGCTGGGATTTAGAGG + Intergenic
966608532 3:181845673-181845695 CCTGAAGTGCTGTGATTTATAGG + Intergenic
967403740 3:189093712-189093734 CCCGAAATATTGGAATTTAGTGG - Intronic
967491389 3:190095543-190095565 CATGAAGATATGTAATTTAGAGG + Intronic
967718719 3:192792327-192792349 ACAGTATTTCTGTAATTTAGAGG - Intergenic
971716208 4:30180100-30180122 CCCTAAGTTATGTAATATTGAGG + Intergenic
972440225 4:39081538-39081560 CCCGAAGTGCTGGGATTTACAGG - Intronic
973315501 4:48755972-48755994 CCCAAAGTTCTGGGATTTGGTGG - Intronic
974051226 4:56944065-56944087 CCCAAAGTTCTGTTTTTGAGGGG - Intergenic
976787310 4:88836698-88836720 CCCAAAGTTCTGGGATTTACAGG - Intronic
977441886 4:97078015-97078037 CCCCAAGTTCTGTAAGTTTAGGG - Intergenic
978808230 4:112822484-112822506 CCCAAAGTGCTGGAATTTACAGG - Intronic
981334377 4:143553218-143553240 CCAGTAGTTCTTTAATTTACGGG + Exonic
984736513 4:183113654-183113676 CCCAAAGTGCTGAAATTTACAGG + Intronic
986705861 5:10454380-10454402 CCCAAAGTTCTGAGATTTATAGG + Intronic
986718698 5:10542999-10543021 CCCAAAGTGCTGGAATTTACAGG + Intergenic
990168297 5:53018802-53018824 CCCAAAGTGCTGGAATTTACAGG - Intronic
990478698 5:56186411-56186433 CCCAAAGTGCTGTGATTTATAGG + Intronic
991378110 5:65987591-65987613 CCCGAAGTTCTGGGATTAACAGG - Intronic
991715961 5:69451196-69451218 CCCAAAGTGCTGTGATTTATAGG + Intergenic
994079637 5:95693899-95693921 CCCAAAGTTCTGGAATTTACAGG - Intronic
996063334 5:119055396-119055418 CCCAAAGTGCTGGAATTTACAGG + Intronic
997501273 5:134376072-134376094 CCCAAAGTGCTGGGATTTAGAGG - Intronic
999686047 5:154104167-154104189 CCAGAAGTTCAGGTATTTAGAGG - Intronic
1000797330 5:165681210-165681232 CCCAAAGTTCTGGGATTTACAGG - Intergenic
1000965141 5:167647361-167647383 CCCAAAGTTCTGGGATTTACAGG - Intronic
1001732756 5:173972580-173972602 CCCAGAGTGCTGGAATTTAGAGG + Intergenic
1002146782 5:177190214-177190236 CCCAAAGTGCTGGAATTTATAGG + Intronic
1002616583 5:180459990-180460012 CCCAAAGTGCTGGAATTTACAGG - Intergenic
1004904338 6:20222433-20222455 CCCAAAGTTCTGTAATTACAAGG + Intergenic
1005121631 6:22396414-22396436 CCTGAAGTTTTGTAATTTTGGGG + Intergenic
1007680582 6:43630479-43630501 CCCAAAGTGCTGTGATTTACAGG - Intronic
1008513987 6:52302370-52302392 CCTGAAGTGCTGGAATTTACGGG - Intergenic
1010842854 6:80668974-80668996 CCCCAAGTGCTGGAATTTACAGG + Intergenic
1012238944 6:96850774-96850796 CCCAAAGTGCTGGGATTTAGAGG - Intergenic
1016500187 6:144712042-144712064 CCTGAAATTCTGTAATTTTGAGG + Intronic
1017214224 6:151891397-151891419 CCCAAAGTTCTGCATTTTATAGG - Intronic
1017643772 6:156519376-156519398 CCCAAAGTTCTGGGATTTACAGG - Intergenic
1017858082 6:158369232-158369254 CCCAAAGTTCTGGAATTTCTAGG - Intronic
1019807827 7:3141513-3141535 CCCGAAGTGCTGGGATTTACAGG + Intronic
1021684196 7:23166117-23166139 GCTAAAGTTCTGTAATTTAATGG - Intronic
1023294163 7:38697974-38697996 CCCAAAGTGCTGGGATTTAGAGG + Intergenic
1023531582 7:41162262-41162284 GCCTAAGTTCTGTTATTTTGAGG + Intergenic
1024316525 7:48024170-48024192 CACGAAGGTTTGTAATTTTGAGG - Intronic
1026931637 7:74226035-74226057 CCCGAAGTGCTGGGATTTATAGG - Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1031448573 7:121885483-121885505 CCAGATGTGCTGTAATTTAAAGG - Intronic
1037318519 8:17622206-17622228 CTCTAAGTTCTGAAGTTTAGGGG + Intronic
1041400139 8:57433988-57434010 CCCAAAGTTCTGGGATTTACAGG + Intergenic
1046651210 8:116838495-116838517 CCCAAAGTGCTGTGATTTACAGG + Intronic
1048685486 8:136900323-136900345 CCCAAAGTGCTGTGATTTACAGG + Intergenic
1049900360 9:156238-156260 ACAGGAGTTCTGTAATTTTGAGG - Intronic
1050810906 9:9746486-9746508 TCTGAACTTCTGTAATTGAGAGG + Intronic
1052919335 9:33951274-33951296 CCCAAAGTTCTGGGATTTACAGG + Intronic
1053743406 9:41166541-41166563 ACAGGAGTTCTGTAATTTTGAGG - Intronic
1054348680 9:63996342-63996364 ACAGGAGTTCTGTAATTTTGAGG - Intergenic
1054446411 9:65322726-65322748 ACAGGAGTTCTGTAATTTTGAGG - Intergenic
1054483864 9:65698782-65698804 ACAGGAGTTCTGTAATTTTGAGG + Intronic
1054684938 9:68264735-68264757 ACAGGAGTTCTGTAATTTTGAGG + Intronic
1055143237 9:72900352-72900374 TCTGAAGATCTTTAATTTAGTGG - Intergenic
1055417227 9:76096858-76096880 CCCAAAGTTCTGGGATTTACAGG + Intronic
1059192176 9:112336520-112336542 CCCAAAGTGCTGTGATTTACAGG - Intergenic
1061762978 9:132863215-132863237 CCCCATGTTCTGTACCTTAGAGG - Intronic
1187350797 X:18515056-18515078 CCCGAAGTGCTGGGATTTACAGG + Intronic
1188126121 X:26371687-26371709 CCAAAACTTTTGTAATTTAGAGG - Intergenic
1189734998 X:44060874-44060896 CCCAAAGTTCTGGGATTTACAGG + Intergenic
1190854469 X:54280037-54280059 CCCGAAGTGCTGGGATTTACAGG - Intronic
1191706842 X:64102827-64102849 CCCCAATTTCTTTAATATAGTGG + Intergenic
1192752779 X:74011102-74011124 CCCAAAGTGCTGGAATTAAGAGG + Intergenic
1197201221 X:123750503-123750525 CCCAAAGTTCTGAGATTTACAGG + Intergenic
1199454035 X:148007547-148007569 CCCAAAGTGCTGGAATTTATAGG + Intronic