ID: 1149716730

View in Genome Browser
Species Human (GRCh38)
Location 17:58798149-58798171
Sequence ACTGATATTCAGAATGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 386}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149716730 Original CRISPR ACTGATATTCAGAATGTGTT AGG (reversed) Intronic
902223022 1:14978817-14978839 GCTGCTATTCAGAGTCTGTTAGG + Intronic
903935786 1:26894011-26894033 AGGGTTATTCAGAATTTGTTGGG + Intronic
904856649 1:33502909-33502931 ACTAATATTCTGCATGTCTTGGG + Intergenic
907952915 1:59201215-59201237 ACTGATATTCATTGTGTGTATGG - Intergenic
908677744 1:66624693-66624715 ACTGATATTTCAAATTTGTTTGG - Intronic
908771714 1:67603231-67603253 ACTAATATTCAGAATCTCTAAGG + Intergenic
908890390 1:68840315-68840337 ACTAATATTCAGAATCTATAAGG - Intergenic
911507840 1:98775612-98775634 AATGTTATTCAGAATGTTTTTGG + Intergenic
911804427 1:102187488-102187510 ACTGATATTCAGATGGAGATTGG - Intergenic
911925504 1:103825751-103825773 ACTAATATTCAGAATATATAAGG + Intergenic
912301718 1:108524626-108524648 ACTGATATCCAGAATCTATAAGG - Intergenic
913345050 1:117800519-117800541 GCTGATATTGAAAATGTTTTGGG - Intergenic
913373475 1:118126563-118126585 ACTAATATTCAGAATATATAAGG - Intronic
916005977 1:160660643-160660665 ACTAATATCCAGAATCTGTAAGG - Intergenic
918625192 1:186649434-186649456 ATTGATTTTCAGAGTGTGATGGG + Intergenic
920042365 1:203109785-203109807 ACTGATATCCAGAATCTATAAGG + Intronic
921003596 1:211069577-211069599 ATTGATATAAAGAATGTCTTTGG + Intronic
922813197 1:228429747-228429769 ACTGATTTACAGAATGCGTGTGG - Intergenic
922888498 1:229040628-229040650 ACTCATATCCAGAATCTGTAAGG + Intergenic
923737661 1:236626601-236626623 ACTGATATGCAGAATATTTAAGG + Intergenic
924071525 1:240285207-240285229 AGTCATATTCTGGATGTGTTTGG + Intronic
924222209 1:241889278-241889300 AGTGAGACTCAGAATGTATTGGG + Intronic
1062790274 10:299753-299775 GCTAATATCCAGAATGTGTAAGG + Intronic
1063311319 10:4955350-4955372 ACTGATATCCAGAATTTATAAGG - Intronic
1063656827 10:7998914-7998936 AATAATATTCATTATGTGTTTGG + Intronic
1063837221 10:10029517-10029539 ACTAATATCCAGAATGTGCAAGG + Intergenic
1064857604 10:19787828-19787850 ACTGCTATTTAAAATGTATTAGG - Intronic
1065432149 10:25670310-25670332 ACTGATATTCAGTTTGTTATTGG - Intergenic
1065690231 10:28325348-28325370 ACTGATATTAAGAACATTTTTGG + Intronic
1066566705 10:36728899-36728921 ACTGGTATGAAGAACGTGTTTGG - Intergenic
1067513194 10:46912123-46912145 ACTTATGTTTTGAATGTGTTAGG + Intronic
1067649059 10:48139719-48139741 ACTTATGTTTTGAATGTGTTAGG - Intergenic
1068909738 10:62366787-62366809 ACTGATGTTCAGAAGGTTTTCGG - Intergenic
1069223772 10:65915520-65915542 ATTGATATTCAATATGAGTTTGG - Exonic
1069406608 10:68107308-68107330 ACTGCCATTCAGAATGTCTTTGG + Intronic
1070618510 10:77988071-77988093 ACTGACAGCCAGGATGTGTTGGG - Intronic
1071000966 10:80830053-80830075 ACAGAAATTCATAATGTGTGGGG + Intergenic
1071202490 10:83235420-83235442 TCTGATGTTCTGAAAGTGTTTGG + Intergenic
1071248192 10:83787608-83787630 ACTAATATTCAGAATCTATGAGG - Intergenic
1073744995 10:106457969-106457991 ACTAATATTCAGAATCTGTAAGG - Intergenic
1073827711 10:107344464-107344486 ACTGATATCCAGAATGTATAAGG - Intergenic
1073961878 10:108941066-108941088 ACTAATTTTGAGAATTTGTTCGG + Intergenic
1074331291 10:112512429-112512451 ACTAATATTCAGAATATATAAGG - Intronic
1074943948 10:118262859-118262881 ATAGATATTCACAATGTGATAGG - Intergenic
1076211470 10:128649672-128649694 ACTAATATCCAGAATCTGTAAGG + Intergenic
1077759806 11:5081521-5081543 ACTAATATCCAGAATATGTAAGG + Intergenic
1078137908 11:8667465-8667487 ATTGGTATCCAGAATGTGTAAGG + Intronic
1078517719 11:12038582-12038604 TCTAATATTCAGAATCTATTAGG + Intergenic
1078918280 11:15801511-15801533 ACAGATATTCAGAGTGTTTAGGG + Intergenic
1079225325 11:18600107-18600129 ACTGGAAGTCAGAATGTGATGGG + Intergenic
1079623211 11:22581152-22581174 AATGATATTCAAAATGCTTTTGG + Intergenic
1079950242 11:26793012-26793034 ACTGAAATTCTGTATGTGTAAGG + Intergenic
1080371987 11:31659564-31659586 AATGATATTTGGAATGTATTTGG + Intronic
1081835803 11:46152840-46152862 TCTAATATTCAGAATCTGTAAGG - Intergenic
1083510107 11:63201770-63201792 TCTGATATTCAGAATCTATAAGG + Intronic
1083575132 11:63784946-63784968 ACAGAAATGAAGAATGTGTTTGG + Intergenic
1085091305 11:73716774-73716796 ACAGATTTTCTGGATGTGTTGGG - Intronic
1085875539 11:80402854-80402876 GCTGATACTCACCATGTGTTAGG + Intergenic
1087298234 11:96402231-96402253 GCTGATGTCCAGAATGTCTTAGG - Intronic
1087692987 11:101343516-101343538 ACTAATATTCAGAATCTATAAGG - Intergenic
1087912136 11:103766509-103766531 TCTGATATCCAGAATCTGTAAGG - Intergenic
1089089603 11:115859587-115859609 ACTAATATTCTGAATATATTAGG + Intergenic
1093163290 12:15775019-15775041 AATGATACTCACAATGGGTTTGG - Intronic
1093374082 12:18402796-18402818 ACAGATCTTCAAAATCTGTTTGG + Intronic
1093902829 12:24655279-24655301 ACTAATAATCAGAATGTATAAGG - Intergenic
1094056499 12:26274150-26274172 AAGGATGTTCAGAATTTGTTTGG + Intronic
1094417645 12:30234370-30234392 ACTGCTCTTCAGAATGGGTGTGG + Intergenic
1094537446 12:31334666-31334688 ACTGATATTAAGAAAGTATTGGG - Intergenic
1095842717 12:46711730-46711752 ACTAATATTCAGAATTTATAAGG + Intergenic
1096920283 12:55077201-55077223 ACTGATATCTAGCATGTGCTAGG - Intergenic
1097179388 12:57162660-57162682 ACAGAGAATCAGATTGTGTTGGG - Intronic
1097531532 12:60807507-60807529 ACTAATATTCAGAATCTATAAGG - Intergenic
1098058006 12:66528904-66528926 ACTAATATCCAGAATCTGTAGGG + Intronic
1099458200 12:82890531-82890553 ACTGATATTAAAAATGTTGTTGG - Intronic
1099962380 12:89408999-89409021 GCTAATATTCAGAATCTGTAAGG - Intergenic
1100574614 12:95878658-95878680 GCTGATAATCAGAATATGTGGGG + Intronic
1102162408 12:110780320-110780342 CCTGAGAGTCAGAATGTGTTAGG + Intergenic
1102697310 12:114809917-114809939 AGTGATATTCAGGAGGTCTTTGG - Intergenic
1102874578 12:116439810-116439832 TCTGTTATTCAGAATGCTTTAGG + Intergenic
1105002557 12:132700556-132700578 ACTGTTATCCAGAATCTGTGAGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105664789 13:22541820-22541842 ACTGCTATTCAGAATTTTTTTGG - Intergenic
1107183296 13:37487144-37487166 GCTGATATTCATATAGTGTTCGG + Intergenic
1107283030 13:38757941-38757963 CCTCATTTTCAGAATGTGTTAGG + Intronic
1107725752 13:43297531-43297553 CCTGATATTCTTAAGGTGTTTGG - Intronic
1108139775 13:47408164-47408186 ATTGATATTCAAAATGTCTGTGG + Intergenic
1108434384 13:50387311-50387333 GCTGATATTTAGATTGTGGTGGG + Intronic
1109005254 13:56866870-56866892 ACTGATATTTTGATAGTGTTTGG - Intergenic
1109510494 13:63366044-63366066 ACTGTGATTCAAAATGTGTGAGG + Intergenic
1109652366 13:65346017-65346039 ACTAATATCCAGAATCTGTAAGG + Intergenic
1109775914 13:67040699-67040721 ATTGAAATACAGAATGTGGTGGG + Intronic
1110129391 13:71988449-71988471 ACCTATATTCAGACTGTGGTTGG - Intergenic
1110245187 13:73315512-73315534 ATTGATATCCAGAATATGTAAGG + Intergenic
1110461793 13:75753287-75753309 ACTGATATCCAGAATTTATAAGG - Intronic
1111975290 13:94960927-94960949 CCTGATTTTCAAAATGTGGTAGG + Intergenic
1114754996 14:25248913-25248935 ATTGTGATTCAGAATGTTTTAGG + Intergenic
1115887492 14:37989458-37989480 AGAGATATTCAGAATGAGATGGG - Intronic
1116021498 14:39468039-39468061 ACAGGTATTCAGAATGACTTGGG + Intergenic
1116280070 14:42895324-42895346 ACTAATATCCAGAATCTATTAGG - Intergenic
1116749325 14:48863168-48863190 CCTAATATCCAGAATCTGTTAGG + Intergenic
1117266164 14:54089247-54089269 ACTGACTTTCAGAATTTGTTAGG + Intergenic
1118106887 14:62669885-62669907 TCTGATATGCAGAATGGATTGGG + Intergenic
1118290987 14:64522826-64522848 ACAGATATTTTCAATGTGTTTGG - Exonic
1118718826 14:68579609-68579631 TCTGAAATCCAGATTGTGTTGGG + Intronic
1120084513 14:80254942-80254964 ACTGATATGGAGAAAGTTTTAGG + Intronic
1121652799 14:95572201-95572223 ACTGAAAGTCAGGATGTCTTAGG + Intergenic
1121963934 14:98287253-98287275 ACAGATATTCAGTGTGTGTAAGG + Intergenic
1123702198 15:22923226-22923248 ACTGATATTTAGAATGTATAAGG + Intronic
1123883825 15:24702776-24702798 TCTAATATTCAGAATGTATAAGG - Intergenic
1124478011 15:30052496-30052518 ACTAATATTCAGAATGTACAAGG - Intergenic
1124812717 15:32957235-32957257 GCTGATTTTCAGAATGTCGTTGG + Intronic
1125228666 15:37426972-37426994 GCATATATTTAGAATGTGTTTGG + Intergenic
1125247854 15:37661961-37661983 ACTAATATTCAGAATCTATAAGG - Intergenic
1125414501 15:39438377-39438399 ACTAAAATTCAGACTGTGTCTGG + Intergenic
1126209754 15:46087711-46087733 AATGAGAATCAGAATGTCTTTGG - Intergenic
1128602336 15:69007802-69007824 GCAGATAATCAGAATGAGTTAGG - Intronic
1129620663 15:77142100-77142122 ACTTATATTCAGAATATATAAGG + Intronic
1130308203 15:82729627-82729649 ACTCATATTTAGAATGTTTGGGG + Intergenic
1131858046 15:96620009-96620031 ACTGATATTCAGGCTGTGCTTGG + Intergenic
1132138179 15:99365057-99365079 ACAGGTATTCAGAATTTGATTGG - Intronic
1136171900 16:28494887-28494909 ACTGAAATTCAGAAAATATTAGG - Intronic
1137482061 16:48860359-48860381 ACTAATATTCAGAATTTATAAGG + Intergenic
1138315626 16:56067353-56067375 ACTGCTATTGGGAATGTGATAGG + Intergenic
1139075854 16:63446709-63446731 ATGTATATTCAGCATGTGTTGGG - Intergenic
1140074719 16:71687289-71687311 ACTTGTATTCAGAATATGTAAGG - Intronic
1140164177 16:72531702-72531724 ACATATGTTCAGAATGGGTTGGG - Intergenic
1140681426 16:77388851-77388873 ACACTTATTCAGAATCTGTTAGG - Intronic
1141215060 16:82016004-82016026 AATGATAGTCAGCATGTATTGGG + Intergenic
1143076341 17:4347210-4347232 TCTGAAATCCAGAATGTTTTTGG - Intronic
1146754454 17:35415622-35415644 ACTGATATCCAGAATCTATGAGG + Intronic
1148345360 17:46899790-46899812 ACTGTTATTTAGAATATGCTAGG + Intergenic
1149716730 17:58798149-58798171 ACTGATATTCAGAATGTGTTAGG - Intronic
1150023500 17:61646014-61646036 ACTGATCTCCAGAATGTCTTTGG - Intergenic
1150203610 17:63382708-63382730 ACTCCTATTCTAAATGTGTTGGG + Intronic
1150936164 17:69638020-69638042 AGTGATGTTCAGATTCTGTTGGG - Intergenic
1150948340 17:69773061-69773083 TCTGATATTCAAAATCTGTAAGG + Intergenic
1152182010 17:78828388-78828410 CCTGATATTCAGAATGGAATTGG + Intronic
1152629297 17:81402791-81402813 ACTGACATTCTGAAAGTGTTGGG - Intronic
1153403297 18:4705448-4705470 ACGGCTATTCAAAATGTCTTTGG - Intergenic
1153588891 18:6652412-6652434 AGTGGAATTCAGAAAGTGTTAGG + Intergenic
1154378569 18:13829218-13829240 TCTGATATCCAGAATGGTTTTGG + Intergenic
1155776998 18:29777266-29777288 ACTGATATCCAGAATCTATAAGG - Intergenic
1155899296 18:31368261-31368283 TCTAATATTCAGAATCTGTAAGG + Intergenic
1158026381 18:52902321-52902343 ACTGATATTTTGACTATGTTTGG + Intronic
1158539180 18:58337188-58337210 ACTGAGTTTCAGCATGGGTTGGG + Intronic
1159081483 18:63740480-63740502 TCTGAGATTCAGACTGTGGTGGG + Intergenic
1159216259 18:65394422-65394444 ACTGAAATTAAGACTGTTTTGGG + Intergenic
1159345869 18:67202046-67202068 ACTGGTATTTAGACTGTTTTTGG - Intergenic
1160444261 18:78914857-78914879 ACTCTTAAGCAGAATGTGTTGGG - Intergenic
1161760656 19:6168751-6168773 ACTAATATTCAGAATCTATAAGG - Intronic
1163242515 19:16072937-16072959 TCTGGCATTTAGAATGTGTTGGG - Intronic
1164512497 19:28909064-28909086 GCTGGTATTCAGCATGTATTTGG - Intergenic
1165537363 19:36460143-36460165 AATAATATTCAGAATGCCTTAGG + Intronic
1167204950 19:48095164-48095186 AAGCAGATTCAGAATGTGTTTGG - Intronic
1167223738 19:48221990-48222012 ACTGATATAAAGATTGTGATAGG + Intronic
1168453234 19:56482725-56482747 ATTAATATTCAGAATATGTAAGG - Intergenic
924970753 2:125707-125729 ACTGAGATTTATTATGTGTTGGG + Intergenic
925264310 2:2554494-2554516 ACTAATATTCAGCATCTGTAAGG + Intergenic
925535846 2:4915707-4915729 ACTGATTTTCAGCATATATTAGG - Intergenic
926898384 2:17721085-17721107 TGTGATATGCAGAATGTATTTGG - Intronic
927336212 2:21927774-21927796 ACTCATATTCAGAATCACTTGGG + Intergenic
927355732 2:22170946-22170968 ACTAATATTCAGAATCTATAAGG + Intergenic
927926177 2:27015240-27015262 CCTGACATTCAGTATGTATTTGG - Intronic
928882313 2:36111083-36111105 ACTGATATCCAGAATGTACAGGG - Intergenic
929101335 2:38317471-38317493 ACTTATATTCAAATTGTGTTTGG - Intronic
930510320 2:52336161-52336183 AATGAAATTCAGAATGACTTGGG - Intergenic
930546441 2:52773210-52773232 TCTGATATCCAGAATCTATTAGG + Intergenic
930930770 2:56879298-56879320 TCTAATATTCAGAATCTGTAAGG + Intergenic
931919491 2:66997749-66997771 ACTGATATCCAGAATCTATAAGG - Intergenic
932738525 2:74273720-74273742 ACTGGTCTTCAGTATCTGTTGGG - Intronic
933083287 2:78022187-78022209 ACTAATATTCAGAATATGCAAGG - Intergenic
933326654 2:80846494-80846516 ACTGATATTCAGAAAGAATAAGG - Intergenic
937498983 2:122457179-122457201 ACTAATATCCAGAATTTGTAAGG + Intergenic
938147030 2:128843475-128843497 ACTGATATCCAGAATTTATAAGG - Intergenic
939442671 2:142270038-142270060 AAAGATATTCAGTATGTTTTTGG + Intergenic
939658927 2:144863288-144863310 AAATATATGCAGAATGTGTTAGG - Intergenic
939863836 2:147450553-147450575 ATTGGTATTCTGAAGGTGTTTGG - Intergenic
942478094 2:176350696-176350718 ACTAATATTCAGAATATGCAAGG - Intergenic
944521426 2:200572684-200572706 TCTGAGATTCAAAATGTTTTGGG + Exonic
945722433 2:213434581-213434603 ACTGATATCCAGAATTTATAGGG + Intronic
945902027 2:215549470-215549492 ACTAATATTCAGAATGTTACAGG + Intergenic
946984407 2:225256099-225256121 ATGGATATTCAGAAAGTGTTGGG - Intergenic
1168820806 20:772532-772554 GCTGGTGTTCGGAATGTGTTGGG + Intergenic
1170882324 20:20307925-20307947 AATGATATTAAGAATGTATTTGG - Intronic
1170886997 20:20348960-20348982 ACTTATATTCAGCATGGTTTTGG + Intronic
1171016221 20:21544332-21544354 AAAGATATTCAGAGTGTGTTAGG + Intergenic
1171047670 20:21826097-21826119 ACTGCTATTAACATTGTGTTGGG - Intergenic
1171112235 20:22494782-22494804 ACTGGTTTTCAGAGTGTCTTAGG + Intergenic
1171116596 20:22530155-22530177 ACTGCTAATCAGCATTTGTTAGG + Intergenic
1171868444 20:30507665-30507687 AATGATATTAAGATTCTGTTGGG + Intergenic
1171939496 20:31312091-31312113 ACTGATAGTAAATATGTGTTTGG + Intergenic
1173697619 20:45033151-45033173 TCTAATATTCAGAATCTGTAAGG - Intronic
1174890352 20:54385153-54385175 ACTGAGATTTGGGATGTGTTTGG - Intergenic
1174934271 20:54850804-54850826 ACTGAAATTCAGAAAGAGGTAGG + Intergenic
1177512215 21:22103107-22103129 ACTAATATCCAGAATGTATGAGG - Intergenic
1177538740 21:22463955-22463977 ACTCATATCCAGAATGTATAAGG - Intergenic
1177598885 21:23284887-23284909 TTTGATTTTCAAAATGTGTTTGG + Intergenic
1178182713 21:30181840-30181862 ACTGATTTACAGAATGTTTTTGG - Intergenic
1178566963 21:33695617-33695639 ACTTATACTCAAAATGTGTTTGG - Intronic
1179500784 21:41807293-41807315 ACAGAGATTCAGAATCTTTTAGG - Intronic
1179946339 21:44680148-44680170 ACTAATATCCAGAATATGTAAGG + Intronic
1182940694 22:34274104-34274126 ACTGCTATTCACAATGTGAGTGG + Intergenic
1183662777 22:39231243-39231265 TCTGACACTCAGAATGTTTTGGG - Intronic
1183765409 22:39868735-39868757 TCTGATATTCAGAATCTATAAGG + Intronic
1185151780 22:49167883-49167905 GAAGATATTCAGAATGTGTAGGG - Intergenic
949753932 3:7387167-7387189 ACTAATATCCAGAATGTATGAGG - Intronic
950988683 3:17406744-17406766 ACTGAAATTCATAATGTCTATGG + Intronic
951842920 3:27053366-27053388 ACTAATATTCAGAATCTATGGGG - Intergenic
952040696 3:29258059-29258081 ACTGGTTTCCACAATGTGTTTGG - Intergenic
952522743 3:34178506-34178528 ACTGTGATTCAGCATTTGTTAGG + Intergenic
953174507 3:40537619-40537641 ACTGATATGGAGAAAGTTTTAGG + Exonic
953510277 3:43529921-43529943 ATTGAGATGCAGAATATGTTTGG - Intronic
953549131 3:43886962-43886984 ACTTTGATTCAGAATGTTTTTGG - Intergenic
955561366 3:60194694-60194716 ACTAATATCCAGAATCTGCTAGG + Intronic
956831745 3:73056488-73056510 ATTGATTTGCAGAAAGTGTTTGG + Intronic
957688464 3:83536371-83536393 ACTGATATCCAGAATTTGCAAGG + Intergenic
957963944 3:87297527-87297549 ACTGTTATCCAAAATATGTTTGG + Intergenic
958605192 3:96349804-96349826 ACTGATACTCAATATGTGCTCGG - Intergenic
958607968 3:96384585-96384607 ACTGATATCCAGAATTTATAAGG - Intergenic
958610226 3:96415677-96415699 TCTAATATTCAGAATCTATTAGG - Intergenic
958719190 3:97823024-97823046 CCTGATTTCCAGAATCTGTTTGG - Intronic
960026256 3:113014232-113014254 CCTGATTTTAAAAATGTGTTTGG - Intronic
960305890 3:116060235-116060257 ACTCATACTCAGAATTTATTTGG - Intronic
960500359 3:118430462-118430484 TCTGATATCCAGAATGTATAAGG - Intergenic
960500440 3:118431246-118431268 TCTGATATCCAGAATGTATAAGG - Intergenic
960896077 3:122506820-122506842 TTTGATATTGAGAATGTCTTTGG - Intronic
961407897 3:126695341-126695363 ACTGATATCCAGAATCTGTAAGG - Intergenic
961846447 3:129768332-129768354 AATGATTTTCAGAAGTTGTTTGG - Intronic
963874487 3:150458979-150459001 ACTGTTATTTATAATGTGATAGG - Exonic
963930889 3:151003341-151003363 TCTGAAATTCAGTATGTGTTGGG + Intergenic
965075512 3:163969913-163969935 ACTGATATTCAGAATATACAAGG + Intergenic
965459947 3:168950138-168950160 ACTGGTATTCTGATTGAGTTTGG + Intergenic
966089849 3:176119723-176119745 ACTGATATTCACAGTGTCTGTGG + Intergenic
966093174 3:176164970-176164992 ACTGATATACAGAATCTATAAGG + Intergenic
968475978 4:808882-808904 AATGATATTTAGAATGTTCTTGG + Intronic
969164240 4:5292519-5292541 ACTAATATTCAGAATCTATAAGG - Intronic
969782611 4:9420973-9420995 ACTAATATTCAAAATATTTTTGG - Intergenic
970184632 4:13437475-13437497 ACTAATATCCAGAATCTGTAAGG + Intronic
970378920 4:15485848-15485870 ACTGATATCCAGAATATACTAGG - Intronic
970389871 4:15597817-15597839 ACTGATCTTCTCCATGTGTTAGG - Intronic
971368772 4:25998610-25998632 TCTGAGATTCAGAATGTTCTAGG + Intergenic
971468723 4:26995008-26995030 TCTGGTATTCAGAATGTTTTCGG + Intronic
971515845 4:27485314-27485336 ACAGATATTTATAATGGGTTGGG - Intergenic
971550587 4:27950966-27950988 TCTAATATCCAGAATGTGTAAGG + Intergenic
972018377 4:34275604-34275626 ACTGATATTCAGAATCTATAAGG - Intergenic
972157415 4:36181716-36181738 CCTGGTATTCAGAATAGGTTTGG - Intronic
972214934 4:36886506-36886528 TCTGATATCCAGAATCTGTAAGG - Intergenic
972333712 4:38086758-38086780 CCTGCTATTCAGAGTGTGCTTGG + Intronic
973971917 4:56221617-56221639 ACTCATATTCAGAATCTGCAAGG + Intronic
974411587 4:61548160-61548182 TCTAATATTCAGAATGTATGAGG - Intronic
975563890 4:75733696-75733718 TCTAATATTCAGAATCTGTAAGG - Intronic
975833041 4:78390172-78390194 ACTGATCTTTACAATGTCTTGGG + Intronic
976634480 4:87274046-87274068 ACTTATTTTCAGAATGATTTTGG - Intergenic
977716107 4:100185609-100185631 ACTCATATTCAGATAGGGTTAGG + Intergenic
978352257 4:107832372-107832394 ACTTATATTCACTATGTGTCAGG + Intronic
978656465 4:111071016-111071038 ACTAATATTCTGAATGTAGTTGG - Intergenic
978917112 4:114140681-114140703 ACTGATATCCAGAATGTACAAGG - Intergenic
979174489 4:117646265-117646287 AATGATATCCAGAATCTATTAGG - Intergenic
980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG + Intergenic
980315106 4:131189100-131189122 AAACATATTCAGAATGAGTTAGG + Intergenic
980392483 4:132164753-132164775 TCTAATATTCAGAATTTGTAAGG - Intergenic
981825834 4:148940296-148940318 ACTTATATACAAAATGTTTTTGG - Intergenic
981968054 4:150630478-150630500 ACTGATATTCAGACTGAATAAGG - Intronic
982636332 4:157901419-157901441 ACTGATATCCAGAATCTATAAGG - Intergenic
982950990 4:161695838-161695860 ACTAATATTCAGAATCTATAAGG - Intronic
983102390 4:163641432-163641454 TGTGATATTCAGAATATCTTGGG + Intronic
983305517 4:165980161-165980183 ATTTATATTGAGAATATGTTGGG + Intronic
984264418 4:177479759-177479781 TCTGATATTCTGAATCTGTCTGG - Intergenic
984925353 4:184801668-184801690 TCTGATTTTCAGAATTTGTGGGG - Intronic
986715500 5:10520881-10520903 AATGGTATTCAAAATATGTTTGG - Intronic
986835956 5:11637615-11637637 TATGATTTTCAGAATGAGTTAGG - Intronic
988072850 5:26316580-26316602 ACTGATATCCAGAATCTATAAGG - Intergenic
988325721 5:29764591-29764613 ACTGATATCCAGAATCTATAAGG - Intergenic
989231337 5:39090473-39090495 ACTAATATCCAGAATATGCTAGG + Intergenic
989299324 5:39870407-39870429 CCTAATATCCAGAATCTGTTAGG - Intergenic
990760226 5:59121314-59121336 AATAATATTCAGAATATATTAGG + Intronic
990848017 5:60166442-60166464 ACCAAAATTCAAAATGTGTTTGG - Intronic
991415765 5:66391316-66391338 ACTAATATTCAGAATCTATAAGG + Intergenic
991692554 5:69239216-69239238 AATGATGTTGAGAATGTGGTGGG - Intronic
991929615 5:71740355-71740377 ACTGATATTGGGAATTTGTTTGG + Intergenic
993249321 5:85497166-85497188 ACTTATATCCAGAATCTGCTAGG - Intergenic
993579730 5:89645138-89645160 ACTGATATCCAGAATATATGTGG + Intergenic
993642264 5:90419487-90419509 ACTGATATTCTGAATATATAAGG + Intergenic
994174696 5:96698734-96698756 ACGCCTTTTCAGAATGTGTTGGG - Intronic
994488649 5:100412012-100412034 ACTAATATCCAGAATGTGCAAGG - Intergenic
994524669 5:100888908-100888930 CCTGATATTCAGAATATTTGGGG - Intronic
994795880 5:104299176-104299198 ACTTTTAATCAGAATATGTTGGG + Intergenic
995012479 5:107273242-107273264 TCAGATATTCAGAATGTGGTTGG + Intergenic
995378580 5:111506825-111506847 TCTGATATTCAGAATTACTTGGG - Intronic
995394063 5:111668810-111668832 AAAGATATTCAGAATGTATAGGG - Intronic
995437623 5:112155452-112155474 ACTGATATTCAGGATGCTTTTGG - Intronic
996692328 5:126353658-126353680 ACTGATTTGCAACATGTGTTTGG + Intergenic
996694582 5:126379786-126379808 ACTGATATCCAGAATGTACAAGG - Intronic
997480656 5:134182132-134182154 ACTGATATACACAATGTGGATGG + Intronic
997983501 5:138485879-138485901 GCTGACATTCAGAATGTCTTTGG - Intergenic
997995248 5:138580389-138580411 ACTGCTATTAATAATGTATTAGG - Intergenic
998648223 5:144088424-144088446 AATGATGTTGAGAATGTATTGGG - Intergenic
998702621 5:144721019-144721041 GGTGGTATTCAGAATGTGCTAGG - Intergenic
999593438 5:153174436-153174458 ACTAATATTCAAAATGTATAAGG - Intergenic
1000263030 5:159607808-159607830 ACTAATATCCAGAATGTATAAGG + Intergenic
1000302783 5:159971252-159971274 ATTGATATTTAGAATATGTGAGG - Intronic
1000709711 5:164557063-164557085 ACTAATATTCAGAATCTATAAGG - Intergenic
1001149020 5:169210603-169210625 AGTGGTATGCAGAATGTGTTGGG + Intronic
1002652911 5:180716111-180716133 TCTGGTATTCAGAATCTGTAAGG + Intergenic
1002975769 6:2074388-2074410 ACTGATATCCAAAATGTGCAGGG - Intronic
1003025787 6:2554634-2554656 GCTGTTATTCAGAATGTGGTTGG + Intergenic
1003237364 6:4307939-4307961 ACTGATTTTCAGATTGATTTGGG - Intergenic
1005247527 6:23905304-23905326 ACTGTTTTTCAGAATGTGACAGG - Intergenic
1005419543 6:25634726-25634748 GCTGAGGTTCAGAATGTGCTTGG - Intergenic
1005774234 6:29112593-29112615 ACTGGGCTTCAGAAAGTGTTTGG + Exonic
1005920769 6:30398605-30398627 ACTAATATCCAGAATATGTAAGG - Intergenic
1006944966 6:37778920-37778942 TCAGATATTCAGAAGGTGATGGG + Intergenic
1007050862 6:38827361-38827383 ACTAATATTTAGAATGTTTTAGG + Intronic
1007815169 6:44517515-44517537 ACTAATATCCAGAATATGTAAGG - Intergenic
1007866909 6:44981453-44981475 GTTGATATACAGAATGTATTGGG - Intronic
1008438664 6:51507034-51507056 ACTAATATCCAGAATCTGTAAGG + Intergenic
1008704497 6:54141824-54141846 ACTAATCTTCAGACTGTCTTCGG - Intronic
1008949966 6:57146160-57146182 ACTAATATTCAGAATCTACTAGG - Intronic
1011116780 6:83901903-83901925 ACTGATATCCAGAATATATAAGG - Intronic
1011503619 6:88017505-88017527 ACTAATATGCATAATGTGTTTGG + Intergenic
1013938045 6:115623146-115623168 ACTAATATTCAGAATCTATGAGG + Intergenic
1014369450 6:120586176-120586198 TATGATTTACAGAATGTGTTAGG - Intergenic
1014507654 6:122279892-122279914 ACTAATATTCAGAATTTACTTGG + Intergenic
1014533250 6:122585813-122585835 ACGGTTATTCCTAATGTGTTTGG + Intronic
1014745772 6:125198665-125198687 ACTTGTGTTCACAATGTGTTAGG - Intronic
1014902331 6:126983135-126983157 ACTAATATTCAGAATCTATAAGG + Intergenic
1015873487 6:137800205-137800227 AGTGCTACTCAGAATGTCTTGGG + Intergenic
1016948355 6:149555580-149555602 ACTGATATCCAGAATCTGCAAGG + Intergenic
1018278097 6:162154152-162154174 ACTGTTTTTCAGAGTGTGGTGGG - Intronic
1018487727 6:164258827-164258849 ACTACTATTCTGAATGGGTTAGG + Intergenic
1018636894 6:165870211-165870233 ACTAATATCCAGAATATGTAAGG + Intronic
1019264447 7:105536-105558 ACTCATATCCAGAATATGTAAGG + Intergenic
1019847324 7:3518446-3518468 ACTAATATCCAGAATGTACTAGG + Intronic
1020272894 7:6607515-6607537 CCTGAAATTCAGAATGAGTCCGG - Intronic
1020331922 7:7027371-7027393 ACTAGTATTCAGAATCTGTAAGG - Intergenic
1020775491 7:12449507-12449529 ACTGATATTCAGAATATACAAGG + Intergenic
1020815387 7:12899293-12899315 AATAAAATTCAGAATATGTTTGG + Intergenic
1020996364 7:15270502-15270524 ACTAATATCCAGAATATGTGAGG - Intronic
1021388373 7:20060552-20060574 ACTGAGATTCTAAATGTATTAGG + Intergenic
1021727689 7:23565430-23565452 ACTAATAATCAGAATATGTAAGG - Intergenic
1022561800 7:31357118-31357140 ACTGATTTTAATAATGTGTTTGG + Intergenic
1022798331 7:33750852-33750874 ACTACTATCCAGAATGTGTAAGG - Intergenic
1023232144 7:38044943-38044965 ACTGATATTCAGAATACATAAGG - Intergenic
1023271942 7:38473160-38473182 ACTGATCTTCAAAAAGTCTTGGG - Intronic
1023697069 7:42858363-42858385 ACTAACATTTAGAATGTGCTGGG - Intergenic
1025101333 7:56137631-56137653 ACTGATATTCAGATTCTATGTGG + Intergenic
1028026115 7:85842977-85842999 ACTGATATGCAGAATTTATAAGG - Intergenic
1028434766 7:90789917-90789939 ACACATATTTAGAATGTGTCTGG + Intronic
1028610490 7:92705072-92705094 ACTGTGATTAAGAATCTGTTTGG + Intronic
1028813161 7:95112168-95112190 ACTAATATTCAGAATCTATGTGG + Intronic
1030461869 7:109848569-109848591 CCTGAAATTAAAAATGTGTTTGG + Intergenic
1032827579 7:135587147-135587169 AATGTTCTTCAGAGTGTGTTTGG + Intronic
1032890287 7:136187469-136187491 ACTGATAATAAAAATGAGTTTGG + Intergenic
1033320389 7:140333693-140333715 ACTGAGATTTAGAATGTGATCGG - Intronic
1034739467 7:153460337-153460359 AAGGATATACAGAATGTCTTGGG - Intergenic
1034743481 7:153500255-153500277 ACTGATATCCAGAATCTGCAAGG - Intergenic
1037265850 8:17059202-17059224 ACAAATATTTAAAATGTGTTGGG - Intronic
1038173270 8:25158271-25158293 TCTGATATCCAGAATCTGTAAGG - Intergenic
1038929751 8:32179680-32179702 TTTAATATTCAGAAAGTGTTTGG + Intronic
1039113144 8:34062316-34062338 ACTAATATCCAGAATCTGTGAGG + Intergenic
1040568116 8:48584716-48584738 TCAGATATTCAGAATGTACTTGG + Intergenic
1041906752 8:63040925-63040947 ACTTATATCCAGAATGTACTGGG - Intergenic
1042527473 8:69778807-69778829 ATTGATGTTCAGGATGTGTCAGG - Intronic
1042527544 8:69779918-69779940 ACTGATATCCAGAATTTATAAGG + Intronic
1042861745 8:73321100-73321122 ACTGATAAAAAGAATATGTTGGG + Intronic
1042943742 8:74133903-74133925 ACTGATATCCAGAATCTATAAGG + Intergenic
1043473432 8:80583401-80583423 ACTAGAATTCAGAATGTGTCTGG - Intergenic
1043871041 8:85433180-85433202 ACTAATATCCAGAATGTATAAGG - Intronic
1044493834 8:92852302-92852324 ACTAATATTCAGAATTTACTAGG - Intergenic
1044941909 8:97352206-97352228 TCTGATTTACAAAATGTGTTAGG - Intergenic
1045424686 8:102053300-102053322 ACTGATATTAAATATGTATTTGG + Intronic
1045455379 8:102373477-102373499 ACAGGTATTCAGAATGTGGATGG - Intronic
1045718012 8:105071062-105071084 ACTTATATTTTGCATGTGTTAGG + Intronic
1046012041 8:108560807-108560829 ACTGATATTCAGAAAACATTCGG - Intergenic
1046119907 8:109832802-109832824 TCTAATATTCAGAATGTATAGGG + Intergenic
1047118966 8:121878884-121878906 AAAGATATTCAGATTATGTTTGG + Intergenic
1048356883 8:133661117-133661139 TCTGATATTCATAATTAGTTGGG - Intergenic
1048399860 8:134055051-134055073 ACTGATATTCTGGTTTTGTTGGG - Intergenic
1048601495 8:135923436-135923458 ACTGATTCTCAGATTGTGTGAGG + Intergenic
1048701465 8:137095348-137095370 TCTAATATTCAGAATCTGTAAGG + Intergenic
1050403980 9:5287834-5287856 ACTAATATTCAGCATTTGTGAGG - Intergenic
1050905307 9:10995743-10995765 ACTGAAATTCACAATTGGTTGGG + Intergenic
1051243953 9:15090336-15090358 CCTGATATACAGTATGTGATTGG - Intergenic
1053559347 9:39174001-39174023 CTTAATATTCAGAACGTGTTAGG + Intronic
1053823462 9:41994241-41994263 CTTAATATTCAGAACGTGTTAGG + Intronic
1054137764 9:61444945-61444967 CTTAATATTCAGAACGTGTTAGG - Intergenic
1054607111 9:67193124-67193146 CTTAATATTCAGAACGTGTTAGG - Intergenic
1054980984 9:71205532-71205554 ACTTGTATTCAAAAAGTGTTTGG - Intronic
1055196900 9:73605798-73605820 ACTGAGATTCAAATTCTGTTAGG - Intergenic
1055261369 9:74437730-74437752 AATGAAATTCAGAATGTTTTTGG + Intergenic
1055543878 9:77346405-77346427 ACTAATATCCAGAATCTGTAAGG - Intronic
1055996424 9:82165257-82165279 ACTAATATCCAGAATCTGTAAGG + Intergenic
1056342348 9:85649131-85649153 ACTGATTTTCAAAATGTCCTTGG + Intronic
1056468102 9:86878603-86878625 CATGATATTCAGATTTTGTTGGG + Intergenic
1056555913 9:87686861-87686883 ACTGATATTCAGAGTGAGCCAGG + Intronic
1058256809 9:102776961-102776983 ACTGTTATTCAGAATGTTACTGG - Intergenic
1062338010 9:136080987-136081009 TCTGTTAATCAGAATGTGCTTGG - Intronic
1186655139 X:11604333-11604355 ACTATTCATCAGAATGTGTTTGG - Intronic
1186683693 X:11901979-11902001 ACTAATATCCAGAATCTGTAAGG - Intergenic
1186938726 X:14480242-14480264 TCTAATATTCAGAATCTGTAAGG - Intergenic
1187108812 X:16274135-16274157 ACTAATATTCAGAATCTATAAGG - Intergenic
1188613909 X:32133734-32133756 AGTCATATTCTGAACGTGTTTGG - Intronic
1189700979 X:43716143-43716165 AATGGTCTTCAGAATGTGTGGGG + Intronic
1189874593 X:45422524-45422546 TCTGATATCCAGAATGTATAAGG + Intergenic
1193254838 X:79335721-79335743 ACTAATATTCAGAATATGTAGGG - Intergenic
1193321398 X:80126132-80126154 ACTAATATTCAGAATCTATAAGG - Intergenic
1193506823 X:82354644-82354666 ACTAATATTCAGAATATATAAGG + Intergenic
1193580264 X:83255940-83255962 ACTAATATTCAGAATTTATAAGG + Intergenic
1194099717 X:89688842-89688864 TCTGATATTCAGAATCTATAAGG - Intergenic
1194441050 X:93934797-93934819 ATTAATAGTCAGAATGTGTAAGG - Intergenic
1194842629 X:98762839-98762861 TCTAATATTCAGAATCTGTAAGG + Intergenic
1196743733 X:119049044-119049066 AATAAAATTCAGAATGTGTATGG + Intergenic
1197086600 X:122483807-122483829 ACTGATATCCAGAATTTATAAGG + Intergenic
1197110501 X:122768359-122768381 ACTGAAATCCAGAATCTGTAAGG + Intergenic
1197424170 X:126274154-126274176 ACTGATATTTTTAATGTTTTTGG - Intergenic
1197788554 X:130225708-130225730 ACAGGTAATCTGAATGTGTTTGG + Intronic
1198189793 X:134291131-134291153 ACAGAAATCCAGAATGTGTCAGG + Intergenic
1198539574 X:137622736-137622758 ACTGTGATTCAGAATATGTCTGG + Intergenic
1199423915 X:147679050-147679072 ATTAATTTTCAGAATGTGTATGG - Intergenic
1199821116 X:151447852-151447874 ACTGATATCCAGAATTTATAAGG + Intergenic
1200389196 X:155926579-155926601 GCTGATATGGAGAATGTTTTAGG - Intronic
1200449380 Y:3306119-3306141 TCTGATATCCAGAATGTATCAGG + Intergenic
1200452722 Y:3350225-3350247 TCTGATATTCAGAATCTATAAGG - Intergenic
1200858005 Y:7960110-7960132 ACTTGTATTCAGAAGGTGATGGG - Intergenic