ID: 1149720631

View in Genome Browser
Species Human (GRCh38)
Location 17:58840576-58840598
Sequence GAAAATGTACAGAACCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 539}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149720630_1149720631 -9 Left 1149720630 17:58840562-58840584 CCAGGGATAGGGTAGAAAATGTA 0: 1
1: 1
2: 2
3: 20
4: 164
Right 1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG 0: 1
1: 0
2: 2
3: 34
4: 539
1149720625_1149720631 11 Left 1149720625 17:58840542-58840564 CCTTGGAGAAATGGCTGATTCCA 0: 50
1: 238
2: 428
3: 694
4: 898
Right 1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG 0: 1
1: 0
2: 2
3: 34
4: 539
1149720624_1149720631 19 Left 1149720624 17:58840534-58840556 CCAGGACTCCTTGGAGAAATGGC 0: 5
1: 85
2: 250
3: 474
4: 711
Right 1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG 0: 1
1: 0
2: 2
3: 34
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149720631 Original CRISPR GAAAATGTACAGAACCAGCC TGG Intronic
902459826 1:16565818-16565840 GAAAAAGTAAAGAATAAGCCAGG + Intronic
902460011 1:16567364-16567386 GAAAAAGTAAAGAATAAGCCAGG + Intronic
902829195 1:18998970-18998992 AAAACTGAACAAAACCAGCCAGG + Intergenic
903048394 1:20582318-20582340 AAAAATGCAAAGAATCAGCCGGG + Intergenic
903153011 1:21426418-21426440 GAAAAAGTAAAGAATAAGCCAGG + Intergenic
903160119 1:21481563-21481585 GAAAAAGTAAAGAATAAGCCAGG - Intronic
903392538 1:22974714-22974736 TAAAATGTATAAAATCAGCCAGG + Intergenic
903504787 1:23825599-23825621 AAAGATGAACAGAATCAGCCTGG + Intronic
904217557 1:28934952-28934974 AAAAATGAACAGAACTAGCCAGG + Intronic
906994466 1:50776962-50776984 AAAAATATACAGAATCAGCCAGG + Intronic
907199448 1:52713867-52713889 GAAAATGTCTAGAGCCAGCCTGG + Intergenic
907221050 1:52907228-52907250 GGAAAGTTACAGAATCAGCCAGG + Intronic
907346164 1:53782566-53782588 GAAACTGTACAGAAGCAGCAAGG + Intronic
908412234 1:63878429-63878451 GAAAATGTACAGAGACCGTCAGG - Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
909804471 1:79857751-79857773 GAAAAGGTACACAATGAGCCAGG + Intergenic
910323543 1:85977056-85977078 GACAATCTCCAGCACCAGCCTGG + Intronic
912687419 1:111778336-111778358 GCACATGCACAGAACCAGGCCGG + Intronic
913357238 1:117936168-117936190 GTAAATCTATAGAACCAGCAGGG - Intronic
913605579 1:120462759-120462781 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
913642268 1:120823939-120823961 GAAAAAGTAAAGAATAAGCCAGG - Intronic
913642444 1:120825479-120825501 GAAAAAGTAAAGAATAAGCCAGG - Intronic
913642624 1:120827019-120827041 GAAAAAGTAAAGAATAAGCCAGG - Intronic
913642995 1:120830381-120830403 GAAAAAGTAAAGAATAAGCCAGG - Intronic
913643179 1:120831953-120831975 GAAAAAGTAAAGAATAAGCCAGG - Intronic
913643356 1:120833568-120833590 GAAAAAGTAAAGAATAAGCCAGG - Intronic
913643480 1:120834595-120834617 GAAAAAGTAAAGAATAAGCCAGG - Intronic
913643762 1:120837134-120837156 GAAAAAGTAAAGAATAAGCCAGG - Intronic
913643946 1:120838710-120838732 GAAAAAGTAAAGAATAAGCCAGG - Intronic
913711698 1:121490720-121490742 GAAAATGTATAGCACAGGCCGGG + Intergenic
913989596 1:143598535-143598557 GAAAAAGTAAAGAATAAGCCAGG + Intergenic
914082788 1:144424875-144424897 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914082965 1:144426463-144426485 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914083138 1:144428003-144428025 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914177702 1:145293389-145293411 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914177883 1:145294967-145294989 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914178064 1:145296523-145296545 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914178247 1:145298147-145298169 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914178428 1:145299733-145299755 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914178609 1:145301285-145301307 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914178792 1:145302909-145302931 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914178973 1:145304479-145304501 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914179170 1:145306078-145306100 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914179351 1:145307662-145307684 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914179546 1:145309261-145309283 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914179726 1:145310843-145310865 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914179906 1:145312393-145312415 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914180090 1:145314017-145314039 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914180271 1:145315611-145315633 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914180452 1:145317163-145317185 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914180635 1:145318789-145318811 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914180816 1:145320381-145320403 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914180995 1:145321925-145321947 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914181178 1:145323551-145323573 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914181359 1:145325131-145325153 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914181538 1:145326675-145326697 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914181721 1:145328299-145328321 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914181902 1:145329890-145329912 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914182083 1:145331442-145331464 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914182266 1:145333066-145333088 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914182447 1:145334644-145334666 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914182628 1:145336198-145336220 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914182811 1:145337822-145337844 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914182992 1:145339400-145339422 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914183173 1:145340952-145340974 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914183356 1:145342572-145342594 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914183537 1:145344154-145344176 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914183718 1:145345706-145345728 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914183900 1:145347330-145347352 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914184080 1:145348924-145348946 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914184261 1:145350476-145350498 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914184444 1:145352102-145352124 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914184624 1:145353688-145353710 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914184805 1:145355240-145355262 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914184988 1:145356864-145356886 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914185169 1:145358435-145358457 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914185350 1:145359987-145360009 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914185533 1:145361611-145361633 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914185714 1:145363189-145363211 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914185895 1:145364741-145364763 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914186079 1:145366365-145366387 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914186260 1:145367949-145367971 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914186442 1:145369501-145369523 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914186625 1:145371125-145371147 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914186805 1:145372697-145372719 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914186986 1:145374249-145374271 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914187169 1:145375873-145375895 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914187350 1:145377451-145377473 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914187529 1:145378999-145379021 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914187712 1:145380625-145380647 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914187893 1:145382203-145382225 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914188074 1:145383755-145383777 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914188257 1:145385379-145385401 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914188438 1:145386959-145386981 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914188617 1:145388503-145388525 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914188800 1:145390129-145390151 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914188981 1:145391715-145391737 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914189159 1:145393259-145393281 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914210836 1:145577406-145577428 GAAAAAGTAAAGAATAAGCCAGG + Intergenic
914211010 1:145578968-145578990 GAAAAAGTAAAGAATAAGCCAGG + Intergenic
914269597 1:146068188-146068210 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914269773 1:146069728-146069750 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914269952 1:146071332-146071354 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914270313 1:146074456-146074478 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914270493 1:146076054-146076076 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914270850 1:146079192-146079214 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914271029 1:146080790-146080812 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914271387 1:146083922-146083944 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914271567 1:146085526-146085548 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914271922 1:146088649-146088671 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914272102 1:146090247-146090269 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914272459 1:146093367-146093389 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914272638 1:146094965-146094987 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914272997 1:146098089-146098111 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914273176 1:146099687-146099709 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914273535 1:146102811-146102833 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914273715 1:146104409-146104431 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914274074 1:146107529-146107551 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914274253 1:146109127-146109149 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914274433 1:146110697-146110719 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914274611 1:146112239-146112261 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914274789 1:146113837-146113859 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914275144 1:146116957-146116979 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914275323 1:146118555-146118577 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914275504 1:146120141-146120163 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914275681 1:146121683-146121705 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914275858 1:146123291-146123313 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914276210 1:146126421-146126443 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914366610 1:146984778-146984800 GAAAAAGTAAAGAATAAGCCAGG - Intronic
914366787 1:146986317-146986339 GAAAAAGTAAAGAATAAGCCAGG - Intronic
914366971 1:146987919-146987941 GAAAAAGTAAAGAATAAGCCAGG - Intronic
914367143 1:146989540-146989562 GAAAAAGTAAAGAATAAGCCAGG - Intronic
914367323 1:146991078-146991100 GAAAAAGTAAAGAATAAGCCAGG - Intronic
914367507 1:146992677-146992699 GAAAAAGTAAAGAATAAGCCAGG - Intronic
914485478 1:148105541-148105563 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914485659 1:148107127-148107149 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914485835 1:148108667-148108689 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914532431 1:148534869-148534891 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914532610 1:148536409-148536431 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914532791 1:148538019-148538041 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914532972 1:148539595-148539617 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914533145 1:148541135-148541157 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914533325 1:148542739-148542761 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914533507 1:148544309-148544331 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914533680 1:148545849-148545871 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914533860 1:148547453-148547475 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914534042 1:148549017-148549039 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914534216 1:148550557-148550579 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914534396 1:148552161-148552183 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914534577 1:148553725-148553747 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914534752 1:148555265-148555287 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914534932 1:148556875-148556897 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914535112 1:148558437-148558459 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914535467 1:148561592-148561614 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914535648 1:148563182-148563204 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914535824 1:148564724-148564746 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914536005 1:148566328-148566350 GAAAAGGTAAAGAATAAGCCAGG + Intronic
914536183 1:148567898-148567920 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914536360 1:148569440-148569462 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914536538 1:148571050-148571072 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914536719 1:148572628-148572650 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914536899 1:148574238-148574260 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914537079 1:148575824-148575846 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914537256 1:148577368-148577390 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914585444 1:149057520-149057542 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914585624 1:149059110-149059132 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914585810 1:149060708-149060730 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914585990 1:149062278-149062300 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914586170 1:149063818-149063840 GAAAAAGTAAAGAATAAGCCAGG + Intronic
914628668 1:149487978-149488000 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914628844 1:149489526-149489548 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914629023 1:149491104-149491126 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914629201 1:149492733-149492755 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914629378 1:149494283-149494305 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914629556 1:149495867-149495889 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914629734 1:149497490-149497512 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914629912 1:149499038-149499060 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914630091 1:149500622-149500644 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914630269 1:149502251-149502273 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914630446 1:149503799-149503821 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914630625 1:149505383-149505405 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914630803 1:149507012-149507034 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914630980 1:149508560-149508582 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914631156 1:149510144-149510166 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914631334 1:149511773-149511795 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914631511 1:149513321-149513343 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914631689 1:149514901-149514923 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914631866 1:149516529-149516551 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914632045 1:149518075-149518097 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914632225 1:149519653-149519675 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914632402 1:149521284-149521306 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914632582 1:149522830-149522852 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914632762 1:149524410-149524432 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914632937 1:149526035-149526057 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914633117 1:149527579-149527601 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914633296 1:149529139-149529161 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914633472 1:149530764-149530786 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914633652 1:149532310-149532332 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914633832 1:149533890-149533912 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914634008 1:149535519-149535541 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914634188 1:149537065-149537087 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914634368 1:149538641-149538663 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914634541 1:149540266-149540288 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914634721 1:149541818-149541840 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914634901 1:149543378-149543400 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914635076 1:149545003-149545025 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914635256 1:149546555-149546577 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914635436 1:149548115-149548137 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914635611 1:149549740-149549762 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914635791 1:149551292-149551314 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
914635971 1:149552852-149552874 GAAAAAGTAAAGAATAAGCCAGG - Intergenic
915318733 1:155044320-155044342 AAAAATGAACAAAATCAGCCAGG + Intronic
916362639 1:163988386-163988408 GAAAGTGTAAATAACCTGCCAGG + Intergenic
916459452 1:165008285-165008307 GAAAATGTCCAGAAACTGACTGG + Intergenic
917341756 1:173986721-173986743 AAAAATACACAGAATCAGCCAGG - Intronic
919266180 1:195269428-195269450 GAAAATATACAAAATTAGCCAGG - Intergenic
919389494 1:196964493-196964515 GAAAAAGCCCAGCACCAGCCAGG - Intergenic
920836511 1:209515649-209515671 GAAAATGAATAGAATAAGCCAGG - Intergenic
921297218 1:213715675-213715697 CAAATTGTTCAAAACCAGCCTGG + Intergenic
921392510 1:214630795-214630817 GAGAATGTACAGAACCATTCTGG + Intronic
921804681 1:219440410-219440432 GGAAATGTACAAAATGAGCCTGG + Intergenic
922453222 1:225753410-225753432 AAAAATGTAAAAAACTAGCCAGG + Intergenic
922578679 1:226680848-226680870 GAAAATGTTCAGCCCCATCCTGG + Intronic
923193577 1:231643014-231643036 GAAAATTTACAGAGCCGGCAAGG - Intronic
923607804 1:235460530-235460552 GAAATAGTACAGAAACAGCCAGG - Intronic
924150636 1:241125740-241125762 GACCCTGTACAGAAGCAGCCTGG + Intronic
1063862343 10:10324757-10324779 TAAAATGTACAAAACCAAGCTGG - Intergenic
1064628756 10:17287599-17287621 TAAAATGTATAAAACCGGCCGGG + Intergenic
1065908495 10:30280780-30280802 TAAAATGTATAAAACCAGGCTGG - Intergenic
1068993263 10:63173424-63173446 CAAAATGGAAAAAACCAGCCAGG + Intronic
1069600735 10:69705182-69705204 GAAAATGTAAAGATCCAGCCTGG - Intergenic
1069637278 10:69932839-69932861 GAAAATAAACAGAACTTGCCGGG + Intronic
1070147327 10:73784518-73784540 GAAAATGCAAAGAATTAGCCAGG - Intergenic
1070386019 10:75925307-75925329 AAAAATGTTCATTACCAGCCAGG - Intronic
1071362316 10:84861178-84861200 GAAAATGTTCAGAACCAAAGAGG + Intergenic
1071549719 10:86557295-86557317 AAAAAGGTATAAAACCAGCCTGG + Intergenic
1071641074 10:87307766-87307788 GAAAATATGCATAACCAGCTAGG + Intergenic
1072352073 10:94566813-94566835 GAAAAAATACAAAAACAGCCAGG - Intronic
1073703872 10:105960368-105960390 CAACATGTACAGAAAAAGCCAGG - Intergenic
1074389919 10:113048514-113048536 GAAAGTGTTCAGAACCATCTTGG + Intronic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1075063475 10:119273093-119273115 GAATATGAACAAAACCAGACCGG + Intronic
1076124026 10:127960726-127960748 CAAAAAATACAGAAACAGCCGGG + Intronic
1077265508 11:1647088-1647110 GAAAATGCAAAGAACCGGCTGGG - Intergenic
1077275223 11:1702578-1702600 GAAAATTTATTCAACCAGCCAGG + Intergenic
1077671953 11:4165631-4165653 GGAAGTGAACAGGACCAGCCTGG + Intergenic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078614669 11:12854089-12854111 GAAAATCACCAGAAACAGCCAGG - Intronic
1081193396 11:40131928-40131950 GAAATTGTACAGTACCATCATGG + Intronic
1085168228 11:74424026-74424048 AAAAATACACAAAACCAGCCAGG - Intergenic
1085443760 11:76586092-76586114 GGAAAAGTACAAAATCAGCCTGG - Intergenic
1086248519 11:84785598-84785620 GAAATTGTATAGAACCAACAAGG + Intronic
1086522424 11:87684951-87684973 GAAAATGTACAAGATAAGCCTGG - Intergenic
1087786945 11:102365958-102365980 GAAATTGTTCAGGACCAACCAGG - Intronic
1087971251 11:104487712-104487734 TAAAATGTACATAATAAGCCAGG + Intergenic
1088222899 11:107588753-107588775 TAAAATGTCCAGAATCAACCTGG - Intergenic
1088295675 11:108291144-108291166 GAAAATGGCCAGAACCAGGTAGG + Intronic
1088491317 11:110390743-110390765 GAAAATATACAAAATCAGCCTGG - Intergenic
1089506277 11:118964566-118964588 AAAAAAGTATAGTACCAGCCGGG + Intergenic
1089521671 11:119068605-119068627 GAAAATGTAAAAAATTAGCCGGG - Intronic
1090275337 11:125414801-125414823 GAAAATGTATATAAAGAGCCAGG + Intronic
1090707436 11:129351745-129351767 GAAAAAGTACAGGATGAGCCTGG - Intergenic
1092151293 12:6250747-6250769 GAAAATTTACAGGTCCAGCAAGG - Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1093641352 12:21529943-21529965 GAAAATGTGCAGAGCCAGAAAGG + Intronic
1093947367 12:25124980-25125002 GAAAATGTACATACCCACCATGG - Intronic
1095231361 12:39743639-39743661 GAAAATGTAAAGAATCAGAAGGG + Intronic
1095606182 12:44070544-44070566 GAAAATGTACATGAAGAGCCTGG - Intronic
1096691244 12:53323201-53323223 TAAAAAATACAAAACCAGCCAGG + Intronic
1097847167 12:64378752-64378774 AAAAATGAACAGAACCTGGCTGG + Intronic
1098225273 12:68315074-68315096 GAAGACGTACAGAAACAGCCCGG - Exonic
1100472163 12:94903250-94903272 GAAAATGTACAAACCCTCCCTGG + Intronic
1100589501 12:96012548-96012570 GCAAAAGTACAAAAACAGCCGGG + Intronic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1102498867 12:113337649-113337671 AAAAATGAACAAAACGAGCCAGG - Intronic
1103545033 12:121694587-121694609 GAAAATGTAAAAAATTAGCCGGG + Intergenic
1103630888 12:122259806-122259828 GAATAAGTTCAAAACCAGCCTGG + Intronic
1105055467 12:133094827-133094849 GAAAAAGTCCAGAACCATCAGGG - Intronic
1105370424 13:19797297-19797319 AAAAATGTACAAAATTAGCCAGG + Intergenic
1106499843 13:30317449-30317471 AAAAATGTACATAATCGGCCGGG + Intergenic
1107361235 13:39619498-39619520 GAAATTCTCCAGGACCAGCCTGG + Intergenic
1107553686 13:41499353-41499375 GAGAAGGCACAGAACCAGCTTGG - Intergenic
1108288402 13:48932308-48932330 CAAAATTTGCAGAACCATCCTGG + Intergenic
1108518597 13:51224308-51224330 AAAAATATACAGAATTAGCCAGG + Intronic
1109318840 13:60784792-60784814 GAAATTATAAAGAATCAGCCTGG + Intergenic
1109686594 13:65829591-65829613 GAGTATGTACACACCCAGCCAGG - Intergenic
1110007391 13:70290110-70290132 GAAAATGTACATAAACATCATGG + Intergenic
1112160411 13:96861137-96861159 GGAAATAAGCAGAACCAGCCAGG - Intergenic
1112348303 13:98611393-98611415 AGAAATGTAAAGGACCAGCCGGG - Intergenic
1116547362 14:46185274-46185296 GGAAATCAACAGACCCAGCCTGG + Intergenic
1117639897 14:57786601-57786623 GACAATGCCCAGTACCAGCCCGG + Intronic
1119504637 14:75161945-75161967 GGAAATGTACAAAATGAGCCTGG + Intronic
1121684022 14:95818685-95818707 GAGAATGTACACAAGGAGCCAGG + Intergenic
1121805420 14:96816033-96816055 GAAAATGTACAGAAGGAACCTGG + Intronic
1123784429 15:23655024-23655046 AAAAATGTACAGAATAGGCCAGG - Intergenic
1123968549 15:25482478-25482500 CAAAATATACAAAACTAGCCGGG + Intergenic
1124212201 15:27772545-27772567 GAAAATGGAGAGAACTGGCCGGG + Intronic
1126009879 15:44292489-44292511 AAAAATATACAGAACTAGCCGGG - Intronic
1126597150 15:50394367-50394389 CAAAATGTTTAGGACCAGCCGGG + Intergenic
1126671220 15:51116706-51116728 CAAAGGGTACTGAACCAGCCAGG - Intergenic
1126815541 15:52449838-52449860 AAAAATGAACAGAATTAGCCAGG + Intronic
1127015787 15:54686085-54686107 GAAAATGTACAAAATGAACCTGG + Intergenic
1127506811 15:59605843-59605865 GAAAATGTATAGAATAGGCCGGG - Intronic
1128733723 15:70038024-70038046 GAAAATGTACAAGATGAGCCAGG + Intergenic
1128764200 15:70241188-70241210 CAAAATGGACAGTTCCAGCCAGG + Intergenic
1128965007 15:72050311-72050333 CAAAACGTACATTACCAGCCGGG + Intronic
1130233851 15:82116490-82116512 TTAAATGTAGAGACCCAGCCAGG - Intergenic
1130346802 15:83054853-83054875 GAAAATGTTTGGTACCAGCCGGG - Intronic
1130682292 15:86007228-86007250 GAAAATGTTAAGAATTAGCCGGG - Intergenic
1130957062 15:88634772-88634794 AAAAATGTAAAAAATCAGCCAGG - Intergenic
1131837143 15:96402137-96402159 AAAAGTGTGTAGAACCAGCCTGG - Intergenic
1132295446 15:100730988-100731010 GCAAATTTCCAGAACCACCCAGG + Intergenic
1132429603 15:101749911-101749933 GAAAATGTATAGACCCAGCATGG + Intergenic
1132902291 16:2263771-2263793 GAAAATAAACAAAACTAGCCGGG - Intronic
1132946769 16:2536138-2536160 GAAAATGACCACAACCATCCCGG - Intergenic
1133112769 16:3558763-3558785 GAAAAAGAAGAGCACCAGCCTGG - Intronic
1133158422 16:3892132-3892154 GAAAATGTAAACATCCAGCCAGG - Intergenic
1133334299 16:4996779-4996801 ATAAAATTACAGAACCAGCCGGG - Intronic
1135852883 16:25980572-25980594 TAGAATGGACAGAACCAGCCAGG + Intronic
1136116172 16:28096238-28096260 AAAAATAAACAGAACTAGCCAGG + Intergenic
1137754234 16:50888761-50888783 GAGAATAAACAGATCCAGCCTGG + Intergenic
1139838317 16:69858069-69858091 GAAAAGGAACAAAACCAACCGGG - Intronic
1142017838 16:87760735-87760757 GAAAATGTACATTTACAGCCAGG + Intronic
1142646930 17:1320172-1320194 AAAAATGCAAAGGACCAGCCAGG + Intergenic
1143704785 17:8689158-8689180 AAAAATGCACAAAACCAGCTGGG - Intergenic
1144492741 17:15728398-15728420 GAAAATGTATATAATCAGGCTGG - Intergenic
1144499471 17:15772420-15772442 GAAAATGTATATAATCAGGCTGG - Intergenic
1144620988 17:16818484-16818506 GAATATGGACGGAACCAGCTGGG - Intergenic
1144631121 17:16873059-16873081 GAAAATGTCCAGAGACTGCCGGG - Intergenic
1144907512 17:18648258-18648280 GAAAATGTATATAATCAGGCTGG + Intronic
1145162853 17:20587438-20587460 GAAAATGTATATAATCAGGCTGG - Intergenic
1145744681 17:27307257-27307279 TTAAATGTACAGGACCAGCTGGG - Intronic
1146110379 17:30084127-30084149 GAAAAAGGAAAGAAGCAGCCCGG - Intronic
1146449364 17:32960334-32960356 GAAAATGTTTTGAACTAGCCTGG - Intergenic
1147572971 17:41582777-41582799 GAATATGGATGGAACCAGCCAGG - Intronic
1148644841 17:49213780-49213802 GAAACTGTACAGAAGAAGGCAGG + Intronic
1149452408 17:56759996-56760018 GAAAATTTACAGCAGCAGACAGG + Intergenic
1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG + Intronic
1150317524 17:64181809-64181831 AAAAAAATACAAAACCAGCCGGG - Intronic
1150674466 17:67233141-67233163 TAAAATAAACATAACCAGCCTGG + Intronic
1151332012 17:73415504-73415526 AAAAATGAACAGAACTAGCTTGG - Intronic
1152150291 17:78595400-78595422 TAAAATGTATAGAACCAAGCTGG + Intergenic
1153277668 18:3383881-3383903 CAAAATGTAAAGAATTAGCCAGG + Intergenic
1153375482 18:4372629-4372651 GAAAAGGTACAGATCAGGCCAGG + Intronic
1153882005 18:9429378-9429400 GAAAAGGTACAGATCCTGCCTGG - Intergenic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1156021867 18:32608614-32608636 AAAAATGTACAACAGCAGCCAGG - Intergenic
1157891657 18:51423822-51423844 GAAAATGTCCAGAATAGGCCAGG - Intergenic
1158500348 18:57995366-57995388 TAAAATGTACAGAACTCTCCTGG + Intergenic
1158783010 18:60674760-60674782 GGAAATGTACAATACAAGCCTGG + Intergenic
1159555510 18:69941134-69941156 GAAAATGTACAGAAACACCTGGG + Intronic
1159863239 18:73673972-73673994 GAAAATGTACAGAATGAGCCTGG - Intergenic
1160546774 18:79662644-79662666 GAAAATCTGCAAATCCAGCCAGG - Intergenic
1163877530 19:19885684-19885706 GAAAAAATACAAAACAAGCCGGG - Intronic
1164613577 19:29650520-29650542 AAAAATGTACAAAACTAGGCTGG - Intergenic
1165604027 19:37083716-37083738 GAAATTGTACAAAATGAGCCTGG - Intronic
1166958031 19:46478842-46478864 CAAATTGGACAGAGCCAGCCAGG - Intergenic
1167398384 19:49247003-49247025 GAAAATGCAAAGGACCGGCCGGG - Intergenic
1168276624 19:55282371-55282393 AAAAGGCTACAGAACCAGCCTGG + Intronic
1168673213 19:58257214-58257236 AAAAATGCCAAGAACCAGCCAGG - Intronic
1202676071 1_KI270711v1_random:8002-8024 GAAAAAGTAAAGAATAAGCCAGG + Intergenic
1202676258 1_KI270711v1_random:9550-9572 GAAAAAGTAAAGAATAAGCCAGG + Intergenic
1202676442 1_KI270711v1_random:11096-11118 GAAAAAGTAAAGAATAAGCCAGG + Intergenic
925591948 2:5518480-5518502 GAAAATGTAAAGAATCGGCCAGG + Intergenic
927266248 2:21154839-21154861 GAAGATGTACAGGACCAGGAAGG - Intergenic
928402067 2:30986209-30986231 GAAAACACACAGACCCAGCCAGG + Intronic
928506866 2:31962748-31962770 GGAAATGTACAAAATGAGCCTGG + Intronic
928515760 2:32043530-32043552 TAAGTTGTACAGAACAAGCCAGG + Intergenic
929363921 2:41128405-41128427 CAAAATGTACAGAACCGTCGAGG + Intergenic
929790794 2:45021338-45021360 GAAAATGTAAACAAACGGCCAGG + Intergenic
929828405 2:45328506-45328528 GAAACTGTCCACAACCAGCAAGG - Intergenic
930039815 2:47112791-47112813 GAAAATCAAAAGTACCAGCCTGG + Intronic
930436019 2:51343283-51343305 TAAAATGTATAGAGCCAGGCTGG + Intergenic
930611201 2:53545917-53545939 GCACATGAACAGAAGCAGCCAGG + Intronic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
931978170 2:67666183-67666205 TAAAATGTTCATACCCAGCCAGG - Intergenic
932103132 2:68919175-68919197 GAAAAGGCACAGAAACATCCAGG + Intergenic
932844905 2:75125027-75125049 GAAAATAAACAGGAACAGCCAGG - Intronic
933819198 2:86094468-86094490 GAGAAAGTACAAGACCAGCCTGG - Intronic
934658593 2:96130995-96131017 TAACATGTACAGAAACTGCCAGG - Intronic
935189183 2:100762213-100762235 GCAAAGGTACAGAAAAAGCCAGG - Intergenic
937157499 2:119731416-119731438 TTAAAAGTAGAGAACCAGCCAGG + Intergenic
937657967 2:124398655-124398677 GAAAAAATACAAAACTAGCCAGG - Intronic
939559105 2:143712880-143712902 GAAAATATAAAGAACTAACCTGG + Intronic
939598580 2:144159693-144159715 GAAAAACTACAGATCCAGTCTGG - Intronic
939800241 2:146699097-146699119 AAAAAAGAACAGAACCAGCCTGG + Intergenic
941400827 2:165028718-165028740 GAAAATGTCCAGAACAAACCAGG - Intergenic
941836731 2:170030249-170030271 GAAAATGTACAAAACGAACCCGG - Intronic
943701784 2:190995253-190995275 GAAACAGTCCAGAAGCAGCCTGG + Intronic
944583604 2:201154382-201154404 GAAAATGGAGAGAATAAGCCAGG - Intronic
947608216 2:231504225-231504247 TAAAATTCACATAACCAGCCGGG + Intergenic
947828552 2:233123158-233123180 AAAAATGTACAGTCCCAGCCAGG + Intronic
1169117363 20:3074268-3074290 TAAAATGTATAAAACCAGGCCGG - Intergenic
1169259093 20:4122199-4122221 AAAAAAGTAAAAAACCAGCCAGG + Intronic
1170985294 20:21252523-21252545 TAAAATGTACAGAAGTGGCCAGG + Intergenic
1172079164 20:32325483-32325505 GAAAATGTAAAAAACAGGCCAGG - Intronic
1172332765 20:34087176-34087198 GAAAATGCACAGCACTGGCCAGG + Intronic
1172758283 20:37303211-37303233 GGAAATGTACAAAATGAGCCTGG - Intronic
1173298414 20:41779595-41779617 GGAAATGAACAGAACAAGACAGG - Intergenic
1174182495 20:48683598-48683620 GAGACTGTGCAGAACCAGCCGGG + Intronic
1174639407 20:52030409-52030431 CCAAATGTACTGTACCAGCCTGG - Intergenic
1174783894 20:53414681-53414703 AAAAATGAAAAGAACAAGCCAGG + Intronic
1175476098 20:59275616-59275638 GAAAATGTGCAGTACCTCCCTGG - Intergenic
1175803733 20:61815644-61815666 GCAAAGGTACAGAAGCAGCCTGG + Intronic
1178260886 21:31098768-31098790 GAAAGTGCCCCGAACCAGCCAGG + Intergenic
1178529647 21:33364968-33364990 AAAAATGAACAGAATTAGCCAGG + Intergenic
1178638358 21:34325250-34325272 GTAAATGTTCAAGACCAGCCTGG - Intergenic
1178725559 21:35048390-35048412 GCACATGCACAGAGCCAGCCAGG - Intronic
1178841710 21:36143007-36143029 TAAAATCTACAGATCCGGCCAGG + Intronic
1178925273 21:36769531-36769553 GAAAATATACAGAAGCAGGGAGG - Intronic
1179144778 21:38758223-38758245 AAAAATTTACAGAATTAGCCAGG - Intergenic
1179662895 21:42889395-42889417 GGAAATGTGTAGAGCCAGCCTGG - Intronic
1179820320 21:43933497-43933519 GAAAATGTCAAGAAGCAGCCAGG - Intronic
1180204674 21:46251302-46251324 GAAAAAGTAAAGAAGCAGGCTGG + Intronic
1180908895 22:19434516-19434538 GAAATAGTACAAAAGCAGCCGGG - Intronic
1181289996 22:21784396-21784418 GAAAATGAAAATAAGCAGCCAGG + Intronic
1182223575 22:28777800-28777822 GAAAATTTGCATAAACAGCCAGG - Intronic
1185383688 22:50521955-50521977 GAACATGCTCAGCACCAGCCAGG - Intronic
949129354 3:482733-482755 TAAAATGCAAAGGACCAGCCGGG + Intergenic
949254500 3:2029854-2029876 AAAAAAGTAAAGAATCAGCCTGG + Intergenic
949784533 3:7725754-7725776 GAAAGTGGACAGCCCCAGCCAGG - Intronic
950074188 3:10175592-10175614 GAAAAGGTACAAAATCAGCTGGG + Intronic
952322588 3:32292134-32292156 GAAAATGTTCAGAAGAATCCAGG + Intronic
952659614 3:35829521-35829543 GAAAAAGTACAAAACCTGCAGGG - Intergenic
955310777 3:57884646-57884668 AAAAATGCAAAGAATCAGCCGGG + Intronic
958266389 3:91442638-91442660 GAAATTGTACAGGAACAGTCTGG - Intergenic
958717874 3:97808830-97808852 GAAAAAATACAGAATGAGCCTGG + Intergenic
958866682 3:99508948-99508970 GCAAAAGTACAGAACCACCAAGG - Intergenic
960022203 3:112967366-112967388 GAAGATGAACAGAAACAGCGAGG - Intronic
960620598 3:119633201-119633223 GAAAATATTCAGACCCAGCCAGG + Intergenic
960894916 3:122493599-122493621 GAAAATTAAGAAAACCAGCCTGG + Intronic
961244178 3:125436987-125437009 AAAAATGAACAAAACTAGCCAGG + Intergenic
961378217 3:126481160-126481182 TAAAATGGACAGATCCAGCGGGG - Intergenic
961430751 3:126881194-126881216 ACAAATGTACAGAGCAAGCCTGG - Intronic
961576534 3:127841492-127841514 GAATATGTAAATAAGCAGCCAGG + Intergenic
962527524 3:136250172-136250194 GAAAAAGTACAGGGCCTGCCTGG - Intergenic
963154295 3:142079091-142079113 GAAAATACACAGTCCCAGCCTGG + Intronic
963752408 3:149196531-149196553 GAAAATGTGCAAAATGAGCCTGG + Intronic
963877432 3:150492431-150492453 GAAAAAATACTGAATCAGCCGGG + Intergenic
964045901 3:152326329-152326351 GAAAGTATACAGAACCTTCCAGG - Intronic
964230517 3:154461579-154461601 AAAAATATACAGAATTAGCCGGG - Intergenic
966426477 3:179785623-179785645 GAAAATAAACAGAACCAACCAGG + Exonic
971371725 4:26024766-26024788 AAAAATGTAAAAAACTAGCCGGG - Intergenic
971888064 4:32479251-32479273 GAAAATGTAAAAAATTAGCCGGG - Intergenic
972168716 4:36318907-36318929 GAAAATGCACAGAAGAGGCCAGG - Intronic
972416238 4:38843244-38843266 GAAAAGGTTCTGAGCCAGCCTGG - Intronic
972464929 4:39346179-39346201 GAAACTAAATAGAACCAGCCAGG + Intronic
973247265 4:48022772-48022794 GAAAATTTGCAGCATCAGCCTGG + Intronic
976602826 4:86954005-86954027 GAAAATGCACTGAACTAGGCCGG - Intronic
978072290 4:104489161-104489183 GAAAATGTAATAAACCATCCAGG + Intronic
980198857 4:129627497-129627519 GAAAAAGTACAGAAGCAGAAAGG + Intergenic
981139716 4:141254186-141254208 GACATTCTCCAGAACCAGCCTGG - Intergenic
982942298 4:161573570-161573592 GTAAAAGTACAAAATCAGCCAGG + Intronic
984421380 4:179526640-179526662 GAAAATGTTCAAGACCAGCCTGG - Intergenic
984721877 4:182980127-182980149 TAAAAGATACAGAACCAGCTGGG + Intergenic
984994649 4:185417746-185417768 AAAAATCAACAGAACCAGCCGGG + Intronic
985080948 4:186263298-186263320 TAAAATGTACAAAATCAGCTTGG + Intergenic
985355830 4:189117496-189117518 GACAACCTCCAGAACCAGCCTGG + Intergenic
985461499 4:190111704-190111726 GAAAAAGTCCAGAACCATCGGGG - Intergenic
986866374 5:11993919-11993941 AAAAATTGACAAAACCAGCCTGG - Intergenic
987414292 5:17647117-17647139 GAAAACTTCCAGTACCAGCCTGG - Intergenic
987636284 5:20545959-20545981 GAACATTTTCAGAATCAGCCAGG + Intronic
988738156 5:34043424-34043446 GAAAACATACACAACCAGCTGGG + Exonic
989823056 5:45818764-45818786 GAAAATGTACAAGATGAGCCTGG + Intergenic
990001408 5:50897780-50897802 AAAAATGTACAAAATTAGCCAGG - Intergenic
990501227 5:56398491-56398513 CAAAATATACAAAACCAGTCAGG + Intergenic
991327988 5:65459172-65459194 GAAAATGTAGAGAAACAGGCCGG - Intronic
992501927 5:77351547-77351569 GAACAAGTCCAGAACCGGCCTGG - Intronic
993161796 5:84300972-84300994 AAAATTGTACAGAATCAGCTGGG + Intronic
995143106 5:108755854-108755876 GAAAATATACAGTATCAGCCGGG + Intronic
995180440 5:109225830-109225852 GAAAAAGTACAAAATAAGCCTGG + Intergenic
996443692 5:123519346-123519368 TAAAATATTCAGACCCAGCCGGG - Intronic
996708876 5:126524241-126524263 GCAAATAAACAGAACAAGCCAGG - Intergenic
996845731 5:127896739-127896761 GAAAATGAAAAGAATCAGCTGGG - Intergenic
997122915 5:131194830-131194852 CAAATTGTCCAGAACCAGGCAGG - Intronic
997607217 5:135183843-135183865 GAAAATGCAAAGCACGAGCCAGG + Intronic
998500185 5:142625803-142625825 TACAATTTCCAGAACCAGCCTGG + Intronic
1000070381 5:157735096-157735118 TAAAAAATACAGAATCAGCCGGG - Intronic
1000751797 5:165104520-165104542 GAAAATGTACTGCAACAGTCCGG + Intergenic
1002038205 5:176489840-176489862 GAAAAGGTACCGAAGCTGCCAGG - Intronic
1002113629 5:176939094-176939116 GAAAATATAAAAAACTAGCCAGG + Intronic
1002154102 5:177261882-177261904 CAGAATGTTCAGAGCCAGCCAGG - Intronic
1004727325 6:18323816-18323838 TAAAATGCACAGAACCACCAAGG - Intergenic
1004839852 6:19570467-19570489 GGATATGTAAAGAAGCAGCCTGG + Intergenic
1005506736 6:26475610-26475632 AAAAATGTACAGGATCAGCAGGG + Intronic
1006211978 6:32403394-32403416 TAAAATGTAAAGACCCAGACTGG - Intronic
1006954574 6:37856288-37856310 GAGAAGAAACAGAACCAGCCAGG - Intronic
1008988883 6:57579319-57579341 GAAATTGTACAGGAACAGTCTGG + Intronic
1009177425 6:60477556-60477578 GAAATTGTACAGGAACAGTCTGG + Intergenic
1009193444 6:60656648-60656670 GAAAATGTCCAAAACCATCAGGG + Intergenic
1009389639 6:63130468-63130490 GATAATTTCCAGTACCAGCCTGG - Intergenic
1009517415 6:64637624-64637646 GCAAATGGCCAGAACCAACCTGG + Intronic
1018409733 6:163531799-163531821 TAAAATGTACAAACTCAGCCGGG - Intronic
1021454415 7:20814017-20814039 GAAAATGTACACAGAGAGCCGGG + Intergenic
1021836692 7:24683588-24683610 GAAAATGTACAAGATGAGCCTGG - Intronic
1023841273 7:44099471-44099493 AAAAATGTAAAAAACTAGCCGGG + Intergenic
1024298227 7:47863270-47863292 GAAACTGCACAGACCCAGCATGG - Intronic
1024338625 7:48234914-48234936 CAAAATCTACATAACCAGCATGG - Intronic
1024631101 7:51247711-51247733 GAATATGGCAAGAACCAGCCTGG - Intronic
1025616341 7:63121009-63121031 AAAAATGTTCAGATTCAGCCAGG - Intergenic
1026761801 7:73132384-73132406 GAAAATGAAAAAAACTAGCCAGG + Intergenic
1026807926 7:73439312-73439334 GAAAATGTCCAGAAGGAGCATGG + Intergenic
1027038142 7:74941205-74941227 GAAAATGAAAAAAACTAGCCAGG + Intergenic
1027085422 7:75260271-75260293 GAAAATGAAAAAAACTAGCCAGG - Intergenic
1027219757 7:76206449-76206471 CAAAAATTACAGACCCAGCCTGG + Intronic
1027931274 7:84538031-84538053 GAAAATGTAAAGAGGCGGCCTGG - Intergenic
1028127737 7:87133496-87133518 GAGAAAGTACAAAACAAGCCTGG + Intergenic
1028348828 7:89818351-89818373 GAAAATGTTCAAAATAAGCCTGG - Intergenic
1029462159 7:100701529-100701551 GAAAATGGGCAAATCCAGCCTGG - Intergenic
1030043042 7:105469060-105469082 GAAAATTCAAAGAACTAGCCTGG - Intronic
1030536508 7:110773259-110773281 CAAAATGTTCACAACCCGCCTGG + Intronic
1031833386 7:126653091-126653113 AAAAATGGCCAAAACCAGCCAGG + Intronic
1032221220 7:129995695-129995717 GAAAATGAACACATTCAGCCAGG + Intergenic
1032448092 7:132001923-132001945 AAAAATGAAAAGAACCAGCCAGG + Intergenic
1032726462 7:134593922-134593944 GAATATGTACAGAAACAAACAGG - Intergenic
1034051396 7:147987988-147988010 TAAAATGTATAAAACCTGCCAGG - Intronic
1034426945 7:151018952-151018974 GAAGACGTGCAGAACCTGCCAGG + Exonic
1035764672 8:2096468-2096490 AAAAATGTAAAGAACCACCCAGG - Intronic
1036134811 8:6151115-6151137 GGAAATGTACAAGACAAGCCAGG + Intergenic
1036260216 8:7233626-7233648 GAAAATGGAAGGAACTAGCCAGG + Intergenic
1036312253 8:7692182-7692204 GAAAATGGAAGGAACTAGCCAGG + Intergenic
1036496217 8:9272194-9272216 TAGAATGTACAACACCAGCCAGG + Intergenic
1037479715 8:19293030-19293052 GAAAATGGACAGAATGGGCCAGG - Intergenic
1037965823 8:23133411-23133433 TAAAATGTATAAAACCAGCTGGG + Intergenic
1038014035 8:23498181-23498203 GCCCATGTACACAACCAGCCTGG + Intergenic
1038112167 8:24511754-24511776 GAAAAGGGACAGCAGCAGCCTGG - Intronic
1038128158 8:24697525-24697547 AGAAATGTTCAGAAACAGCCTGG + Intergenic
1038304824 8:26389986-26390008 GAAAATGTACCCAAGCAGCTTGG - Intronic
1039030445 8:33303395-33303417 AAAAATGTCCAGGACCAGACAGG - Intergenic
1039994565 8:42520563-42520585 GAAAATGTAAAAAATTAGCCGGG + Intronic
1041638762 8:60174194-60174216 GAAAATGTACACAAAGAGACAGG + Intergenic
1042251785 8:66763440-66763462 GAAAATGTACAAGATGAGCCTGG - Intronic
1042934596 8:74045980-74046002 GAAGATGTCCAGAACTAGGCTGG + Intergenic
1043473351 8:80582590-80582612 GAAAATTTACACCATCAGCCAGG - Intergenic
1043615363 8:82118268-82118290 GAAAATGTTCTGAACTGGCCGGG - Intergenic
1044947820 8:97407666-97407688 GACAATCCACAGTACCAGCCTGG - Intergenic
1047108334 8:121759988-121760010 GAAAAAGAAAAGAACCAGCTTGG - Intergenic
1048907284 8:139100428-139100450 GAAAAGATACAGAAACAGCATGG - Intergenic
1049081641 8:140447847-140447869 CAAAAATTAGAGAACCAGCCAGG + Intronic
1049737210 8:144215328-144215350 GGAAATGTACAGAAACACCGTGG + Intronic
1050722115 9:8601902-8601924 CAAAAGGTACACAACCAGCCTGG + Intronic
1051116980 9:13706945-13706967 GAAAATGAACACAATCACCCAGG - Intergenic
1051580805 9:18671753-18671775 TAAAAAGAACAGAACCGGCCGGG + Intronic
1052123053 9:24740677-24740699 GAAAATGTACATAACATGACTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054808318 9:69413348-69413370 GAAGATGAACAGAACCTGCAGGG - Intergenic
1055538398 9:77274132-77274154 GAAAATGACAAGGACCAGCCAGG + Intronic
1056399574 9:86213499-86213521 TAAAATATACAAAAACAGCCAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056735809 9:89208736-89208758 GAAAAGGTGCAAAACCTGCCAGG - Intergenic
1056898509 9:90575391-90575413 GAAAATATACAAGACAAGCCTGG + Intergenic
1057376544 9:94529100-94529122 GAAAGTGAACAGAACCAGATGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059478664 9:114570702-114570724 GAAAATGTTCAGAAACAAGCAGG + Intergenic
1060164205 9:121395710-121395732 GAAATTGAAAAGAACAAGCCTGG - Intergenic
1062658502 9:137616070-137616092 TAAAATGCACAGGACCAGGCCGG + Exonic
1185801748 X:3017404-3017426 AAAAATGTACAAAATTAGCCAGG + Intronic
1187193492 X:17058878-17058900 GAAAATGGCCAGAACCACCTAGG + Intronic
1190217517 X:48489745-48489767 GAAAATGTGCAGTACTGGCCAGG + Intergenic
1190775796 X:53551393-53551415 GAAGTTCTACAGAACCAGCTAGG - Exonic
1193392346 X:80943576-80943598 GAAAATGTACAAGATGAGCCTGG - Intergenic
1194345564 X:92759936-92759958 CAAAATGTACAAAATGAGCCTGG - Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1195039008 X:100996701-100996723 GAAAATTTACATTTCCAGCCTGG + Intergenic
1195275818 X:103279133-103279155 AAAAATGTATATATCCAGCCTGG - Intergenic
1195637406 X:107133493-107133515 AAAAATGTAAAAAAACAGCCAGG - Intronic
1197161494 X:123327743-123327765 GAAAATCTACAGCACTAGCCTGG + Intronic
1198863399 X:141094768-141094790 AAAAATGTTCAACACCAGCCAGG - Intergenic
1198899290 X:141492619-141492641 AAAAATGTTCAACACCAGCCAGG + Intergenic
1199211322 X:145214844-145214866 GATAGTGTAAAGAACCAACCAGG + Intergenic
1200231657 X:154446723-154446745 GAAAATGTGCCCAGCCAGCCTGG - Intronic
1200758328 Y:7012956-7012978 GAAGATATACAGAAAAAGCCTGG + Intronic
1201704609 Y:16922362-16922384 GAAAATGTACATATACACCCTGG - Intergenic
1201940540 Y:19453968-19453990 GAAAATGTAAAAAATTAGCCAGG + Intergenic