ID: 1149724142

View in Genome Browser
Species Human (GRCh38)
Location 17:58875679-58875701
Sequence TGTGATTGTCTGTGAATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149724142_1149724144 19 Left 1149724142 17:58875679-58875701 CCTGTGATTCACAGACAATCACA 0: 1
1: 0
2: 2
3: 16
4: 191
Right 1149724144 17:58875721-58875743 ATATTTAGTAACTATTTGAAAGG 0: 1
1: 1
2: 3
3: 46
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149724142 Original CRISPR TGTGATTGTCTGTGAATCAC AGG (reversed) Intronic
900925733 1:5705108-5705130 TGTGATGTTCTAAGAATCACCGG - Intergenic
901711101 1:11115786-11115808 TGGGCTTATGTGTGAATCACAGG + Intronic
902221726 1:14970376-14970398 TGTGTTGGACTGTGAGTCACGGG - Intronic
902987622 1:20164738-20164760 TGAGAATGTGGGTGAATCACGGG - Intronic
904170071 1:28585485-28585507 TGTGATTGTCTGTGATATTCAGG - Intergenic
904331680 1:29761858-29761880 TGTGCTTGTATGTGAGCCACAGG + Intergenic
904656960 1:32056160-32056182 GGTGATTGTCTTTGCATCTCAGG + Intronic
905225948 1:36479324-36479346 TGGGATTCTCTGGGAATCCCAGG + Intronic
907275231 1:53313316-53313338 TGTGGTTTTCTGTGAGTCCCTGG - Intronic
907506646 1:54923924-54923946 TGTGACTCTCTGCTAATCACTGG + Intergenic
911359623 1:96861016-96861038 TGTATTTGTTTGGGAATCACTGG + Intergenic
914008139 1:143751381-143751403 TGAGATTTTCTGTTTATCACTGG + Intergenic
914455963 1:147836599-147836621 TATGATTGTCAGTAAATCCCAGG - Intergenic
918465947 1:184821863-184821885 TGTGTGTGTCTGTGTATCTCTGG - Intronic
919096607 1:193044531-193044553 TGTGTGTGTCTGTGTATCATTGG - Intronic
920201750 1:204263753-204263775 TGTGTGTGTCTGTGTATAACAGG + Intronic
922578220 1:226677490-226677512 TGGGCTTGTCTGAGATTCACAGG - Intronic
1063815435 10:9766530-9766552 TGTGTGTGTGTGTGATTCACAGG + Intergenic
1064100477 10:12459570-12459592 AGTCATTGTCTGAGAATCCCAGG + Intronic
1068245109 10:54355583-54355605 TCAGATTGTCTGTGAATCTTGGG - Intronic
1070001742 10:72383356-72383378 ATTGATTGTCTCTGAATGACTGG - Intronic
1070158208 10:73849431-73849453 AGTGATTCTCTGTGAATCCGTGG - Intronic
1071037943 10:81269916-81269938 TTTGATTTTATGTAAATCACTGG + Intergenic
1071155746 10:82686918-82686940 TGTAAATGTCAGTGAATAACGGG + Intronic
1073682217 10:105716904-105716926 TCTTATTGTCTGTGCATCATAGG - Intergenic
1074215881 10:111383299-111383321 TATGATTCTCAGTGAATCTCTGG + Intergenic
1075675892 10:124295600-124295622 TGTGTGTGTCTGTGACTCAGTGG - Intergenic
1076611645 10:131729667-131729689 TAGGATTGTCTGTGGATAACAGG - Intergenic
1080216052 11:29842315-29842337 TGTTCTTGTCTCTGAGTCACTGG + Intergenic
1080629150 11:34057302-34057324 TGTGTTTGTATGTGTAGCACTGG + Intronic
1083137740 11:60694866-60694888 TGTGTTTGCCTGGGTATCACTGG - Intergenic
1083620599 11:64047512-64047534 TGTGATCCTCTGTGAATGCCAGG - Intronic
1083665348 11:64271199-64271221 TGTGTGTGTGTGTGAGTCACAGG - Intronic
1083665364 11:64271373-64271395 TGTGTGTGTGTGTGAGTCACAGG - Intronic
1084326915 11:68405839-68405861 TGGGAATGTCTGTGAATCGGAGG + Intronic
1086500872 11:87452235-87452257 TGTGATAATTGGTGAATCACTGG + Intergenic
1086508933 11:87534682-87534704 TGTGATAATTGGTGAATCACTGG + Intergenic
1088177259 11:107067633-107067655 TGTAAGTGTCTGTGCATCATAGG - Intergenic
1090119638 11:124012662-124012684 TGTGAGTGTCTCTCAATCACTGG + Intergenic
1090120320 11:124020229-124020251 TATGAGTGTCTCTCAATCACTGG + Intergenic
1091098677 11:132848980-132849002 TGTGATTGTGTGTGAAGCCAAGG - Intronic
1091527563 12:1318627-1318649 TGTAATTGTGTGAGAAGCACTGG + Intronic
1091715273 12:2772251-2772273 TGTGATGGTCTGTGACCCAAAGG - Intergenic
1094147432 12:27244634-27244656 TGTTATTGTTTGTGAAGCCCAGG - Intronic
1094796858 12:33984322-33984344 TGTGATCCTCTGTGCCTCACAGG - Intergenic
1095052453 12:37566765-37566787 TGTGATTGGCTGTGAGGCAGAGG + Intergenic
1097320240 12:58217699-58217721 GGTGTTTGTCTGTGACTGACTGG - Intergenic
1100251086 12:92824613-92824635 TGTTCTTCTCTCTGAATCACAGG + Intronic
1103272078 12:119681762-119681784 TGTGAATGGGTGTGAGTCACAGG - Intergenic
1106872819 13:34039920-34039942 TGTGTTTGTCTGTGAGTAAAAGG - Intergenic
1106883306 13:34155734-34155756 CCTGATTGTGTGTGAGTCACAGG - Intergenic
1108162665 13:47658231-47658253 TGTGATTGTCTCTGCAACCCTGG + Intergenic
1110720525 13:78756044-78756066 TTTGGTTTTCTGGGAATCACTGG + Intergenic
1111268656 13:85852634-85852656 GGTGATTGTCTTTGAATTACAGG - Intergenic
1112309526 13:98305929-98305951 TGTGATTCTGGGCGAATCACTGG + Intronic
1113489050 13:110677505-110677527 TGTGATTGTCTGGGTCTCCCTGG - Intronic
1113489083 13:110677652-110677674 TGTGATTGTCTGGGTCTCCCTGG - Intronic
1115062702 14:29212746-29212768 TGTGATTGTGTGTGTATGGCTGG - Intergenic
1115071353 14:29326182-29326204 TCTGCTTGTCTATGAATTACTGG - Intergenic
1120400592 14:84025746-84025768 TGTGATAGTGAGTGAATCTCAGG - Intergenic
1121843961 14:97156999-97157021 AGTGATTGTGTGTGAATCATGGG + Intergenic
1130757155 15:86776708-86776730 TTTTATTCTCTGTGAATCAATGG + Intronic
1131230654 15:90656457-90656479 TGTGTTTCTCTGTGAACCGCAGG - Intergenic
1138118395 16:54378713-54378735 TGTGATTTCCTTTGAATCTCTGG + Intergenic
1140329520 16:74040480-74040502 TGTGATTGACTTGGATTCACTGG + Intergenic
1143523251 17:7457851-7457873 TAGGATTGTCTGGGGATCACAGG + Intergenic
1144514832 17:15910129-15910151 TGTCATTCTCAGTGACTCACTGG - Intergenic
1145127701 17:20315568-20315590 TGTCATTCTCGGTGACTCACTGG - Intronic
1146775706 17:35613409-35613431 TGTGATTCTCTGCAAAACACAGG - Intronic
1149686124 17:58535986-58536008 TGTCTTTGTATGTGAACCACGGG - Intronic
1149724142 17:58875679-58875701 TGTGATTGTCTGTGAATCACAGG - Intronic
1150417394 17:64998528-64998550 TGTGGTTGGCTGAGCATCACAGG - Intergenic
1153490780 18:5645909-5645931 TTTGATTGTATGTCAAACACGGG - Intergenic
1154369770 18:13749182-13749204 TGTGATTATCTGCTTATCACTGG - Intronic
1156460921 18:37320873-37320895 TGTGATGGGCTCTGTATCACTGG + Intronic
1157150912 18:45216823-45216845 TTTGATTCTCTGAGAATCAAAGG - Intronic
1157300504 18:46475645-46475667 TGTGCCTGTATGTGAATCACTGG - Intergenic
1157880625 18:51317996-51318018 TCTGAGTGTCTGTGTATCTCTGG - Intergenic
1158248564 18:55460418-55460440 TGAGGCTGTCTGTGAATCTCCGG - Intronic
1158931985 18:62331630-62331652 TGTGACTCTCTGGGGATCACTGG - Intronic
1159376670 18:67602470-67602492 TGTGTTTGTGTGTGAAGCAAAGG + Intergenic
1159795983 18:72844456-72844478 TAAAATTGTCTGTGAATCACTGG + Intronic
1160523038 18:79519866-79519888 TGTGCTTGGCTGTGACTAACAGG - Intronic
1163373757 19:16917218-16917240 TGTGTTTGTTTATGAATAACAGG - Intronic
1163631041 19:18417958-18417980 TGTGTTTGTGTGTGAATGTCTGG - Intergenic
1164293702 19:23890191-23890213 TGACATTGTCTGTGACACACTGG - Intergenic
1165283526 19:34817809-34817831 TGTGAATGTGTGTGAATTACTGG - Intergenic
1165570668 19:36772344-36772366 TGTGATTGGCTGTGAGGCAGTGG - Intronic
1167575926 19:50317346-50317368 CCTGAATGTCTGTGAAACACAGG + Intronic
1168456888 19:56519209-56519231 TCTGATTGCCTCTGAGTCACAGG + Intronic
925452939 2:3986275-3986297 TCTGCTTGTCTTTGAATCATGGG + Intergenic
926650141 2:15334693-15334715 TGTAATTGTCTTTGCATCATGGG - Intronic
928240855 2:29584450-29584472 TGTGCCTGTCTGAGAGTCACAGG - Intronic
928914876 2:36459917-36459939 TGGGATTGTCTGTGAAGTCCAGG + Intronic
932940196 2:76155169-76155191 TGTAATTGTCTTTCAAACACTGG + Intergenic
933881627 2:86675528-86675550 TAAGATTGGCTGTGAATCATTGG + Intronic
935023941 2:99258129-99258151 TGTCATTATTTGTGAATCCCAGG + Intronic
937656264 2:124380462-124380484 TGTAATTCTCTGGAAATCACAGG + Intronic
938396607 2:130954749-130954771 TGTGTCTGTCTGTGGATCTCTGG + Intronic
938840836 2:135161034-135161056 TTTGTTTTTCTGTGAATCAGGGG + Intronic
939859403 2:147399454-147399476 TGTTATTTTCTCTGAATCAATGG + Intergenic
941126757 2:161593530-161593552 TGTGTGTGTCTGTGTATCTCAGG - Intronic
941590799 2:167417741-167417763 TATAATAGTCTGTGACTCACTGG - Intergenic
942078510 2:172379271-172379293 TGGCATTGTCTTTGAATCCCTGG + Intergenic
943261213 2:185665913-185665935 TCTGAAGGTCTGAGAATCACAGG - Intergenic
945123952 2:206487977-206487999 TCTGATTTTCTGGGAATCAGAGG + Intronic
945421541 2:209643352-209643374 TGTGATTATGTGGGAATCCCAGG + Intronic
947437171 2:230082767-230082789 TGTGATTCTCTGTGCAGCACAGG + Intergenic
948107036 2:235422548-235422570 TGTGAATGTGTGTGTGTCACAGG - Intergenic
1173077161 20:39830085-39830107 TGTGCTTCTCTGTGCATCATGGG + Intergenic
1177324891 21:19572711-19572733 TGTGCTTGTCTCTGAACTACCGG - Intergenic
1177926988 21:27229642-27229664 TGTAAGTTTCTCTGAATCACTGG + Intergenic
1178893676 21:36541924-36541946 TGTGGGTGTGTGTGAACCACTGG + Intronic
949288943 3:2440584-2440606 TGTGTTTGTCTTTGAATGATGGG + Intronic
952060321 3:29500849-29500871 TGTGTGTGTGTGTGTATCACAGG + Intronic
952404422 3:32992812-32992834 TCTGGTTGTCTGTGAATGCCCGG - Intergenic
952583616 3:34864858-34864880 TGTGAATTTCTGTGAGTCTCTGG + Intergenic
952882914 3:37996565-37996587 TGGGATTGTCTCTGTGTCACAGG - Intronic
953802513 3:46036045-46036067 GGTGATTGTGTGTGTATCATGGG + Intergenic
954905922 3:54062720-54062742 TGTGAGTGTATGTGACTCAATGG + Intergenic
955252557 3:57298882-57298904 TGTGATTATCTTTTTATCACAGG + Intronic
959669836 3:108963986-108964008 TGTCATTGCCTGTGAATTACTGG - Intronic
962167352 3:133063331-133063353 TCTGATTTTGTGTGAATCAAAGG + Intronic
962917787 3:139921450-139921472 TGTGTTTGTGTGTGAAAGACAGG - Intergenic
962934441 3:140066773-140066795 TGTGAGTGTCTGTGAGTGAAAGG - Intronic
963104380 3:141633514-141633536 TGTAAAAGTTTGTGAATCACTGG - Intergenic
963801270 3:149678453-149678475 TGTCATGTTCTGTTAATCACAGG + Intronic
964709785 3:159659389-159659411 TGTGAATGTGTGAGAATCACTGG + Intronic
965201836 3:165668990-165669012 TCAGATTGTTTGTGCATCACAGG - Intergenic
965902701 3:173662594-173662616 TTTGATTTTCTGTGAATCTTTGG + Intronic
966444992 3:179992056-179992078 TGTGAGGGTCTGTGAGTCATAGG + Intronic
967560312 3:190910151-190910173 TGCGCTTGCCTGTTAATCACTGG - Intergenic
969208378 4:5665991-5666013 TGACATTTTCTGAGAATCACAGG + Intronic
969986293 4:11214543-11214565 TGTGAATGTAGGTGTATCACAGG + Intergenic
972163146 4:36249530-36249552 TGTGACTATCAGTGAATCAATGG - Intergenic
972366661 4:38382150-38382172 AGTGATTTTCTGTGAATAGCTGG + Intergenic
973240304 4:47949353-47949375 TGTGATTCTCTGGGGATCCCTGG - Intronic
973331415 4:48913471-48913493 TGAGAGGCTCTGTGAATCACAGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975066200 4:70066848-70066870 TGTGTTTGTATGAGAATCACAGG + Intergenic
976942041 4:90714197-90714219 TGTGATTGTCTTTGAATAGTTGG + Intronic
978579260 4:110216227-110216249 TGTGATGGTCTGTGATTCTGAGG + Intergenic
980637110 4:135520666-135520688 TGTGATAGTATATAAATCACAGG - Intergenic
982159247 4:152551175-152551197 TGTGTGTGTGTGTGTATCACAGG - Intergenic
986257112 5:6109640-6109662 TGTGATTATCTGTGATTCATAGG - Intergenic
987417033 5:17672745-17672767 TCTGATTGTCAGTGAGTCAAAGG + Intergenic
987585855 5:19855264-19855286 TCTGAAAGTCTGTGAATCATTGG - Intronic
990705829 5:58528460-58528482 TGTGATTTTCTGTGAGCAACTGG + Intergenic
991960593 5:72040114-72040136 TGTGTTTGTTTTTTAATCACAGG + Intergenic
992946071 5:81811667-81811689 TGTGATTGGCATTAAATCACTGG + Intergenic
996444434 5:123528872-123528894 TGTACGTGTCTGTGAATGACTGG - Intronic
996606812 5:125332651-125332673 TGAGGTTGTCTGTGAAGAACTGG + Intergenic
997673100 5:135692405-135692427 TTTGATTCTCTGTGAAACACTGG - Intergenic
998744284 5:145239392-145239414 TGTAATTGTCTGTTTATCCCAGG - Intergenic
999241909 5:150132811-150132833 TGCGGTTGTCTTTGAACCACAGG + Exonic
1006746568 6:36346950-36346972 TGTGTGTCTCTGTGAATCTCAGG - Intergenic
1009602892 6:65825873-65825895 TGTTATTGTGTGTGAATATCCGG + Intergenic
1010144650 6:72653000-72653022 TGTGATTGTCTGTGAATAAATGG - Intronic
1011543641 6:88461156-88461178 ATTGATAGTCTGAGAATCACAGG - Intergenic
1013724123 6:113071382-113071404 TGAAATTTTCTGTGAATCTCAGG + Intergenic
1013740168 6:113274048-113274070 TGTAATTGTCTTTAAATCGCAGG - Intergenic
1015206369 6:130644414-130644436 TGAGATTATGTGAGAATCACTGG + Intergenic
1015886096 6:137920261-137920283 TTTGAGTGTTTGTGAAACACTGG + Intergenic
1020906015 7:14065595-14065617 TGTAATTGTCTCTGAAAGACTGG - Intergenic
1026389651 7:69887593-69887615 TGTGATAGTATGTGAATACCTGG + Intronic
1026610441 7:71854761-71854783 TGTGAGTGTCTGTCAGTCAGTGG + Intronic
1031374387 7:121006466-121006488 TGTGAGTGTCTGAGAAAGACAGG + Intronic
1031534023 7:122911748-122911770 TGTGATGGCCTGTAAATCACAGG - Intergenic
1031960989 7:127989675-127989697 TATGTGTGTCTCTGAATCACTGG - Intronic
1032080611 7:128856731-128856753 TGTGCTTGTCTGTGGATAAAGGG - Exonic
1032198355 7:129802386-129802408 TGTCATTGTGTGAGCATCACAGG - Intergenic
1033657711 7:143384243-143384265 TCTGAGTGCCTGTGACTCACAGG - Intronic
1033998414 7:147382498-147382520 TGTCATTGTCTCTATATCACTGG - Intronic
1034463721 7:151213306-151213328 TGTTAAAGTCTGTGAATCACAGG + Intronic
1035236969 7:157503759-157503781 TGTGATTGTGTGTGATTTCCAGG - Intergenic
1039674401 8:39644601-39644623 TGTGATTGTGTCTGACTCTCTGG + Intronic
1039772668 8:40703553-40703575 AGTGATTGTCTAGGAATCAGAGG + Intronic
1039855033 8:41404517-41404539 TGTGATTATCTGTGAGTGACAGG + Intergenic
1041628960 8:60063205-60063227 TGTAATTGCCAGGGAATCACAGG - Intergenic
1044075290 8:87813948-87813970 AGTGGTTCTCTGTGAAGCACTGG - Intergenic
1044867630 8:96587829-96587851 TATTATTATGTGTGAATCACAGG + Intronic
1045962306 8:107982525-107982547 TGTGTGTGTCTGTGAGTGACAGG - Intronic
1048452927 8:134549835-134549857 TGTGACTGTCAGTGGGTCACGGG - Intronic
1053797804 9:41741929-41741951 TGTGATTGGCTGTGAGGCAGAGG - Intergenic
1054147385 9:61573028-61573050 TGTGATTGGCTGTGAGGCAGAGG + Intergenic
1054186217 9:61953982-61954004 TGTGATTGGCTGTGAGGCAGAGG - Intergenic
1054467131 9:65504066-65504088 TGTGATTGGCTGTGAGGCAGAGG + Intergenic
1054652286 9:67634541-67634563 TGTGATTGGCTGTGAGGCAGAGG + Intergenic
1057514283 9:95708292-95708314 TGTGAGTGGCTTGGAATCACGGG - Intergenic
1060690916 9:125659387-125659409 TGTGAATGTCTGAGAATGAAAGG - Intronic
1185891155 X:3823419-3823441 TGTGAGTGTATGTGAATGAGTGG + Intronic
1185896261 X:3861835-3861857 TGTGAGTGTATGTGAATGAGTGG + Intergenic
1185901380 X:3900261-3900283 TGTGAGTGTATGTGAATGAGTGG + Intergenic
1186188818 X:7049084-7049106 AGTGATTGTCTGTGAATGACAGG - Intronic
1188440554 X:30211653-30211675 TGTTATTTTGTGTGGATCACAGG - Intergenic
1188731748 X:33655940-33655962 AGTAATTTTCTGTGAATCATAGG - Intergenic
1189057757 X:37716480-37716502 TGTGAGTGTCTGTGGTTCAAGGG + Intronic
1189952758 X:46249157-46249179 TGTGTTTACCTCTGAATCACCGG - Intergenic
1193037137 X:76964051-76964073 TGTGAATGCCTGTGAATCAGTGG + Intergenic
1193083494 X:77427783-77427805 TGTGTTTTTCTCTGAGTCACTGG - Intergenic
1193902122 X:87193511-87193533 TGGGATAGTTTGAGAATCACTGG - Intergenic
1194037629 X:88897812-88897834 TGTATTTGGCTGGGAATCACTGG - Intergenic
1194368659 X:93042269-93042291 TGTGTTTGTTTGTGTAGCACTGG + Intergenic
1195278420 X:103306400-103306422 TATGATTGTCTCTGACTTACTGG - Intergenic
1197096085 X:122597241-122597263 TTTAATTGTCTTTGCATCACTGG - Intergenic
1199707744 X:150445377-150445399 AGTGAAAGTCTGTGATTCACGGG + Intronic
1200676859 Y:6158596-6158618 TGTGTTTGTCTGAGTAGCACTGG + Intergenic
1201338072 Y:12902195-12902217 TGTGAATGTCCCTGAATTACAGG - Intergenic
1201510841 Y:14760417-14760439 TATGATTGTGTGTGAAAAACTGG - Intronic
1201567381 Y:15380733-15380755 TGGTAGTGTCTGTGAATCTCAGG - Intergenic