ID: 1149724259

View in Genome Browser
Species Human (GRCh38)
Location 17:58877217-58877239
Sequence GGTACCAAGGCTACCTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149724259_1149724264 21 Left 1149724259 17:58877217-58877239 CCAACATAGGTAGCCTTGGTACC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1149724264 17:58877261-58877283 TTTCCTCATTGTTAATGAAAAGG 0: 1
1: 0
2: 1
3: 56
4: 411
1149724259_1149724266 27 Left 1149724259 17:58877217-58877239 CCAACATAGGTAGCCTTGGTACC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1149724266 17:58877267-58877289 CATTGTTAATGAAAAGGATAAGG 0: 1
1: 0
2: 2
3: 29
4: 287
1149724259_1149724262 -7 Left 1149724259 17:58877217-58877239 CCAACATAGGTAGCCTTGGTACC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1149724262 17:58877233-58877255 TGGTACCTCATTAGGTAAAGTGG 0: 1
1: 0
2: 2
3: 6
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149724259 Original CRISPR GGTACCAAGGCTACCTATGT TGG (reversed) Intronic
915347056 1:155202866-155202888 AGTACCCAGGCTACCGCTGTGGG - Exonic
1070789948 10:79183053-79183075 AGTACCAAGTCAACCTAGGTTGG + Intronic
1072426502 10:95334912-95334934 TGTGCCAAGGCTCCATATGTGGG - Intronic
1085708058 11:78804596-78804618 GGTACAAAGGATAATTATGTTGG - Intronic
1090658956 11:128867461-128867483 GCTACCAAGGCTAACTAAGAAGG + Intergenic
1103924281 12:124414994-124415016 GGCACCCAGGGTACCTCTGTGGG - Intronic
1109927011 13:69156775-69156797 TGTACCAATGATACTTATGTTGG - Intergenic
1129359743 15:75017327-75017349 TGTACCAAGGCTATCTGTCTTGG + Intronic
1129446463 15:75622313-75622335 GGTTTCAGGGCTACTTATGTGGG + Intronic
1140208121 16:72949987-72950009 GGTACCCAGTGTACATATGTTGG + Intronic
1149724259 17:58877217-58877239 GGTACCAAGGCTACCTATGTTGG - Intronic
1162033999 19:7929525-7929547 GTTACCAGGGTTACCTCTGTGGG + Intronic
1167793711 19:51695668-51695690 TGTAACAAGGCAGCCTATGTGGG - Intergenic
929824660 2:45300812-45300834 GGCAACAAGGCTTCCCATGTAGG + Intergenic
932618028 2:73248286-73248308 GTTACCCAGGCTACCTCTGGAGG + Intronic
933222588 2:79707467-79707489 GTTACCAAAGCTACATCTGTTGG - Intronic
934671279 2:96214754-96214776 GATGCCAAGGCCAACTATGTAGG - Intergenic
937678760 2:124621659-124621681 GGAAGCAAGGCTACCAATTTAGG - Intronic
939003655 2:136762946-136762968 AGAACCAAAGCTAACTATGTTGG + Intergenic
947579993 2:231309298-231309320 GTTTCCAAGGCAACCGATGTTGG - Intronic
1169412508 20:5383430-5383452 GGCCCCAAGGCAACATATGTTGG - Intergenic
1173319814 20:41977261-41977283 GGTACCAGAACTACCTATGTGGG - Intergenic
1174032240 20:47639129-47639151 GTTACCAAAGCAACCCATGTTGG + Exonic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
970350290 4:15195373-15195395 GTTGACAAGGCTACCTCTGTGGG + Intergenic
973652933 4:53014832-53014854 TGTACCAAAGCAAGCTATGTAGG - Intronic
974531019 4:63107891-63107913 GCCACCAAGGCTGCGTATGTGGG + Intergenic
978416249 4:108479697-108479719 GGTGCCCATGCTTCCTATGTGGG + Intergenic
978763630 4:112381797-112381819 GGTACCAAGTCTACTTATAATGG - Intronic
982736201 4:159009485-159009507 TGTACCAAGACTAGCAATGTTGG + Intronic
984710563 4:182880765-182880787 GGTACCATGGCTGCCTGTGACGG + Intergenic
990920609 5:60961847-60961869 GCTACCAAAGCTTCCTAAGTAGG - Intronic
992046326 5:72893970-72893992 GGTACCAAGGCTTCCCTGGTGGG - Intronic
992529400 5:77640507-77640529 GCTACCAACGCGGCCTATGTGGG + Intergenic
1024317735 7:48036602-48036624 AGAACCAAGGCTACCTATCTTGG + Intronic
1036766104 8:11550254-11550276 GCCACCAAGCCTACCTTTGTTGG - Exonic
1037914464 8:22764479-22764501 GGGACCAAGGCTGGCTTTGTGGG + Intronic
1041864030 8:62548042-62548064 GGTACAAACGCAACCTCTGTTGG + Intronic
1044637684 8:94342715-94342737 GGTACCAGGGCAACATATTTTGG + Intergenic
1051982050 9:23031931-23031953 GGTAGCAATGCCACCTATGGTGG - Intergenic
1055607212 9:77983393-77983415 GGTACTGAGGCTACCCATGGAGG - Intronic
1060151576 9:121292286-121292308 GGTAGCAAGGCTGGCTCTGTAGG + Intronic
1187752638 X:22484383-22484405 GGTGCCAAGGAAATCTATGTAGG + Intergenic
1200821650 Y:7590484-7590506 GGCACCAACGATACCTTTGTGGG + Intergenic
1200876706 Y:8163894-8163916 GGCACCAACGATACCTTTGTGGG + Intergenic
1202238655 Y:22742270-22742292 GGCACCAACGATACCTTTGTGGG - Intergenic