ID: 1149725049

View in Genome Browser
Species Human (GRCh38)
Location 17:58884751-58884773
Sequence GGGGATAATACTTCCTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149725048_1149725049 -7 Left 1149725048 17:58884735-58884757 CCTCATCTGTAACATGGGGGATA 0: 1
1: 7
2: 74
3: 470
4: 2576
Right 1149725049 17:58884751-58884773 GGGGATAATACTTCCTTTGTAGG 0: 1
1: 0
2: 0
3: 43
4: 314
1149725043_1149725049 1 Left 1149725043 17:58884727-58884749 CCTATTTTCCTCATCTGTAACAT 0: 1
1: 5
2: 126
3: 619
4: 2035
Right 1149725049 17:58884751-58884773 GGGGATAATACTTCCTTTGTAGG 0: 1
1: 0
2: 0
3: 43
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149725049 Original CRISPR GGGGATAATACTTCCTTTGT AGG Intronic
900812366 1:4816592-4816614 GGGGACTAGACTGCCTTTGTAGG + Intergenic
900848900 1:5126468-5126490 GGGGACTAAACTGCCTTTGTAGG + Intergenic
901254257 1:7807647-7807669 GGGGATAATTCCTACTTTCTGGG + Intronic
903832105 1:26181746-26181768 GGGGATAATACCTGCTCTGATGG - Intronic
904154997 1:28475513-28475535 GGGAATAATATTTACTCTGTAGG + Intronic
904593951 1:31631301-31631323 GGGGATAATACTTAACTTGTAGG + Intronic
905475577 1:38224895-38224917 GGGGACTAGACTGCCTTTGTAGG - Intergenic
905578283 1:39063435-39063457 GGGGAGAATGCTTCCTTGCTAGG - Intergenic
905631977 1:39524068-39524090 TATGATAATACTTCCTTTCTGGG + Intronic
906486469 1:46239208-46239230 GGGGATAAGTCTGCCTTTGAGGG - Intergenic
906823408 1:48953027-48953049 GGTGATAGTTCTTCCTTTCTAGG + Intronic
907036676 1:51222226-51222248 GGGGACTAGACTGCCTTTGTAGG + Intergenic
907120977 1:52007675-52007697 GGGGACTAGACTGCCTTTGTAGG - Intergenic
907196617 1:52692434-52692456 GGAAATAGTACTTGCTTTGTAGG - Intronic
907721859 1:56979638-56979660 GGGGATAATGCTATCTTTCTGGG + Intergenic
908388798 1:63666984-63667006 GGGGACTAGACTGCCTTTGTAGG - Intergenic
908657536 1:66403899-66403921 GGTGATAATACCTACTTTATGGG - Intergenic
908761632 1:67518116-67518138 GGGGAATAGACTGCCTTTGTAGG + Intergenic
911011616 1:93287258-93287280 GGGCTAAATACTCCCTTTGTGGG - Intergenic
912014679 1:105017921-105017943 GGGGACTAGACTGCCTTTGTAGG - Intergenic
912585124 1:110756166-110756188 GGGGCTAAAGTTTCCTTTGTGGG + Intergenic
912974499 1:114315647-114315669 GGGGATAATAATGCTTTTCTAGG - Intergenic
913395479 1:118366285-118366307 TGAGATACTACTTCCTTTTTAGG - Intergenic
914672089 1:149878496-149878518 GGGGGTAATATTTACTTTTTTGG + Intronic
915658017 1:157377574-157377596 TGGGATAATACCTCCTCTGCAGG - Intergenic
915670998 1:157489075-157489097 TGGGATAATACTTCCTCTGCAGG + Intergenic
917695964 1:177524436-177524458 GGGGACAATTCTTCATTTGTAGG + Intergenic
917726084 1:177828716-177828738 TGGGATAATATCTGCTTTGTAGG - Intergenic
918203603 1:182289788-182289810 TGGGAAAATACTACCTTTCTAGG + Intergenic
918400296 1:184156257-184156279 GGGGACAAGACAGCCTTTGTGGG - Intergenic
918623623 1:186633525-186633547 GGGGACTAGACTGCCTTTGTAGG + Intergenic
918990930 1:191696269-191696291 GGGGACTAGACTGCCTTTGTAGG + Intergenic
920785358 1:209035461-209035483 GGGGATAGTACTTCCCTTTCAGG + Intergenic
921569224 1:216758928-216758950 GGGGATAATAATACCTTCTTAGG - Intronic
921647412 1:217634654-217634676 GGGGACTAGACTGCCTTTGTTGG - Intronic
923387185 1:233476808-233476830 GGGGACTAGACTGCCTTTGTAGG + Intergenic
923483678 1:234408446-234408468 GGGGACTAGATTTCCTTTGTAGG + Intronic
924512157 1:244736573-244736595 GGGGACTAGACTGCCTTTGTAGG - Intergenic
924512587 1:244740020-244740042 GGGGACTAGACTGCCTTTGTAGG + Intergenic
924807797 1:247375054-247375076 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1064625408 10:17256322-17256344 GGTGATAATGCTTTATTTGTAGG - Intergenic
1064708805 10:18101260-18101282 GGGGATAGTACTTGCTTTGCAGG - Intergenic
1064766960 10:18684896-18684918 GGTGACTAGACTTCCTTTGTGGG + Intergenic
1064804904 10:19119742-19119764 GGGGACTAGACTGCCTTTGTAGG - Intronic
1065613426 10:27496104-27496126 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1067758397 10:49024589-49024611 AGAGATAATACCTACTTTGTTGG + Intronic
1068526717 10:58138619-58138641 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1069303922 10:66944603-66944625 TTGGATAATAATTCCTTTGATGG - Intronic
1070087113 10:73248036-73248058 GGGGATAAAACTTTGTTAGTAGG + Exonic
1071576840 10:86733472-86733494 TGGAATAACACTTCCTTTTTTGG - Exonic
1073759086 10:106611354-106611376 GTGGATAATAATTCCTTTTTGGG + Intronic
1073985198 10:109200297-109200319 GTTGATAATAATTCCTTTCTTGG - Intergenic
1075489032 10:122850347-122850369 GGGGATAGCACTTCCTCAGTGGG - Intronic
1077927240 11:6693904-6693926 GGGGACTAGACTGCCTTTGTGGG + Intergenic
1078410933 11:11117095-11117117 GGGGATAATTCTTCCTTCACTGG + Intergenic
1078551656 11:12285400-12285422 GGGGACAAGACTGCCTTTGCAGG - Intronic
1079331270 11:19534950-19534972 GTGGTTAATATTTCCATTGTAGG + Intronic
1079892486 11:26074166-26074188 GATCATAATACTTACTTTGTTGG + Intergenic
1080169751 11:29285931-29285953 GAGGTTAAAACTTCCTTTCTTGG + Intergenic
1081260682 11:40956537-40956559 GGGGATAATATTACCTTTCTAGG + Intronic
1083198304 11:61104220-61104242 GGAGATAATCCTGCCTTTGGAGG - Intronic
1085505727 11:77057754-77057776 GGGGACCAGACTGCCTTTGTAGG - Intergenic
1086527456 11:87744817-87744839 GGGGCTGAAAGTTCCTTTGTGGG + Intergenic
1087050491 11:93881971-93881993 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1087797876 11:102473385-102473407 GGGGACTAGACTGCCTTTGTAGG - Intronic
1087870564 11:103288502-103288524 GGGGATAAGTCTGCCTTTGTAGG + Intronic
1089376818 11:118000364-118000386 GGGGATGCTACTCCATTTGTTGG - Exonic
1089860168 11:121583162-121583184 GGGAATAATCCTTACCTTGTAGG + Intronic
1089910481 11:122094422-122094444 GAGAATATTAGTTCCTTTGTTGG - Intergenic
1089986449 11:122818652-122818674 GGGGACTATACTGCCTTTGTAGG + Intergenic
1091153800 11:133354432-133354454 GGGGATAATATCTCCTTTATAGG - Intronic
1091467969 12:702130-702152 GAGAATAATACTTCCATTGTTGG + Intergenic
1093727069 12:22526364-22526386 GGGGATGATACTACCTTATTGGG - Intronic
1094430990 12:30368947-30368969 GGGGATTAGATTGCCTTTGTAGG - Intergenic
1094603452 12:31930703-31930725 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1095202892 12:39406270-39406292 TGTGATTATACCTCCTTTGTGGG + Intronic
1095267724 12:40179992-40180014 GGGGATTAGATTGCCTTTGTAGG + Intergenic
1095461039 12:42444813-42444835 GGGGAGGAAACTACCTTTGTAGG - Intronic
1095515521 12:43000885-43000907 GAGGATAATGCTTACTTTGCAGG - Intergenic
1096939632 12:55328007-55328029 GGGGAATAGACTGCCTTTGTAGG + Intergenic
1097293482 12:57940271-57940293 AGAGATAATACTTACTTTGCAGG + Intergenic
1097340690 12:58434408-58434430 GAGGACTAGACTTCCTTTGTAGG - Intergenic
1097497835 12:60364537-60364559 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1097849728 12:64399951-64399973 GGGGACTAGACTACCTTTGTAGG + Intergenic
1098295408 12:68999228-68999250 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1098574761 12:72028585-72028607 GGTGACATTACTTCATTTGTTGG + Intronic
1098623409 12:72634126-72634148 GGGGATAATAATTCCTTACAGGG - Intronic
1099928090 12:89041952-89041974 GGAGATAATACTTTCTTCATTGG + Intergenic
1100294623 12:93249140-93249162 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1100454090 12:94734812-94734834 AGGCATAATACTTACTTTGTAGG - Intergenic
1101060007 12:100960990-100961012 AGAGAAAATACTCCCTTTGTAGG - Intronic
1101107657 12:101455903-101455925 GGGGTTGGTACTTCCTCTGTGGG - Intergenic
1101148981 12:101867337-101867359 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1101987832 12:109461336-109461358 TGGGATAGGACTTCCTGTGTTGG - Intronic
1102802897 12:115752043-115752065 GTGGATCATAGGTCCTTTGTTGG - Intergenic
1104182444 12:126395680-126395702 TGGGGTAACACATCCTTTGTTGG - Intergenic
1106009539 13:25806029-25806051 GGAGATCATTCTTCATTTGTTGG + Intronic
1107698268 13:43021963-43021985 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1107868534 13:44726809-44726831 GGGGACAAGACTACCCTTGTAGG + Intergenic
1108423872 13:50278316-50278338 GGGGACTAGACTGCCTTTGTGGG - Intronic
1109163021 13:59000145-59000167 GGGGATTAGACTGCCTTTGCAGG - Intergenic
1109300323 13:60584244-60584266 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1109958888 13:69605156-69605178 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1112196123 13:97228167-97228189 GGGGATAGTATTAACTTTGTGGG - Intronic
1114697079 14:24635635-24635657 GGGGAAAATGCTTAATTTGTAGG - Intergenic
1115882117 14:37931238-37931260 GGGGATAATACTTCCTACATAGG + Intronic
1115999599 14:39228788-39228810 GGGGATGTTACATCCTTTGTTGG + Intergenic
1116868774 14:50052287-50052309 GGGGATAATACTTGCCCAGTCGG + Intergenic
1117249031 14:53916784-53916806 GGGGAAAATGCTGCCTTTGCAGG + Intergenic
1118209625 14:63753294-63753316 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1120556725 14:85937374-85937396 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1120970617 14:90204105-90204127 GGGGATTAGATTGCCTTTGTAGG - Intergenic
1122014705 14:98784904-98784926 GGTGATAATACTTTCCATGTAGG + Intergenic
1124603668 15:31154630-31154652 GGGGACTAGACTGCCTTTGTAGG + Intronic
1125395134 15:39239042-39239064 GGGGATAAGACTTCCTTGGAGGG - Intergenic
1125690706 15:41593931-41593953 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1126073114 15:44883185-44883207 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1126085148 15:45004454-45004476 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1127086151 15:55426333-55426355 GGGGATTAGACTGCCTTTGTAGG - Intronic
1128687763 15:69699485-69699507 GTGGACAATACTTCCTTTCTAGG + Intergenic
1129378417 15:75150019-75150041 GGGGACCAGACTGCCTTTGTAGG + Intergenic
1129381251 15:75168805-75168827 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1129473869 15:75770189-75770211 GGAGAAGATGCTTCCTTTGTGGG + Intergenic
1130833890 15:87630661-87630683 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1132275965 15:100564185-100564207 GGGGACGAGACTGCCTTTGTAGG + Intronic
1133680066 16:8113027-8113049 GAGGACTAGACTTCCTTTGTAGG + Intergenic
1137042404 16:35625301-35625323 GGAGACAAGACTGCCTTTGTAGG + Intergenic
1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG + Intergenic
1137971278 16:52987341-52987363 GGGTATAATAGCTACTTTGTAGG - Intergenic
1138490904 16:57376022-57376044 TGGGATAATACTCCCTTTGCAGG + Intronic
1139605900 16:68018253-68018275 GGGGACTAGACTGCCTTTGTAGG - Intronic
1141780976 16:86160751-86160773 GGGGCAATTACTTCCTTTCTTGG + Intergenic
1141976419 16:87519219-87519241 GGGGATAAGACCTTCTTTGCAGG + Intergenic
1143020599 17:3915501-3915523 AGGGATGATAGTTCCTTTCTGGG - Intronic
1144556124 17:16284437-16284459 GGGGACTAGACTGCCTTTGTAGG + Intronic
1145753972 17:27376624-27376646 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1146269895 17:31477881-31477903 GGGGATAATACCTGCCTCGTAGG + Intronic
1146581827 17:34045224-34045246 GGGAATATTACTACCTGTGTTGG - Intronic
1147230482 17:39014376-39014398 GGGGACCAGACTGCCTTTGTAGG + Intergenic
1149725049 17:58884751-58884773 GGGGATAATACTTCCTTTGTAGG + Intronic
1152456022 17:80416653-80416675 GAGGAAAATACTTGCTTTTTAGG - Intronic
1152776812 17:82207000-82207022 GGGGACTAGACTGCCTTTGTAGG + Intronic
1156300197 18:35829610-35829632 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1156437277 18:37146072-37146094 GAGGATAATACTTTTTTTTTCGG + Intronic
1156903344 18:42326650-42326672 GGGGACTATACTGCCTTTGTAGG - Intergenic
1157167888 18:45375210-45375232 GGGGACTAGACTGCCTTTGTAGG + Intronic
1157506486 18:48230237-48230259 GGGGATAAACCTTGCTGTGTTGG - Intronic
1159112592 18:64076528-64076550 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1159584555 18:70271420-70271442 GGGGACCAGACTGCCTTTGTAGG + Intergenic
1164564158 19:29314247-29314269 GGGAATAATACCTCCTTTGCTGG - Intergenic
1165300689 19:34966643-34966665 GGGGACCAGACTGCCTTTGTAGG + Intergenic
1166497980 19:43318567-43318589 GGGGACAAGACTGCCTTTGTGGG - Intergenic
926720186 2:15954297-15954319 GGGGACTAGACTGCCTTTGTGGG + Intergenic
926905485 2:17801487-17801509 GGGGACTAGACTGCCTTTGTAGG + Intergenic
928214892 2:29353014-29353036 GGGGACCAGACTGCCTTTGTAGG + Intronic
932079374 2:68697771-68697793 GGGGACCAGACTGCCTTTGTGGG - Intronic
932488339 2:72101548-72101570 GGTGATAATATTTCCTTCTTGGG + Intergenic
933384180 2:81589252-81589274 GGGGATAATGATACCTTTGTGGG + Intergenic
936626368 2:114153621-114153643 GGGGACTACACTGCCTTTGTAGG + Intergenic
936870110 2:117126416-117126438 GGGGACTAGACTGCCTTTGTAGG - Intergenic
941887592 2:170544839-170544861 GAGGAAAATATTTCCTTTGTCGG - Intronic
942152238 2:173088275-173088297 GGGAATAATGTTTACTTTGTTGG + Intronic
942173605 2:173310080-173310102 GGGGACTAGACTGCCTTTGTAGG - Intergenic
942223708 2:173796329-173796351 GGGGACTAAACTGCCTTTGTAGG + Intergenic
944024021 2:195142296-195142318 GGGGACTAGACTGCCTTTGTAGG - Intergenic
945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG + Intronic
947014238 2:225600433-225600455 GGGGATTAGACTGCCTTTGTAGG - Intronic
947388064 2:229612169-229612191 GGGGATAGTACTTTCTTTGAGGG + Intronic
947519211 2:230830859-230830881 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1169439904 20:5625378-5625400 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1170260985 20:14408096-14408118 GGGGATAGTGCCTCCTTTATAGG + Intronic
1170521484 20:17190288-17190310 GGGAATAAGACTTCCATTGAAGG + Intergenic
1171246324 20:23612763-23612785 AGAGATAATACTTCCTTTTGGGG + Intergenic
1173403506 20:42745263-42745285 TGGGAAGATACTTCCTCTGTGGG - Intronic
1173440369 20:43070079-43070101 GCCCAGAATACTTCCTTTGTGGG + Intronic
1174541299 20:51291806-51291828 GAGGATAATACTTGCTTAATTGG - Intergenic
1174777675 20:53360688-53360710 GGGGATAATGCTACATTTTTGGG - Intronic
1175019670 20:55831267-55831289 GGTAATAATACCTGCTTTGTGGG + Intergenic
1175028766 20:55931210-55931232 GGGGAGTAGACTGCCTTTGTAGG - Intergenic
1176082088 20:63278596-63278618 GGGGATAAAAATTCATTTATAGG - Intronic
1177420605 21:20852041-20852063 GGGGACAAGACTGCCTTTGTAGG - Intergenic
1177782425 21:25635299-25635321 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1178602745 21:34009084-34009106 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1178741069 21:35201869-35201891 GGGGATAATTCTACCTTATTAGG - Intronic
1179228693 21:39480049-39480071 GGGGATGATAGTTCCTTTTCAGG - Intronic
1180676816 22:17592077-17592099 TGGGAAAATACTTCTTTTCTAGG + Intergenic
1181017008 22:20076480-20076502 AGGTATAATACTTCCTGGGTTGG - Intergenic
1181879794 22:25969076-25969098 GGGGAAATTACTACCTCTGTGGG + Intronic
1183069336 22:35385410-35385432 GGGAATAGCAATTCCTTTGTTGG + Intronic
951113494 3:18833186-18833208 GGGGACTATACTGCCTTTGCAGG - Intergenic
951263547 3:20540405-20540427 GGGGATCAGTCTTCCTTTGCAGG - Intergenic
952002558 3:28803272-28803294 GGGCATAATAATGCCTTTGGAGG - Intergenic
953048842 3:39321969-39321991 GGGGACTAGACTGCCTTTGTAGG - Intergenic
953051336 3:39347122-39347144 GGGGACTAGACTGCCTTTGTAGG + Intergenic
953212117 3:40885291-40885313 GGGGACAAGTCTGCCTTTGTAGG - Intergenic
953426523 3:42799387-42799409 GGGGACTAGACTGCCTTTGTAGG - Intronic
953719506 3:45343239-45343261 GGGGATAATTCTTCCTGGGTTGG + Intergenic
953742672 3:45551041-45551063 GGTGATAATGCCTCCTTTTTCGG - Intergenic
955550370 3:60078339-60078361 GGATATAATACTACCTCTGTAGG + Intronic
955946930 3:64204338-64204360 GGAGATAATATTTCCTTTCCTGG - Intronic
957716103 3:83930930-83930952 GGGGACCAGACTGCCTTTGTAGG - Intergenic
958525857 3:95258328-95258350 GAGGACTAGACTTCCTTTGTAGG + Intergenic
959157320 3:102682595-102682617 GGGGACTAGACTGCCTTTGTAGG + Intergenic
959161941 3:102734556-102734578 GGGGATTAGACTGCCTTTGTAGG + Intergenic
960594123 3:119392511-119392533 GCGGAGAATAGGTCCTTTGTGGG + Intronic
963165330 3:142195780-142195802 GTGGATTATACTTCCATTATTGG - Intronic
963717754 3:148822954-148822976 GGGGACCAGACTGCCTTTGTAGG - Intronic
963888613 3:150608241-150608263 GGAGATAAAAATTTCTTTGTGGG - Intronic
964357254 3:155862145-155862167 GGGGACTAGACTGCCTTTGTAGG + Intergenic
964365587 3:155947761-155947783 AGGAATAATACTGCCTCTGTGGG + Intergenic
964759824 3:160124230-160124252 GGGGACTAGACTGCCTTTGTAGG - Intergenic
965764091 3:172111463-172111485 TGGGATAAGACTTCATTTTTTGG + Intronic
965892672 3:173534109-173534131 GGGGATAATGCTTACCTTGTAGG + Intronic
965988149 3:174781575-174781597 GAGGAAAATACTTTCTTTTTAGG + Intronic
966757393 3:183384334-183384356 GGGGATTAGATTGCCTTTGTAGG + Intronic
967210076 3:187160465-187160487 GGGGACCAGACTGCCTTTGTAGG - Intronic
967922471 3:194623419-194623441 GGGGTTAAGCCTTCCTTTGTTGG - Intronic
968290968 3:197539502-197539524 GGGGATCAGACTGTCTTTGTAGG + Intronic
969655195 4:8493116-8493138 GAGGATCAGACTGCCTTTGTAGG + Intronic
970156012 4:13142430-13142452 GGGGATAACACTTATTTTATGGG - Intergenic
970928278 4:21478595-21478617 GGGGAAAGTACTTCCTATGAGGG - Intronic
971441089 4:26686678-26686700 GGGGATACTATTGCCTCTGTGGG - Intronic
971462352 4:26914216-26914238 GGGAATAATGCCTACTTTGTGGG + Intronic
972091241 4:35287403-35287425 GGCGGTAAAACTTCCTTTTTGGG + Intergenic
972297451 4:37753598-37753620 TGTAATAATACTTACTTTGTGGG + Intergenic
972568618 4:40290831-40290853 GGGGACTAGACTGCCTTTGTAGG + Intergenic
972743778 4:41913484-41913506 GGGGACAAGAATGCCTTTGTAGG + Intergenic
973092129 4:46149821-46149843 GGGCATAAAGCTTTCTTTGTTGG - Intergenic
973252902 4:48079239-48079261 GGGGACTAGACTTCCTTTGTAGG + Intronic
975220444 4:71807505-71807527 GGGGAGTAAACTACCTTTGTAGG + Intergenic
975253175 4:72202971-72202993 TGGGATGATGCTGCCTTTGTAGG - Intergenic
975916480 4:79331527-79331549 GGGGACTAGACTTCCCTTGTAGG - Intergenic
976603081 4:86957193-86957215 GGGGATAACATTGTCTTTGTAGG + Intronic
977159774 4:93619008-93619030 GGGCATAACACTTCTTTTCTAGG + Intronic
977666938 4:99653417-99653439 GTGGATTATGCTTCCTTTGGTGG - Exonic
978307544 4:107348182-107348204 GGGGACTAGACTGCCTTTGTAGG + Intergenic
978543554 4:109845638-109845660 GGGGTTTATACTTACTTGGTGGG - Intergenic
978840939 4:113210808-113210830 GGCTATTATACTACCTTTGTGGG + Intronic
980466764 4:133196614-133196636 GGGGACTAGACTGCCTTTGTAGG - Intronic
981044363 4:140252455-140252477 GGGAATAATACTTACTTCCTAGG - Intergenic
984097885 4:175453898-175453920 GGGGACTACACTGCCTTTGTAGG - Intergenic
988510240 5:31858566-31858588 GGGGACCAGACTGCCTTTGTAGG + Intronic
988619089 5:32804159-32804181 GAGGATAATAACTCCTTTGTAGG + Intergenic
990307324 5:54506067-54506089 GGGGACCAGACTGCCTTTGTAGG - Intergenic
990961643 5:61399761-61399783 GAAGAAAATACTTCCTCTGTAGG + Intronic
991030361 5:62076168-62076190 GGGGACTAGACTGCCTTTGTTGG + Intergenic
991426011 5:66492455-66492477 GGGGATTAGACTGCCTTTGTAGG - Intergenic
991588869 5:68227751-68227773 AGGGATTTCACTTCCTTTGTGGG + Intronic
992722818 5:79577619-79577641 GGGGACTAGACTGCCTTTGTGGG + Intergenic
995200947 5:109424753-109424775 GGGGATGAGACTGCCTTTGTAGG + Intergenic
996381296 5:122864848-122864870 GGGGACTATACTGCCTTTGTAGG - Intronic
997868827 5:137489096-137489118 GGGGATAATGGTTTCTTTTTGGG - Intronic
998070636 5:139195354-139195376 GGGAATAATATTTACTTTGAAGG - Intronic
999875732 5:155803739-155803761 GGTGGTGATACTTCCTTTCTGGG + Intergenic
999898075 5:156056316-156056338 GGGGACCAGACTGCCTTTGTAGG + Intronic
1000053250 5:157580245-157580267 GGGGATAGTACTTGATTTTTAGG - Intergenic
1000089540 5:157918300-157918322 GGGGACCAGACTGCCTTTGTAGG - Intergenic
1000249082 5:159476426-159476448 ATGGATCATACTACCTTTGTGGG - Intergenic
1000261565 5:159593425-159593447 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1000401360 5:160831449-160831471 GTACATAATACTTCATTTGTGGG + Intronic
1002951526 6:1817329-1817351 GGGAAGAATAGTTCTTTTGTTGG - Intronic
1004468538 6:15907649-15907671 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1005482558 6:26268594-26268616 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1007388725 6:41537307-41537329 TGGGATAACACTCCCTTTATTGG + Intergenic
1010201066 6:73282530-73282552 GGGGACTAGACTCCCTTTGTAGG + Intronic
1011241245 6:85273406-85273428 CTGGATAATATTTCCCTTGTTGG + Intergenic
1011759890 6:90552028-90552050 GGGTATAATCCTTCTTTTGAGGG - Exonic
1011824846 6:91293753-91293775 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1012663355 6:101933231-101933253 GGGGATAAAACTTGCATGGTTGG - Intronic
1013028797 6:106309621-106309643 GGCGATAATACTTCCTGTGGGGG - Intronic
1013238089 6:108216400-108216422 GGGGATAAAACTGCCTTTGGTGG + Intronic
1013246128 6:108289138-108289160 GGGGACCAGACTGCCTTTGTAGG - Intergenic
1014026621 6:116655431-116655453 TGGGATAATAGTTCCCTTGTGGG + Intronic
1014151233 6:118057972-118057994 GGAGATATTCCTTCCTTTGAGGG + Intronic
1015311623 6:131773176-131773198 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1017921838 6:158879653-158879675 GGGGACTAGACTGCCTTTGTAGG - Intronic
1019100047 6:169622952-169622974 GGGGACCAGACTGCCTTTGTAGG + Intronic
1020762734 7:12288713-12288735 GGGGATTAAACTGCCTTTGCAGG + Intergenic
1020991250 7:15198964-15198986 GGGGACAAGGCTGCCTTTGTGGG - Intergenic
1022786077 7:33638724-33638746 GGGGTTACTTCTTCCATTGTAGG + Intergenic
1023436980 7:40149447-40149469 GGGGACTAGATTTCCTTTGTAGG + Intronic
1025217383 7:57070188-57070210 GGGGGTAATATTTCCATTGAGGG - Intergenic
1025628298 7:63243841-63243863 GGGGGTAATATTTCCATTGAGGG - Intergenic
1025653967 7:63500277-63500299 GGGGGTAATATTTCCATTGAGGG + Intergenic
1027362358 7:77422488-77422510 GGGGACCAGACTGCCTTTGTAGG + Intergenic
1027527437 7:79287643-79287665 GAGGATAATACCTGCTTTGCAGG + Intronic
1027762491 7:82297370-82297392 CCTGTTAATACTTCCTTTGTGGG + Intronic
1027824287 7:83090685-83090707 GGGAATAATAGTTAATTTGTAGG - Intronic
1029030368 7:97460456-97460478 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1030155591 7:106451231-106451253 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1031406207 7:121390477-121390499 GGGGACTAGACTGCCTTTGTAGG + Intronic
1031431285 7:121672709-121672731 GGGGCTAGTTTTTCCTTTGTGGG + Intergenic
1031840794 7:126737058-126737080 GGGGACTAGACTGCCTTTGTAGG + Intronic
1032072407 7:128816399-128816421 GGGGATAATCTCTTCTTTGTAGG + Intronic
1032247438 7:130224935-130224957 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1032682089 7:134195293-134195315 GGGGACTAGACTGCCTTTGTAGG - Intronic
1033071558 7:138208034-138208056 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1033627557 7:143125405-143125427 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1033664315 7:143426275-143426297 GGGGAAAATTCTTCATTTTTTGG + Intergenic
1036048009 8:5165565-5165587 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1036946125 8:13096511-13096533 GTGCATAATACTCGCTTTGTCGG + Intronic
1037106943 8:15120356-15120378 GGGGAAAATACTACCTGTATAGG - Intronic
1038393610 8:27229942-27229964 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1039301710 8:36216572-36216594 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1039731819 8:40287784-40287806 GGGGATTAGACTGCTTTTGTAGG - Intergenic
1041918067 8:63155739-63155761 GGGGACAGGACTGCCTTTGTAGG - Intergenic
1042623148 8:70728016-70728038 GGAGATTAGACTGCCTTTGTAGG - Intronic
1043668207 8:82844974-82844996 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1043706729 8:83359253-83359275 GGGGACTAGACTACCTTTGTAGG - Intergenic
1043886988 8:85612415-85612437 GGAGATAATTATTCTTTTGTGGG - Intergenic
1045273092 8:100678601-100678623 GGGGATAATCATGCCCTTGTGGG - Intergenic
1045991847 8:108316947-108316969 GGGGATTAGATTGCCTTTGTAGG + Intronic
1045994054 8:108342508-108342530 GGGGACTAGACTGCCTTTGTAGG + Intronic
1046164819 8:110418678-110418700 GGGGACAAGTCTGCCTTTGTAGG + Intergenic
1047866452 8:129029236-129029258 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1050033057 9:1406435-1406457 GGGGATAACACTTACTTGGGTGG - Intergenic
1052074038 9:24118593-24118615 GGGGATTAGACTGCCTTTGCAGG - Intergenic
1052290290 9:26832608-26832630 GGGGACCAGACTGCCTTTGTAGG - Intergenic
1053267419 9:36725306-36725328 GGGAATAATATTTCCTTCATAGG + Intergenic
1053450146 9:38186882-38186904 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1053451054 9:38194288-38194310 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1054725184 9:68642812-68642834 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1056638955 9:88353927-88353949 GGGGACTAGACTGCCTTTGTGGG + Intergenic
1056641240 9:88372726-88372748 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1059253281 9:112906328-112906350 GGGGACCAGACTGCCTTTGTAGG + Intergenic
1059454974 9:114394762-114394784 GAGGATAATGCTTTATTTGTGGG - Intergenic
1059784983 9:117571796-117571818 GGGGACTAGACTGCCTTTGTGGG + Intergenic
1059961160 9:119565748-119565770 GGGGATAATACTCTCCTTATAGG - Intergenic
1060422941 9:123482655-123482677 GGGGGTAATTGTTCCTTTATGGG - Intronic
1060450554 9:123734676-123734698 GAGGATAATTCTTCCTCTGCGGG + Intronic
1060719240 9:125963807-125963829 GGGCAAAATTCTTCCTTTTTAGG + Intronic
1061751112 9:132777632-132777654 GGGGCTACTACTCCCTTTGATGG + Intronic
1062051210 9:134448012-134448034 GGGGAAGATTTTTCCTTTGTTGG + Intergenic
1062228703 9:135468799-135468821 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1185808075 X:3078898-3078920 GGGGACAAGATCTCCTTTGTGGG - Intronic
1185971904 X:4674419-4674441 GGGGACCAGACTGCCTTTGTAGG - Intergenic
1186062643 X:5726655-5726677 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1186115594 X:6302061-6302083 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1186270556 X:7882572-7882594 GGGGTTAAAACTTGCTTTGCTGG - Intergenic
1186363352 X:8865938-8865960 GGGTATAAGACTTCTTTTGGGGG + Intergenic
1186842070 X:13494363-13494385 GGGGCTAATTATTCTTTTGTGGG + Intergenic
1187033643 X:15514445-15514467 GGAGATAATAATTACTTTGCTGG - Intronic
1187536658 X:20147072-20147094 GGGGACTAGACTGCCTTTGTGGG + Intergenic
1188316928 X:28686660-28686682 GGGCATATTACTTCATTTCTTGG + Intronic
1188686448 X:33075896-33075918 GGGGACTAGACTGCCTTTGTAGG + Intronic
1189116202 X:38345364-38345386 GGGGACTAGACTTCCTTTGTAGG + Intronic
1189631636 X:42960492-42960514 GGGGACTAGACTACCTTTGTAGG - Intergenic
1190083886 X:47378458-47378480 GGGGATTAGACTGCCTTTGTAGG - Intronic
1190409028 X:50116129-50116151 GGGGACCAGACTACCTTTGTAGG + Intergenic
1190477558 X:50842901-50842923 GGGGATTAGACTGCCTTTGTAGG - Intergenic
1191239094 X:58165928-58165950 GTGGAAAACACTTTCTTTGTAGG + Intergenic
1192276863 X:69640897-69640919 GGGGATAATATCTACTTTGCAGG - Intronic
1192812293 X:74558093-74558115 GGGGACTAGACTGCCTTTGTAGG + Intergenic
1194447737 X:94008355-94008377 GGGGACTAGACTGCCTTTGTAGG - Intergenic
1194589163 X:95775512-95775534 GTGGATAATGCCTCCTTTGTGGG + Intergenic
1196287520 X:113899608-113899630 GGGGACCATACTGCCTTTGTAGG + Intergenic
1199888029 X:152042616-152042638 TGGCATAAGTCTTCCTTTGTGGG - Intergenic
1201707032 Y:16949152-16949174 GGAGACAAGACTTCCTTTTTAGG + Intergenic