ID: 1149725863

View in Genome Browser
Species Human (GRCh38)
Location 17:58893675-58893697
Sequence CTGTCGATAGGGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149725857_1149725863 -8 Left 1149725857 17:58893660-58893682 CCACTCTGTTATGGGCTGTCGAT 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149725863 Original CRISPR CTGTCGATAGGGAGGGAGGC TGG Intronic
900392007 1:2437650-2437672 CTGTCCCTAGAGAGAGAGGCAGG - Intronic
900399486 1:2467176-2467198 CTGCCGGGAGGGAGGGAGGGAGG + Intronic
901157466 1:7150137-7150159 CTGTCCGTAAGGAGTGAGGCAGG + Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902860639 1:19242793-19242815 CTGTCCATTGGGAGGCAGGCAGG - Intronic
903280233 1:22245964-22245986 CTTAGGAGAGGGAGGGAGGCAGG + Intergenic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
904911355 1:33936674-33936696 CTGGCAATAAGGAGGGAGGGAGG + Intronic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
906869451 1:49461616-49461638 CTGTTGGTAGGGTGGGGGGCTGG - Intronic
907076345 1:51582655-51582677 GTGTAGAGAAGGAGGGAGGCAGG - Intronic
907468152 1:54653197-54653219 CTGGTGATCTGGAGGGAGGCTGG - Exonic
908089176 1:60668755-60668777 CTGTCCACTGGGAGGGAGGGAGG - Intergenic
908295341 1:62707219-62707241 CAATCGATAGGGAAGGGGGCTGG + Intergenic
909206089 1:72759523-72759545 CTCAGGATAGGGAGGGTGGCAGG - Intergenic
909941455 1:81616280-81616302 CTGTTGATGGGGAGAGAGGTAGG - Intronic
911320792 1:96411194-96411216 CTGTCAATAGGGAGGGCAGTTGG - Intergenic
911968529 1:104399213-104399235 CTGAGGATAGGGAGAGAAGCAGG + Intergenic
913524186 1:119675516-119675538 TGGTCGAAGGGGAGGGAGGCCGG + Intronic
914044889 1:144083105-144083127 CTTACAATAGGGAGGGAGGAAGG - Intergenic
914133221 1:144877581-144877603 CTTACAATAGGGAGGGAGGAAGG + Intergenic
915255655 1:154626995-154627017 TTGTTGCTAGAGAGGGAGGCAGG - Intronic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
915466127 1:156099079-156099101 CCGTTGGCAGGGAGGGAGGCAGG + Intronic
915530814 1:156501036-156501058 CTGCCGGGAGGGAGGGAGGAAGG + Intergenic
915891216 1:159775639-159775661 CTGGAGATGGGGAGGGAGGTGGG - Intergenic
916667696 1:166981487-166981509 GTGTAGAGAGGGAGGGAGGGAGG + Intronic
917232422 1:172852535-172852557 CTGTCGGTGGGGTGGGAGGTTGG - Intergenic
918357156 1:183715756-183715778 ATGTAGAAAGGGAGGGAGGGAGG + Intronic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920570906 1:207016559-207016581 GTGTGGATTGGGAAGGAGGCAGG + Intronic
922758330 1:228109070-228109092 GAGTCGGGAGGGAGGGAGGCAGG - Intronic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
924775566 1:247112734-247112756 CTGTAGGTGGGGAGGCAGGCAGG + Intergenic
1063423861 10:5936271-5936293 CTGTCGATAGCTTTGGAGGCAGG + Intronic
1065025458 10:21535324-21535346 CTTTAGATGGGGAGGGATGCGGG + Intronic
1065508975 10:26458381-26458403 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
1066957015 10:42182787-42182809 CTTACAATAGGGAGGGAGGAAGG - Intergenic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1070704370 10:78627050-78627072 CTGTAGACAGGGAAGTAGGCAGG - Intergenic
1071515240 10:86292606-86292628 CTGAAGAGAGGGAGGAAGGCAGG - Intronic
1073065987 10:100759476-100759498 CAGCCAAAAGGGAGGGAGGCAGG + Intronic
1076778558 10:132711305-132711327 CTGTAGATGGGGAGGGACACGGG - Intronic
1076815632 10:132913441-132913463 CTGTTGATGGGACGGGAGGCGGG - Intronic
1077376070 11:2205588-2205610 CTGTTGGGAGGTAGGGAGGCTGG - Intergenic
1078233122 11:9460664-9460686 TTGTAGCGAGGGAGGGAGGCTGG - Intronic
1081327056 11:41757706-41757728 TTGTCCTTAGAGAGGGAGGCAGG - Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1082997662 11:59266362-59266384 CTGTCCAAATGGAGGGTGGCAGG - Intergenic
1084113893 11:67030798-67030820 CTGTCCATGGGGAGGGCTGCAGG - Intronic
1084128954 11:67118984-67119006 CTGGCGGGAGGGAGGGAGGGCGG + Intergenic
1084491649 11:69481817-69481839 CTTTAAATAGGGAGGGAGGTGGG + Intergenic
1084706697 11:70820003-70820025 ATGTCAAGAGGGAGAGAGGCAGG - Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085061560 11:73452102-73452124 CTGTCCATAGTGACTGAGGCTGG - Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085167700 11:74418026-74418048 CTGACAATAGGGAGTGGGGCTGG - Intergenic
1085313850 11:75531558-75531580 ATGTGCATAGGGTGGGAGGCAGG + Intergenic
1085514927 11:77106363-77106385 CTGTCCTGAGGGTGGGAGGCTGG - Intronic
1085616771 11:78006274-78006296 CTGAAGAGAGGGAGGGAGACAGG - Intergenic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1088031946 11:105262049-105262071 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1089326588 11:117661645-117661667 CTGGCCTTAGGGAGGGATGCAGG - Intronic
1090402578 11:126458521-126458543 CTGGCACTAGGCAGGGAGGCAGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1096194947 12:49643806-49643828 CTGTGGATAGCCTGGGAGGCAGG - Exonic
1096414878 12:51404398-51404420 CTGGCGCTAGGGAGTGAGGAGGG - Intronic
1097015365 12:55982436-55982458 CTGTGAACAGGGAGGAAGGCAGG + Intronic
1100840974 12:98611500-98611522 CTGTAGATAGAGATGGAGACAGG - Intergenic
1101614867 12:106326351-106326373 CTGTCAACAGGGAGGGTGGATGG - Intronic
1102106939 12:110333357-110333379 CTTTCAAAAGGGAGGAAGGCAGG - Intronic
1102278326 12:111599314-111599336 CTGCCGGGAGGGAGGGGGGCCGG + Exonic
1103362750 12:120363357-120363379 TAGTCCCTAGGGAGGGAGGCAGG - Intronic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1103601828 12:122059377-122059399 CTGTCCTTGGGGAGGCAGGCGGG + Exonic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104661475 12:130613939-130613961 CAGCAGAGAGGGAGGGAGGCAGG + Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104929466 12:132330042-132330064 CGGGGGAGAGGGAGGGAGGCCGG - Intergenic
1105913535 13:24892626-24892648 CTTGCGGTAGGCAGGGAGGCGGG - Exonic
1106808097 13:33332176-33332198 CTGTGGATAGGTGGGGAGGTGGG - Intronic
1106847846 13:33755942-33755964 ATGTGGTTAGGGAGGCAGGCAGG - Intergenic
1108822243 13:54367842-54367864 ATGTCTATAGGGATGGAGGCTGG + Intergenic
1111807356 13:93054089-93054111 ATGTTGATAGTGAGGGAGGCTGG + Intergenic
1112111901 13:96310608-96310630 AGGGAGATAGGGAGGGAGGCAGG - Intronic
1112433992 13:99377535-99377557 CTTTCGATAGGGAGAGAGATGGG + Intronic
1112506831 13:99980755-99980777 CTGGAGGGAGGGAGGGAGGCCGG + Intergenic
1112709146 13:102106569-102106591 CTGTCGAAAAAGAGGGAGGGAGG + Intronic
1113697103 13:112354473-112354495 CTGGCCCCAGGGAGGGAGGCCGG - Intergenic
1116848407 14:49885593-49885615 CTGGCGAGAAGGAGGCAGGCTGG - Intergenic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1121275303 14:92663434-92663456 CAGGCAAGAGGGAGGGAGGCCGG + Intronic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122563688 14:102635943-102635965 CTGTCAGAAGGGAGGGAGGGAGG - Intronic
1202936096 14_KI270725v1_random:88989-89011 CTTACAATAGGGAGGGAGGAAGG + Intergenic
1124159292 15:27254261-27254283 GTTTCCAGAGGGAGGGAGGCAGG + Intronic
1124856412 15:33393527-33393549 TTATTGATAGGGAGGGAAGCAGG + Intronic
1125511312 15:40293945-40293967 CTTTGGCTAGGGAGGGAGGTGGG - Intronic
1128450632 15:67804145-67804167 CTGTCCAGAGGCAGGCAGGCGGG - Intronic
1129164317 15:73767691-73767713 CTGTTGAGAGGCAGGGAGCCGGG - Intergenic
1130137906 15:81197124-81197146 CTGTGCATAGGGAGGTAGGTGGG + Intronic
1130293916 15:82629575-82629597 CTGTGGAGAGTGAGGGAGACCGG - Intronic
1132647590 16:1006372-1006394 TTCCTGATAGGGAGGGAGGCAGG - Intergenic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1134257389 16:12623447-12623469 CTTTACATAGAGAGGGAGGCAGG - Intergenic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1137238648 16:46636276-46636298 CTGTTGATAATGGGGGAGGCTGG + Intergenic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1138186429 16:54981259-54981281 TGGTGGAAAGGGAGGGAGGCTGG - Intergenic
1139488136 16:67270957-67270979 CCGTGGATGGGGAGGCAGGCAGG - Exonic
1142611808 17:1112590-1112612 CTGTCTTGAGGGAGGGAGGGAGG + Intronic
1143152693 17:4817079-4817101 CTGGAGGTAGGGAGGGAGCCAGG + Intronic
1143453382 17:7050328-7050350 AGGTGGACAGGGAGGGAGGCGGG + Intergenic
1143761384 17:9106516-9106538 CTGTCGAAAGGAAGGAAGGAAGG - Intronic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1144495228 17:15741564-15741586 CTGTAGGGAGGGAGGGTGGCTGG - Intronic
1144887268 17:18471800-18471822 CTGTCCCTAGGGAGTGAGGAGGG - Intergenic
1145144948 17:20472495-20472517 CTGTCCCTAGGGAGTGAGGAGGG + Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146329761 17:31917448-31917470 CTGTCCACAGGGAGGGAATCCGG + Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146353981 17:32118873-32118895 CTGTCACTAGGGAGTGAGGAGGG - Intergenic
1148770625 17:50064054-50064076 CTGGGGATAGGGACGGAGGTGGG - Intronic
1148829769 17:50424128-50424150 CTGTGGATGGGGAGGAGGGCTGG - Intergenic
1148974995 17:51519836-51519858 CTGACGTTGGGGTGGGAGGCAGG - Intergenic
1149505610 17:57191303-57191325 CTGTGGATTGGGTGAGAGGCAGG + Intergenic
1149725863 17:58893675-58893697 CTGTCGATAGGGAGGGAGGCTGG + Intronic
1151544638 17:74785347-74785369 CTGTAGACAGGGAAGGAGGCAGG - Intronic
1151620810 17:75243768-75243790 CTGTGGATAGGCAGGGGGCCAGG + Intronic
1152050730 17:77974032-77974054 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1152583720 17:81180093-81180115 CTGGAGACAGGGTGGGAGGCAGG - Intergenic
1152841718 17:82573348-82573370 CTGTAGACAGGAAGGCAGGCAGG - Intronic
1154284020 18:13034863-13034885 CTGTCGGCAAGGAGGAAGGCAGG - Intronic
1155526508 18:26721314-26721336 CTGGGGATGGGGATGGAGGCAGG + Intergenic
1155565457 18:27128994-27129016 CTTTCAGTAGGGAAGGAGGCAGG + Intronic
1156034878 18:32754960-32754982 CTGCAGCAAGGGAGGGAGGCAGG + Intronic
1156834312 18:41534150-41534172 CTTTCAAGAGGGAGAGAGGCAGG - Intergenic
1157338336 18:46757046-46757068 CTGCCGATAGGGACGGGGGGAGG + Exonic
1157472085 18:47997359-47997381 TGGTGGCTAGGGAGGGAGGCAGG + Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157850299 18:51042380-51042402 CTGAAGTAAGGGAGGGAGGCAGG - Intronic
1157898598 18:51491876-51491898 TTGTAGTTAGAGAGGGAGGCAGG - Intergenic
1158517992 18:58146693-58146715 CAGTGGCTAGGGAGGCAGGCAGG + Intronic
1158757324 18:60341626-60341648 CTGAGGAAAGGGAGAGAGGCTGG - Intergenic
1158852265 18:61506768-61506790 CTGTCCATGGAGAGGCAGGCTGG + Intronic
1160112032 18:76042142-76042164 CTATCGGAAGGGAGGGAGGAAGG + Intergenic
1160584464 18:79904693-79904715 CTATCACCAGGGAGGGAGGCCGG - Intronic
1160809426 19:1007061-1007083 ATGTTGATGGGGAAGGAGGCTGG + Intronic
1161424252 19:4193830-4193852 CCGTCGGGAGGGAGGGAGGAAGG + Intronic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163521492 19:17794725-17794747 ATGGCGATAAGGAGGGAGGGAGG - Intergenic
1163738586 19:18996914-18996936 CTCTTGAGAGGGAGGGAGGAAGG + Intronic
1164933016 19:32189713-32189735 CTGGAATTAGGGAGGGAGGCTGG - Intergenic
1167440927 19:49508386-49508408 CTTTGGAGAGGGAGGCAGGCGGG + Intronic
1167567561 19:50266552-50266574 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
1202684447 1_KI270712v1_random:36509-36531 CTTACAATAGGGAGGGAGGAAGG - Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
927312961 2:21651163-21651185 TAGTCGATGGGGAAGGAGGCAGG - Intergenic
928251818 2:29687346-29687368 CTGTCCCTAGGCAGGCAGGCAGG + Intronic
928913135 2:36443015-36443037 CTGTATATAGATAGGGAGGCAGG + Intronic
931167109 2:59760183-59760205 CTCTCGATAGGTAGGTAGGTAGG - Intergenic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
933189187 2:79314141-79314163 CTGACAATAGTGAGGGAGACAGG - Intronic
934247271 2:90318337-90318359 CTTACAATAGGGAGGGAGGAAGG + Intergenic
934262054 2:91484266-91484288 CTTACAATAGGGAGGGAGGAAGG - Intergenic
935341231 2:102061499-102061521 CTGTCCAGAGGGAGGGGGCCGGG + Intergenic
936715362 2:115180920-115180942 CTTAAGAAAGGGAGGGAGGCAGG - Intronic
938082009 2:128375032-128375054 CTGGCGCTGGGGAGGGTGGCAGG + Intergenic
938087105 2:128408833-128408855 CTGTGGTTAGGGTGGGCGGCGGG + Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
940321811 2:152385326-152385348 CAGTTTGTAGGGAGGGAGGCTGG + Intronic
944739423 2:202597159-202597181 ATGTTGATAGTGAGGGAGGCTGG - Intergenic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
947474514 2:230430882-230430904 CTGTAGTTAGGCAGGGTGGCTGG + Intronic
947722472 2:232378347-232378369 GTGTCGAGAGGAGGGGAGGCTGG - Intergenic
947726810 2:232406458-232406480 GTGTCGAGAGGAGGGGAGGCTGG - Intergenic
947790797 2:232867710-232867732 TGGATGATAGGGAGGGAGGCAGG - Intronic
948041647 2:234905999-234906021 CTGCTGCTAGGGAGGGAAGCAGG - Intergenic
1169729518 20:8771884-8771906 CTGTCGAAAGGAAGGAAGGAAGG - Intronic
1170578534 20:17681705-17681727 CTGCCGGGAGGGAGGGAGGCAGG + Intronic
1170659141 20:18319119-18319141 CTTTCTATGGGCAGGGAGGCAGG + Intergenic
1172186604 20:33034923-33034945 CTGTGGCTGGGGAGGAAGGCCGG + Intronic
1174179444 20:48665804-48665826 CTTTCCATTGGGAGAGAGGCAGG - Intronic
1174883652 20:54307810-54307832 CTGTGAAGAGGGAGGGATGCAGG - Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175595037 20:60224210-60224232 CTGTTCAAAGGGATGGAGGCTGG - Intergenic
1175642920 20:60646403-60646425 CTGTGGACAGAGAGGGTGGCTGG + Intergenic
1176920635 21:14683717-14683739 CAAGCGAGAGGGAGGGAGGCAGG + Intergenic
1177281369 21:18986973-18986995 CTATTGATAGGGACGGGGGCAGG + Intergenic
1178170622 21:30035745-30035767 ATGTTGATTGTGAGGGAGGCTGG + Intergenic
1179801784 21:43814649-43814671 CTGCGGAGAGGGAGGGAGCCAGG + Intergenic
1180280444 22:10688669-10688691 CTTACAATAGGGAGGGAGGAAGG + Intergenic
1180586060 22:16892352-16892374 CTGTCAAGGGGGTGGGAGGCTGG - Intergenic
1180615133 22:17121403-17121425 CCGCCGGGAGGGAGGGAGGCTGG + Intergenic
1181111346 22:20604798-20604820 CTGGCGGGAGGGAGGGAGGTTGG - Intergenic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182560087 22:31152862-31152884 GTGTGGAGAGGGAGGGAGGTGGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183214771 22:36472500-36472522 CTGTTGATAGTGTGGGAGGCTGG + Intronic
1183715283 22:39529716-39529738 CTGAGCATAGGGTGGGAGGCTGG - Intronic
1184114181 22:42412656-42412678 CGGTAGACAGAGAGGGAGGCAGG + Intronic
1184343949 22:43901589-43901611 ATGTTGAGAGGGAGGGTGGCTGG - Intergenic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185230304 22:49676920-49676942 CTGGCATTGGGGAGGGAGGCTGG - Intergenic
953978035 3:47397053-47397075 CTGAGGAGAGGGAGAGAGGCAGG + Intronic
954035597 3:47849386-47849408 CTGCAGACAGGGAAGGAGGCTGG - Intronic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954749152 3:52804010-52804032 GTGGGGATAGGGATGGAGGCCGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
956603258 3:71046082-71046104 ATGTCAAGAGGGAGGGAGGGCGG - Intronic
956742679 3:72287365-72287387 CTGTCCAGAGATAGGGAGGCTGG + Intergenic
960993213 3:123325060-123325082 CTGCCAAGAGGGAGGGAGGAAGG + Intronic
961795149 3:129403761-129403783 CTCTCGAAAGGGCTGGAGGCAGG + Intronic
963800350 3:149669958-149669980 CTGTCAATAGTGAAGGAGGAGGG + Intronic
964592046 3:158376059-158376081 GGGTCGAGAGGGAGGGAGGGAGG - Intronic
966837184 3:184058411-184058433 CTGTCCACTGGAAGGGAGGCCGG - Exonic
966881214 3:184352333-184352355 TAGTAGAGAGGGAGGGAGGCTGG + Intronic
967019523 3:185510302-185510324 CTGTGGACAGAGAGGGAGACAGG - Intronic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
969147167 4:5134015-5134037 CTGTTGATGGGGAGAGAGTCAGG - Intronic
969323033 4:6424541-6424563 CTGTGGATACACAGGGAGGCCGG + Intronic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969684864 4:8665709-8665731 CTGTCCCCAGGGAGGGAGGGAGG + Intergenic
974424890 4:61729050-61729072 TTGTAGAGAGGGAGGGAGGGGGG + Intronic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
978505429 4:109451221-109451243 CTGTATATAGAGAGGGAGACAGG + Intronic
981543337 4:145868794-145868816 CTGACCATAAGGAGGGAGACAGG + Intronic
981561831 4:146056436-146056458 CTGTAGAAAGGGATGCAGGCTGG + Intergenic
985913100 5:2898039-2898061 CTGTGGATTGGCAGGGATGCAGG - Intergenic
987058637 5:14220344-14220366 CTGAGGAGAGGGAGAGAGGCGGG - Intronic
990994008 5:61712982-61713004 CAGTGGCTAGGGAGAGAGGCTGG + Intronic
993532707 5:89043873-89043895 CTGATGATAAGGAAGGAGGCAGG - Intergenic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998529687 5:142872929-142872951 CTTTCACTAGGGAGGGAGCCTGG - Intronic
1000019142 5:157303814-157303836 CTGGCGGTGGGGAGGGGGGCAGG - Intronic
1002783213 6:382664-382686 TTCTCCATAGGGAGGGAGGTGGG + Intergenic
1002858510 6:1058929-1058951 GTGTCAAAAGGGAAGGAGGCCGG + Intergenic
1005743029 6:28810375-28810397 GTGTCCCTAGGGAGGTAGGCTGG + Intergenic
1006026483 6:31150377-31150399 CTGCCCACAGGGAGGGAGGCAGG + Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1013459137 6:110358387-110358409 CGGTCGGGAGGGAGGGAGGCGGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1017404195 6:154099278-154099300 CTGTCGAAAGGAAGGAAGGAAGG + Intronic
1019443071 7:1057045-1057067 CTGCCGGGAGGGAGGGAGGGAGG + Intronic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1023754932 7:43407655-43407677 CTGTCCATGGTGAGGGAGGGCGG - Exonic
1026346712 7:69480792-69480814 CTTTGGATAGAAAGGGAGGCAGG + Intergenic
1026931038 7:74223119-74223141 CTGGAGAGAGGGAGGGAGGCAGG - Intronic
1027058478 7:75066738-75066760 CTGTCCAGAGGCAGGGAGACGGG + Exonic
1028210079 7:88062849-88062871 CTGTGGAGAGGGAGGGAGATGGG + Intronic
1028228765 7:88280744-88280766 CTGTAGATATGGAGGCAGTCAGG + Intronic
1030035305 7:105403756-105403778 CTGTCGAAAGGAAGGGAGGGAGG - Intergenic
1030196207 7:106856027-106856049 CTGTCAGCAGGGAGGGAGACTGG - Intergenic
1032019612 7:128400042-128400064 CTGTGGACAGGGAGTCAGGCTGG + Intronic
1032383628 7:131506835-131506857 CTGGGGCTAGAGAGGGAGGCAGG - Intronic
1035010781 7:155713536-155713558 CGGTCGATGGGGAAGGAAGCAGG + Intronic
1035092427 7:156325271-156325293 TTGGAGATAGGGATGGAGGCTGG + Intergenic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1037157917 8:15728447-15728469 GTGTGGAGAGGGAGGGAGGGAGG + Intronic
1038546095 8:28426748-28426770 CTGTTGAAAGTGAGGAAGGCTGG + Intronic
1038785625 8:30612655-30612677 GTGCTGAGAGGGAGGGAGGCAGG - Intronic
1043472317 8:80575286-80575308 CTGTCCAGAGAGAGGGAGCCAGG - Intergenic
1046241894 8:111507155-111507177 CAGGGGATAGGGTGGGAGGCGGG + Intergenic
1046988715 8:120423899-120423921 TTGTAGATTGGGAGGGAGGGTGG + Intronic
1048449845 8:134523667-134523689 AAGGCGAGAGGGAGGGAGGCGGG - Intronic
1049244150 8:141552491-141552513 CTGTCCATAGGGAGGGCGTGTGG + Intergenic
1051842470 9:21414043-21414065 CTGCTGCTAGGGATGGAGGCAGG + Intronic
1052393847 9:27913738-27913760 CTGTCGGGAGGAAGGGAGGAAGG - Intergenic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056245909 9:84695125-84695147 CTATCTATAAGGAGGGAGGATGG + Intronic
1057159108 9:92873138-92873160 CTCTCCATAGGCAGGCAGGCAGG + Intronic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1059131840 9:111760132-111760154 CTGTAGATAGGGAAGATGGCTGG - Intronic
1059431874 9:114255292-114255314 CTGACCACTGGGAGGGAGGCCGG - Intronic
1060529830 9:124341666-124341688 CTGTGGAGAGACAGGGAGGCAGG - Intronic
1060536134 9:124389596-124389618 CTGTGGAGAGACAGGGAGGCAGG + Intronic
1062304243 9:135894035-135894057 CTGTTGCTAGGCAGGGAGTCAGG - Intronic
1186157578 X:6741623-6741645 AGGTAGATAGGGAGGGAGGGAGG + Intergenic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187431605 X:19229909-19229931 CTGTCGATGGGGAGGGGCGCTGG - Intergenic
1189323144 X:40098052-40098074 CTGTTGGGAGGGAGGGAGGTAGG - Intronic
1190740946 X:53288393-53288415 CTGTTGCTAGGGAAGGAGGGAGG - Intronic
1191151223 X:57222368-57222390 CTGTCGATATAGAGGGAGAAAGG - Intergenic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1196410279 X:115411285-115411307 TTGTGGTTAGGGAGGGAGGGAGG + Intergenic
1199825837 X:151498419-151498441 GTGTGGACAGGGAGGGAGGTGGG + Intergenic
1201514332 Y:14801762-14801784 CTGTCTTTAGGGAGGCAGTCAGG - Intronic
1202272994 Y:23088428-23088450 CTGTCTAAAAGGAGGGATGCTGG - Intergenic
1202293032 Y:23332254-23332276 CTGTCTAAAAGGAGGGATGCTGG + Intergenic
1202425991 Y:24722172-24722194 CTGTCTAAAAGGAGGGATGCTGG - Intergenic
1202444798 Y:24947914-24947936 CTGTCTAAAAGGAGGGATGCTGG + Intergenic