ID: 1149734655

View in Genome Browser
Species Human (GRCh38)
Location 17:58981317-58981339
Sequence CTGAAGGGATGGTGGGAAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1229
Summary {0: 1, 1: 1, 2: 2, 3: 98, 4: 1127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149734655_1149734665 16 Left 1149734655 17:58981317-58981339 CCCCCTTCCCACCATCCCTTCAG 0: 1
1: 1
2: 2
3: 98
4: 1127
Right 1149734665 17:58981356-58981378 TCAAGTTAGTTATTTCAGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149734655 Original CRISPR CTGAAGGGATGGTGGGAAGG GGG (reversed) Exonic
900127621 1:1075494-1075516 CCCAAGGGATGCTGGGAAGTGGG + Intergenic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900407352 1:2498500-2498522 CTGAGGGGATGCCGGGGAGGTGG - Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900977896 1:6028538-6028560 CAGAAGGGATGGAGAGAGGGGGG - Intronic
900993178 1:6107155-6107177 ATGGAGGGATGGAGGGAAGGTGG + Intronic
900993404 1:6108039-6108061 GTGAAGGGATGGAGGGATGGAGG + Intronic
900993407 1:6108047-6108069 ATGGAGGGATGGAGGGATGGAGG + Intronic
901007040 1:6177011-6177033 GTGCAGTGATGGTGGGGAGGGGG - Intronic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
902040822 1:13491056-13491078 CTGAAGGGTTGTTGGGCAAGAGG - Intronic
902290176 1:15430228-15430250 GAGAAGGGAAGGTGAGAAGGGGG - Exonic
902363910 1:15958570-15958592 CTGAGGGGATGGTGGAGTGGAGG + Intronic
902396021 1:16132850-16132872 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902396059 1:16132979-16133001 GTGCAGGTATGGGGGGAAGGTGG + Intronic
902464424 1:16607194-16607216 ATGGAGGGCGGGTGGGAAGGAGG + Intronic
902708338 1:18221857-18221879 CCAAAAGGAAGGTGGGAAGGTGG + Intronic
902833101 1:19030173-19030195 CAGAAGGGAAGGAGGGAGGGAGG + Intergenic
903108020 1:21101632-21101654 AGGAAGGGAGGGTGGGAGGGAGG + Intronic
903363486 1:22792115-22792137 CTGAAAGCAGGGTGGGAAGGAGG - Intronic
903670257 1:25031201-25031223 CTGGAGGGATGGAGGGATGGAGG + Intergenic
903690036 1:25166936-25166958 CGGAAGGGAGGGAGGGAGGGAGG + Intergenic
903707159 1:25294814-25294836 CTCATGTGAGGGTGGGAAGGAGG + Intronic
903720080 1:25398528-25398550 CTCATGTGAGGGTGGGAAGGAGG - Intronic
904113435 1:28144417-28144439 ATAGAGGGATGGTGGGATGGAGG + Intergenic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904375942 1:30082562-30082584 CTGGAGGGCTGATGGGGAGGGGG + Intergenic
904422268 1:30402000-30402022 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
904482959 1:30805518-30805540 CTGAGGCGGGGGTGGGAAGGGGG + Intergenic
904591777 1:31619028-31619050 CTGAAGGGAGGAAGGAAAGGAGG - Exonic
904918085 1:33984809-33984831 GAGAAGGGAGGGAGGGAAGGAGG + Intronic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905307216 1:37028070-37028092 TTGAAGGGATGTTGGCAAGAAGG + Intronic
905309117 1:37037388-37037410 GGGAAGGGAGGGAGGGAAGGAGG - Intergenic
905650036 1:39650163-39650185 CTGAAGGAATGTTGGACAGGAGG + Intergenic
905731663 1:40302810-40302832 CTGGAGGGAGGGAGGGAGGGAGG + Intronic
905921540 1:41722545-41722567 AGGAAGGGAAGGAGGGAAGGAGG - Intronic
905942318 1:41873949-41873971 GGGAAGCGAGGGTGGGAAGGAGG - Intronic
906012642 1:42543291-42543313 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
906637818 1:47421381-47421403 CTGTAGGGAAGCAGGGAAGGTGG + Intergenic
907092551 1:51741398-51741420 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
907400530 1:54222309-54222331 CTGAAGGGCAAGTGGGAAGGAGG + Intronic
908446521 1:64203076-64203098 CTGAAGGGGTGGAAGGAATGTGG + Intergenic
908611763 1:65868918-65868940 CAGACGGGGTGGTGGGAGGGAGG - Intronic
908647329 1:66292767-66292789 CTAAAGAGATAGTGGGAAGGAGG - Intronic
908805812 1:67930292-67930314 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
909184672 1:72471265-72471287 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
909229967 1:73075309-73075331 TTGAAGGGGAGGTGGGAAGAGGG - Intergenic
910118809 1:83761570-83761592 CTGAGGGGTGGGTGGGCAGGGGG - Intergenic
910258506 1:85273941-85273963 CTGAAGTGAAGTTAGGAAGGTGG - Intronic
910681551 1:89870674-89870696 CTGAGGGGAAGGTGGGGAGGGGG - Intronic
910820060 1:91336398-91336420 AAGAAGGGATGGAGGTAAGGAGG - Intronic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
910875312 1:91872961-91872983 TTGACGGGGTGGTGGGAGGGGGG + Intronic
910996128 1:93106065-93106087 ATGAGGAGGTGGTGGGAAGGGGG + Intronic
911052170 1:93680927-93680949 AGGGAGGGACGGTGGGAAGGAGG - Intronic
911125803 1:94339921-94339943 GTGAAGGGAGGGTGAGAAAGGGG - Intergenic
911363028 1:96902625-96902647 TTTCAGGGACGGTGGGAAGGGGG + Intergenic
911371755 1:97002544-97002566 AGGAAGGGAGGGTGGGAGGGAGG - Intergenic
911800160 1:102126316-102126338 CTGAAGGGAAGGAGGAAATGTGG + Intergenic
912497264 1:110099691-110099713 CGGCAGGGAGGGAGGGAAGGAGG + Intergenic
912635799 1:111291508-111291530 CTGAGGGGTTGGGGGCAAGGGGG + Intronic
912729316 1:112088073-112088095 CTGAATGGATGGCTGGTAGGTGG - Intergenic
912812682 1:112805755-112805777 CTGGAGGTCTGGTGGGGAGGTGG + Intergenic
912948523 1:114104665-114104687 CTGAATGGATGGATGGATGGAGG - Intronic
913427799 1:118753889-118753911 GAGCAGGGAAGGTGGGAAGGGGG - Intergenic
914024888 1:143903918-143903940 TGGGAGGGATGGAGGGAAGGAGG - Intergenic
914362269 1:146945091-146945113 ATGGAGGGAGGGAGGGAAGGAGG - Intronic
914457123 1:147846429-147846451 CTGATGGAAAGCTGGGAAGGAGG + Intergenic
914489406 1:148141987-148142009 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
914663317 1:149811638-149811660 TGGGAGGGATGGAGGGAAGGAGG - Intronic
915004967 1:152627396-152627418 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
915342315 1:155183410-155183432 GAGAAAGGATGTTGGGAAGGTGG - Intronic
915891312 1:159776635-159776657 CTGACTTGATGGTGGGTAGGAGG + Intergenic
915940245 1:160114319-160114341 AGGAAGGGAGGGAGGGAAGGGGG - Intergenic
916001527 1:160621121-160621143 CAGTAAGGATGGTGGGAAAGTGG + Intronic
916232202 1:162551476-162551498 AAGAAGGGAAGGCGGGAAGGAGG - Intergenic
916450228 1:164913622-164913644 CAGAAAGCATGGTGGGATGGAGG + Intergenic
916765208 1:167853635-167853657 CTGAAGTGATGGCATGAAGGAGG - Intronic
916827453 1:168456170-168456192 CTGAAGACATGGAGGGCAGGGGG + Intergenic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
917139077 1:171816564-171816586 AAGAAGGGAAGGAGGGAAGGAGG - Intergenic
917291789 1:173477949-173477971 CAGAACGGAGGGTGGGAGGGCGG - Intronic
917612606 1:176703846-176703868 TTGAAGTGAAGGAGGGAAGGTGG - Intronic
918325213 1:183403517-183403539 TGGAAGGAATGGTGGGGAGGTGG - Intronic
918496226 1:185140559-185140581 TTGAAGGGAGGATGGGAAGTTGG + Intronic
919077469 1:192830924-192830946 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
919087185 1:192934218-192934240 CTGAAGAGATGGAGTGGAGGTGG - Intergenic
919132348 1:193467157-193467179 GTGAAGAGATGAAGGGAAGGTGG - Intergenic
919354185 1:196500181-196500203 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
919403987 1:197152801-197152823 GTGGAGGGGTGGGGGGAAGGCGG + Intergenic
919775551 1:201191978-201192000 CTGAGGGGTGGGTGGGATGGGGG + Intronic
919935156 1:202246162-202246184 GTGGAGGGATGGAGGGATGGGGG - Intronic
919935202 1:202246283-202246305 GTGGAGGGATGGAGGGATGGGGG - Intronic
920122472 1:203669087-203669109 CTGGAAGAATGGTGGGATGGTGG - Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
920776575 1:208943850-208943872 CTGCAGGGATAATGGGAAGCTGG + Intergenic
920919238 1:210284511-210284533 CGGATGGGAGGGTGGGAGGGAGG + Intergenic
920984649 1:210875008-210875030 TTGAAGGGAAGGAAGGAAGGAGG + Intronic
921422635 1:214966141-214966163 CTTAGGGGTTGGAGGGAAGGTGG + Intergenic
921529072 1:216257642-216257664 CTAAAGGAATGGTGGGGTGGAGG - Intronic
922195217 1:223353765-223353787 CTGCAGTGATGGTGGCCAGGGGG - Intronic
922455465 1:225770490-225770512 CGGTAGGGAAGGTGGGAAAGGGG - Intergenic
923186115 1:231575144-231575166 CAAAAGGGAGGGTGGGGAGGAGG - Intronic
923332951 1:232942550-232942572 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
923784457 1:237054172-237054194 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
923835717 1:237609019-237609041 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
923909237 1:238421241-238421263 AGGAAGGGAGGGTGGGAGGGAGG + Intergenic
924045448 1:240024938-240024960 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
924116529 1:240753177-240753199 CAGAAGGGAGGGAGGGAAGGAGG - Intergenic
924406385 1:243751771-243751793 TTGCAGGGAAGGTGGGGAGGGGG + Intronic
924602579 1:245504391-245504413 ATGAAGGGAGGGAGGGAAGGAGG - Intronic
924794258 1:247281203-247281225 ATGAAGGGATGGGTGGGAGGTGG + Intergenic
1062928379 10:1335348-1335370 ATGAAGGGAAGGCTGGAAGGAGG + Intronic
1062966052 10:1608630-1608652 ATGAAGGGAGGGAGGGAAGGAGG + Intronic
1063011614 10:2027215-2027237 CAGAAGGGGTCCTGGGAAGGTGG - Intergenic
1064016070 10:11773272-11773294 ATGGAGGACTGGTGGGAAGGTGG - Intergenic
1064235848 10:13574420-13574442 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1064268844 10:13847507-13847529 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1064483453 10:15762255-15762277 ATGGAGGGATGGAGGGAGGGAGG - Intergenic
1064526402 10:16260711-16260733 AGGAATGGAGGGTGGGAAGGAGG + Intergenic
1064911773 10:20409750-20409772 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1065292341 10:24243409-24243431 AAGGAGGGAGGGTGGGAAGGGGG - Intronic
1065493234 10:26303490-26303512 ATGAAGGGAGGGAGGGAGGGAGG + Exonic
1065526055 10:26622438-26622460 CTGCACGGATTCTGGGAAGGGGG + Intergenic
1065639802 10:27770302-27770324 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1066241329 10:33538462-33538484 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1066375882 10:34857301-34857323 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1066680930 10:37936597-37936619 GTTAAGGGATGGGGGTAAGGAGG - Intergenic
1067178572 10:43968169-43968191 CTGAAGAGATGCAGGTAAGGAGG - Intergenic
1067427790 10:46222638-46222660 CCAAAGGGATGGTAGGAAGTGGG - Intergenic
1067833221 10:49622027-49622049 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068064622 10:52113420-52113442 CAGAAGGGAGGGAGGGAAAGAGG + Intronic
1068556900 10:58468288-58468310 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1068945991 10:62729286-62729308 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1069287300 10:66731417-66731439 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1069590125 10:69636221-69636243 CTGAAAGCATGGTGGGTAGGAGG + Intergenic
1069799661 10:71074238-71074260 AGGAAGGGAGGGTGGGAGGGAGG + Intergenic
1069819707 10:71219924-71219946 CTGAAGAGAGGATGGGATGGGGG + Intronic
1069828784 10:71270337-71270359 CGGAAGGGAGGGAGGGAGGGAGG + Intronic
1070154059 10:73822750-73822772 CTGAATGGTGGGTGGGAAGGAGG - Intronic
1070391567 10:75975362-75975384 CTGAAGGGAGAATGGGAGGGAGG - Intronic
1070630455 10:78081034-78081056 CTGGAGCGATGGTGGGATGAGGG + Intergenic
1070814453 10:79313996-79314018 CTGCAGGCATGGGGGGGAGGGGG + Exonic
1070888856 10:79927390-79927412 CTGATGGGCTGCTGGGAAGAGGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071082363 10:81827377-81827399 GTGGAGGGATGGTGGGGTGGAGG + Intergenic
1071398118 10:85243040-85243062 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1071827845 10:89342917-89342939 CTTAAGGGCTGGTGAGAAGCAGG + Intronic
1071867363 10:89749562-89749584 CTGGAGGGATGGGGTGAATGGGG - Intronic
1072923438 10:99595894-99595916 CTGAAGGGGTAGGGGGAAGCAGG + Intergenic
1073128311 10:101167129-101167151 CTGCAGGGATCCTGGCAAGGGGG - Intergenic
1073229086 10:101951898-101951920 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1073738055 10:106372470-106372492 TTACAGGGATGGGGGGAAGGAGG - Intergenic
1074473148 10:113745451-113745473 GTGATGGGCTGGTGGGAAAGAGG + Intergenic
1074651390 10:115527793-115527815 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1075235436 10:120723294-120723316 ATGAAGGGAGGGAGGGAGGGAGG + Intergenic
1075265373 10:120996399-120996421 AAGAAGGGATGGTGGGGCGGGGG - Intergenic
1075502574 10:122989205-122989227 CAGAAGGGAAGGTGGTAAGGAGG + Intronic
1075683134 10:124346500-124346522 CTGGAGGGAGAGTGGGAAGGAGG - Intergenic
1075732420 10:124644434-124644456 CTAAAGGGAAGGAAGGAAGGAGG - Intronic
1076048003 10:127310266-127310288 CTGTAGGGGTGGGGGTAAGGGGG - Intronic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076760997 10:132605574-132605596 CTGGTGGGATGGTGGGATGGTGG + Intronic
1076818869 10:132928235-132928257 AGGAAGGGCTGCTGGGAAGGAGG + Intronic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077283139 11:1754427-1754449 ATGGAGGGATGGAGGGATGGAGG + Intronic
1077283161 11:1754504-1754526 ATGGAGGGATGGAGGGATGGAGG + Intronic
1077283171 11:1754529-1754551 ATGGAGGGATGGAGGGATGGAGG + Intronic
1077479926 11:2808985-2809007 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1077480899 11:2814087-2814109 ATGGAGAGATGGAGGGAAGGAGG + Intronic
1078069644 11:8100049-8100071 GAGAACAGATGGTGGGAAGGAGG + Intronic
1078108174 11:8371760-8371782 ACGAAGGGATGGAGGGAAAGAGG - Intergenic
1078686837 11:13539898-13539920 CAGGAAGGAGGGTGGGAAGGGGG - Intergenic
1078797905 11:14611749-14611771 TGGAAGGGAGGGTGGGAAGGAGG - Intronic
1078943697 11:16038437-16038459 AAGAAGGGAAGGTGGAAAGGTGG + Intronic
1079003318 11:16775460-16775482 CTGAAGGGATGGGGGTGGGGTGG - Intergenic
1079188681 11:18259638-18259660 GTTAAGGGATGGAGGCAAGGAGG + Intergenic
1079241678 11:18726360-18726382 CTGAAGGCCAGGCGGGAAGGAGG + Intergenic
1079348408 11:19672614-19672636 CCCAAGGGATGGAGGGCAGGAGG + Intronic
1079706034 11:23619737-23619759 AAGAAGGGAGGGTGGGAAGAGGG - Intergenic
1079817220 11:25076648-25076670 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1080336445 11:31202906-31202928 CTGAGGGGATGGATGGAGGGTGG + Intronic
1080437489 11:32259165-32259187 CTGAAGGGAGGGAGGGACAGAGG - Intergenic
1080864718 11:36183125-36183147 ACGGTGGGATGGTGGGAAGGTGG + Intronic
1081492240 11:43577847-43577869 CTGAAGGGAAATTGGGGAGGAGG + Intronic
1081501381 11:43669996-43670018 CTTAAGGGAGGGAGGGAAGCTGG + Intronic
1081594124 11:44447439-44447461 CTGAAGGGCTGATGGGAAACAGG + Intergenic
1081833931 11:46137925-46137947 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1082849797 11:57754632-57754654 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1083034958 11:59628514-59628536 CAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1083075605 11:60033740-60033762 CTTGAGGGATGGAGGGTAGGAGG + Intergenic
1083187147 11:61024293-61024315 AGGAAGGGATGGAGGGAGGGAGG - Intergenic
1083196291 11:61090613-61090635 TTGAAGGGATGTTGGGAGGCTGG - Intergenic
1083299377 11:61732315-61732337 CTGGAGGGATGGTGAGAATAAGG - Intronic
1083482930 11:62961242-62961264 GTGAGGACATGGTGGGAAGGCGG + Intronic
1083555625 11:63623982-63624004 CTGACGGGATAGTGGCAATGTGG - Intergenic
1083577253 11:63801098-63801120 AGGGAGGGATGTTGGGAAGGAGG + Intergenic
1083640579 11:64143121-64143143 AAGAAGGGAGGGTGGGAGGGAGG + Intronic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1083695845 11:64441853-64441875 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1083885959 11:65573638-65573660 CTGAAGGGCTGGGGGGCAGGGGG + Exonic
1084095077 11:66905966-66905988 CTGAAGGGATGGTCTTAAGAGGG + Intronic
1084195456 11:67521901-67521923 CTGAAGGGGAGGTGGCATGGGGG - Intronic
1084507016 11:69574725-69574747 CTGAGTGGATGGTGGGAGGGAGG - Intergenic
1084545694 11:69813968-69813990 GTGAAAGGATGGAAGGAAGGAGG + Intronic
1084580019 11:70017466-70017488 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1084708845 11:70831497-70831519 CTGCAGGGAGGGAGGCAAGGGGG - Intronic
1084727167 11:70949457-70949479 GTGAAGGGAGGGTGAGCAGGTGG - Intronic
1085318022 11:75557768-75557790 CTGAAGGGCTGGTGGGATGGAGG - Intergenic
1085806710 11:79643226-79643248 AGGAAGGAAGGGTGGGAAGGAGG + Intergenic
1086426185 11:86684762-86684784 TTGGAGGTATGGTGGAAAGGGGG + Intergenic
1088809525 11:113381767-113381789 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089029382 11:115308767-115308789 ATGAAGGGAGGGAGGGAAGGAGG - Intronic
1089125620 11:116174598-116174620 CCCAGGGGATGGTGGGCAGGGGG - Intergenic
1089433195 11:118438493-118438515 CTGAAGCGAAGGGGGGTAGGGGG + Intronic
1089537230 11:119168442-119168464 CTGAAGGTAGGCTGGGGAGGCGG + Intronic
1089935410 11:122359356-122359378 CTGGAGGGAGGGAGGGAGGGAGG - Intergenic
1090029548 11:123195335-123195357 CGGGAGGGAGGGAGGGAAGGAGG - Intergenic
1090044018 11:123315336-123315358 CTGAAAGGAGGGAGGGGAGGAGG - Intergenic
1090144911 11:124311244-124311266 CTGGAGTGATGGTGGGCATGGGG + Intergenic
1090435609 11:126684156-126684178 GTGCAGGGCTGATGGGAAGGAGG + Intronic
1090800635 11:130169459-130169481 CTGAAGGGGTGGGGGACAGGAGG + Intronic
1090924621 11:131238584-131238606 CTGAATTGGGGGTGGGAAGGAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091035491 11:132229107-132229129 ATGAAGAGGAGGTGGGAAGGAGG - Intronic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1091303531 11:134523141-134523163 CTGCTGGGGAGGTGGGAAGGGGG - Intergenic
1091316845 11:134620205-134620227 GTGAAGGGAGGGAGGGAGGGAGG + Intergenic
1091998613 12:5015324-5015346 GTGAAAGGATGGAGGGAGGGAGG + Intergenic
1092045525 12:5430026-5430048 CTGGAGGGAGGAGGGGAAGGGGG - Intergenic
1092261140 12:6953878-6953900 CCGCAGGGATGGGGGGAAGGAGG - Intronic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092367037 12:7884878-7884900 CTGAGGGTAGGGTGGGAAAGAGG + Intronic
1092518625 12:9242293-9242315 ATAAAGGGAGGGAGGGAAGGAGG - Intergenic
1093267452 12:17020332-17020354 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1093693547 12:22134898-22134920 CTGAAGACATGGTGGAAAAGAGG + Intronic
1094386554 12:29900719-29900741 CTGAAAGGAAGGTGGGAAACTGG + Intergenic
1094599744 12:31898169-31898191 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1095382112 12:41607407-41607429 CTGAATGAATGGAGGGGAGGGGG + Intergenic
1095464332 12:42475084-42475106 AGGAGGGGATGGTGGGATGGTGG - Intronic
1095669511 12:44842082-44842104 CGGAAGGGAGGGAGGGAGGGAGG + Intronic
1095995972 12:48085054-48085076 CTGCAGGGATGGCGGGGAGAAGG + Intronic
1096609956 12:52794723-52794745 GTGAAGTGATGCTGGGAAGCTGG + Intronic
1096621606 12:52869059-52869081 GTGCAGAGATGGTGGAAAGGAGG + Intergenic
1096716991 12:53497615-53497637 CTGAGGTGATGCTGGGAAGAAGG - Intronic
1097809508 12:64003077-64003099 AGGAAGGGAGGGTGGGAGGGAGG + Intronic
1098003738 12:65972505-65972527 CTGAAGGAAGGGTGGTGAGGAGG + Intergenic
1098104242 12:67052763-67052785 ATGAAGGGAGGGAGGGAGGGAGG + Intergenic
1098215433 12:68211552-68211574 CAGTAGTGATGCTGGGAAGGAGG - Intronic
1098378941 12:69847257-69847279 CAGAAAGGATGGGGTGAAGGAGG + Intronic
1098695598 12:73550251-73550273 CTGCAGGGAAACTGGGAAGGGGG + Intergenic
1098915091 12:76249101-76249123 CTAAAGGGATGGTGCAAAGAAGG - Intergenic
1099156674 12:79185431-79185453 CAGAAGGGATATTGGAAAGGTGG - Intronic
1100077251 12:90800671-90800693 GTCATGGGGTGGTGGGAAGGCGG + Intergenic
1100104413 12:91151574-91151596 CTTATGGGATGCTGGGAAGCAGG - Intronic
1100370803 12:93967042-93967064 CGGGAGGGATGGAGGGAGGGAGG - Intergenic
1100370820 12:93967098-93967120 AGGGAGGGATGGAGGGAAGGGGG - Intergenic
1100722117 12:97370200-97370222 CGGAAGCGATGGTGGGGAGGTGG + Intergenic
1100787096 12:98089963-98089985 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
1100835731 12:98565237-98565259 AAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1101022873 12:100571828-100571850 CAGAAGGGATGGTGAGGAAGAGG - Intergenic
1101119005 12:101559968-101559990 CTGTAGGGATGGTGGAGTGGAGG - Intergenic
1101125621 12:101630772-101630794 ATGAAGGGATGGTGAGCTGGAGG + Intronic
1101322162 12:103682148-103682170 CTGATGGGAAGATGGGAAGATGG + Intronic
1101442309 12:104712963-104712985 TGGAGGGGAAGGTGGGAAGGGGG - Intronic
1101588731 12:106108076-106108098 ATGAAGGGAAGGAGGAAAGGAGG + Intronic
1101837866 12:108307666-108307688 ATGTAGGGATGCTGGGGAGGTGG - Intronic
1102526567 12:113516235-113516257 AGGAAGGGATGGAGGGAGGGAGG - Intergenic
1102680605 12:114687944-114687966 GTAAAAGGATGGTGGGTAGGCGG + Intergenic
1102723258 12:115035820-115035842 CTGGAGGGAGGGAAGGAAGGGGG - Intergenic
1102937498 12:116910228-116910250 ACGAGGGGAGGGTGGGAAGGTGG - Intergenic
1103040348 12:117690036-117690058 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1104081058 12:125430918-125430940 CTGAAGGGAGTGTGGGGAGGAGG + Intronic
1104647373 12:130506778-130506800 CGGAAGGGATGGAGACAAGGAGG + Intronic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1105424402 13:20282622-20282644 CTGCAGGGATGGTGGGGGGGGGG - Intergenic
1105623830 13:22094005-22094027 CTGGAGGGAAGGTGGGCAGGTGG + Intergenic
1105818136 13:24055587-24055609 CTGCAGGGATTCTGGGATGGTGG + Intronic
1106461910 13:29978157-29978179 CTGAAGGAATTGCGGAAAGGAGG + Intergenic
1106467285 13:30024182-30024204 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1106538028 13:30665113-30665135 GAGAAGGGATGGTGAGAAAGTGG + Intergenic
1106620220 13:31365138-31365160 CTGCAGGGATGGTGGGGTTGAGG - Intergenic
1106923544 13:34589702-34589724 CAGAAGGGAGGGAGGCAAGGAGG + Intergenic
1107687558 13:42918936-42918958 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1107978798 13:45714705-45714727 CTGGAGGGATGGTGATAATGCGG - Intergenic
1108259292 13:48640962-48640984 CTGAAGTGGTGGCGTGAAGGAGG + Intergenic
1108794796 13:54017885-54017907 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
1108822340 13:54368662-54368684 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1109493928 13:63143150-63143172 AGGAAGGGAGGGTGGGAGGGAGG + Intergenic
1109520321 13:63501909-63501931 CTGAGTGTAAGGTGGGAAGGTGG + Intergenic
1109664038 13:65506244-65506266 CTGAAAGGAGGGTTGGAAAGGGG + Intergenic
1109671316 13:65612212-65612234 CAGAAGGGAGGGAGGGAGGGAGG + Intergenic
1110329328 13:74252753-74252775 GAGAAGGGAGGATGGGAAGGAGG - Intergenic
1110912459 13:80981269-80981291 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
1110985729 13:81965677-81965699 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1111048485 13:82846964-82846986 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1111497880 13:89076917-89076939 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1111529800 13:89521938-89521960 CTGGAGGGAGGGAGGGAGGGAGG + Intergenic
1112742206 13:102487593-102487615 CAGAAGGGATGGCAGGAACGTGG + Intergenic
1113186122 13:107687301-107687323 CTGGATGGAGGGAGGGAAGGAGG + Intronic
1113522457 13:110950523-110950545 CTGAGGGCATGGTGGGCATGAGG - Intergenic
1113674067 13:112196156-112196178 AGGAAGGGATGGAGGGAGGGAGG - Intergenic
1113990442 14:16023953-16023975 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1113990454 14:16023989-16024011 TGGAAGGGATGGAGGGAGGGAGG - Intergenic
1114408987 14:22483076-22483098 TTGAAGGGAGTGGGGGAAGGGGG + Intergenic
1114519356 14:23323170-23323192 GTGGAGGGAGTGTGGGAAGGAGG + Intronic
1114651879 14:24290344-24290366 CTGAAGAGATGGTGGAATGGGGG + Intergenic
1114866020 14:26597200-26597222 CGGGAGGGAGGGAGGGAAGGAGG + Intronic
1115772250 14:36676537-36676559 CAGAAGGGTTGGAGGGCAGGAGG - Exonic
1115954399 14:38762028-38762050 CTGAAGTGGTAGTGGGGAGGTGG - Intergenic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1117111130 14:52456039-52456061 CGAAAGGGATTGTGGGAGGGTGG - Intronic
1117247445 14:53900176-53900198 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1117402767 14:55372602-55372624 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1117457441 14:55912279-55912301 CAGAGGGCATGGTGGGGAGGGGG + Intergenic
1117564131 14:56976522-56976544 AGGAAGGGACGGAGGGAAGGAGG - Intergenic
1118346010 14:64941442-64941464 CTGAAGAGATGGTGTGAGGCTGG + Intronic
1118443334 14:65831069-65831091 CTGAAGAGATGATGGGAGGAAGG + Intergenic
1118994327 14:70822670-70822692 GTGAAGGGAAGGAGGAAAGGAGG - Intergenic
1119555597 14:75549963-75549985 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1119912018 14:78358189-78358211 CTGTAGGGGTGGTGGTAATGAGG + Intronic
1120251980 14:82069352-82069374 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1120858405 14:89232983-89233005 CTGAAAGGAAGGAGGGGAGGTGG - Intronic
1120948529 14:90020487-90020509 CGGAAGGGAGGGAGGGAGGGAGG - Intronic
1120995112 14:90411641-90411663 ATTAGGGGATGGGGGGAAGGAGG - Intergenic
1122126329 14:99580465-99580487 GTGAGGGGAGGGGGGGAAGGGGG + Intronic
1122195520 14:100082172-100082194 CTGGAGGGATGCGGGGGAGGGGG - Intronic
1122427015 14:101616131-101616153 CGGAAGGGAGGGAGGGAGGGAGG + Intergenic
1122662713 14:103308753-103308775 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1122762659 14:104041099-104041121 CTGAAGGGCCGGGGGAAAGGAGG + Intronic
1122776687 14:104119966-104119988 CTGAAGGGAAGCTGGGCACGTGG + Intergenic
1122874108 14:104655290-104655312 AAGGAGGGAAGGTGGGAAGGCGG + Intergenic
1123087458 14:105723470-105723492 CGGGAGGGAGGGTGGGGAGGCGG - Intergenic
1123707340 15:22959786-22959808 CTGAGAGGCTGGTGGGGAGGGGG - Intronic
1123757245 15:23406619-23406641 GGGAAGGGAGGGAGGGAAGGGGG - Intergenic
1124126953 15:26945028-26945050 CTGAATGGAGGGTTGGAGGGAGG + Intronic
1124598422 15:31110906-31110928 CAGAAGGGAGGGAGGGAAGGGGG - Intronic
1124683178 15:31755122-31755144 ATGAAGGGAAGGTGGGAAGAGGG + Intronic
1124856130 15:33391121-33391143 CTGGAGGGATGAGGGGAAAGAGG - Intronic
1124937508 15:34186670-34186692 CTGCAGGGACAGTGGGGAGGGGG - Intronic
1126173460 15:45713340-45713362 ATGGAGGGATGGAGGGAGGGAGG - Intergenic
1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG + Intronic
1126430318 15:48576557-48576579 ATGAAGGGAAGGTGGGAGGGAGG + Intronic
1126473780 15:49045936-49045958 CTGAAGGGAATGGGGGAAGCGGG + Intronic
1128109222 15:65066161-65066183 ATGAAGGGAAGGAGGGAGGGAGG + Intronic
1128332700 15:66766197-66766219 TGGAAGGGATGGGGGGCAGGGGG + Intronic
1128793525 15:70449547-70449569 ATGGAGGGAAGGAGGGAAGGAGG + Intergenic
1128793601 15:70449815-70449837 GTGGAGGGATGGAGGGATGGAGG + Intergenic
1129000207 15:72327025-72327047 CTGAAGGGTTGGGGGAAGGGAGG - Intronic
1129182436 15:73885668-73885690 GTGCAGGGATGGTGGGGTGGAGG - Intronic
1129331479 15:74830107-74830129 CTGAAGGGAAGAGGGGAAGAGGG - Intronic
1129709698 15:77814314-77814336 CTGAGGGCACGGTGGGAAGTGGG - Intronic
1129905241 15:79182611-79182633 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1130147044 15:81282391-81282413 AGGAAGGGAAGGAGGGAAGGAGG - Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130634004 15:85599042-85599064 CTAATGGGATGATGGAAAGGAGG + Intronic
1130955708 15:88626067-88626089 CTGCAGGGAGGGAGGGAGGGTGG + Intronic
1131111610 15:89767965-89767987 ATAAAGGGGTGGTGGGATGGAGG + Intronic
1131719355 15:95150373-95150395 CTGGAGGGAGGGTGCGAAGAGGG + Intergenic
1131810055 15:96163654-96163676 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1132209787 15:100011385-100011407 CAGAAGGGAGGGAAGGAAGGAGG + Intronic
1132243125 15:100276046-100276068 CTGGTGGGAGGGTGGGAGGGAGG + Intronic
1132361229 15:101217606-101217628 AGGAAGGGATGGAGGGAGGGAGG + Intronic
1132538683 16:497006-497028 CTGAAGGAGTGTTGGGAAAGGGG + Intronic
1132677446 16:1126596-1126618 CTGAAGGGGAGGGGGGAGGGTGG - Intergenic
1132784043 16:1644635-1644657 GGGAAAGGAAGGTGGGAAGGAGG + Intronic
1132982427 16:2745302-2745324 CTGGAGGGAAGCTGGGGAGGGGG + Intergenic
1133148374 16:3807807-3807829 CAGAGGGGCTGGTGGGAAAGTGG - Intronic
1133402668 16:5500133-5500155 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1133402685 16:5500176-5500198 ATGAAGGGAGGGAGGGAGGGAGG - Intergenic
1133702548 16:8322595-8322617 ATGAAGGGATGGAGAGAAGGTGG - Intergenic
1133839343 16:9394272-9394294 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1133839352 16:9394296-9394318 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1133839371 16:9394352-9394374 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1133839385 16:9394392-9394414 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1133839399 16:9394432-9394454 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1134054412 16:11160509-11160531 CTGAAGGGAAAGAGGGAAAGGGG - Intronic
1134224567 16:12380892-12380914 ATGGATGGATGGTGGGTAGGTGG - Intronic
1134291719 16:12907053-12907075 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1134655279 16:15943565-15943587 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1135694164 16:24573381-24573403 CTGAAAGGATGTGGGGAATGAGG + Intergenic
1135887703 16:26326488-26326510 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1136060620 16:27723818-27723840 AGGAAGGGAGGATGGGAAGGAGG - Intronic
1136544379 16:30947506-30947528 CCGAAGGGACGGTGGGAGGGGGG + Exonic
1136909596 16:34135039-34135061 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1137379712 16:47986138-47986160 CTGATGGGATGGAGCCAAGGGGG + Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137524484 16:49222741-49222763 CGGAAGGGAGGGGGGGAGGGAGG - Intergenic
1138174378 16:54883405-54883427 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1138448269 16:57078044-57078066 ATGCAGGGCTGGTGGGGAGGAGG + Intronic
1138498469 16:57423272-57423294 GGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1138562902 16:57812612-57812634 CTGAAGGAATGTGGGGAGGGTGG + Intronic
1138600550 16:58051558-58051580 AGGAAGGGAAGGTGGGAGGGAGG + Intergenic
1138890593 16:61139732-61139754 ATGGAGGGATAGTGGGAAAGTGG - Intergenic
1139065615 16:63310006-63310028 CCGAAGGGGTGGTGGGAAAGGGG - Intergenic
1139320431 16:66109760-66109782 GGGAAGGGAAGGGGGGAAGGAGG + Intergenic
1139341276 16:66269786-66269808 CTGGAGGGAGGGAGGGAGGGAGG + Intergenic
1139869065 16:70089456-70089478 GGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1140035106 16:71365869-71365891 TTTAATGGATGGGGGGAAGGGGG - Intronic
1140412987 16:74752712-74752734 AGGAAGGGATGGTGGGGAGCAGG + Intronic
1140543761 16:75786019-75786041 ATGAAGGGAGGAAGGGAAGGAGG - Intergenic
1140697249 16:77547402-77547424 ATGGAGGGATGGAGGGATGGAGG + Intergenic
1140894994 16:79317136-79317158 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1141193671 16:81843020-81843042 CCGAGGTGATGCTGGGAAGGGGG + Intronic
1141482531 16:84316118-84316140 CTGATGTGGTGGTGGAAAGGAGG + Intronic
1141608210 16:85167637-85167659 CTGAAGGAATGTTGGGAGCGGGG - Intergenic
1141611958 16:85186953-85186975 CTGAGGGGCTGGTGGGAAAGAGG - Intergenic
1141641881 16:85346358-85346380 GTGGATGGATGGTGGGCAGGTGG + Intergenic
1141641970 16:85346741-85346763 GTGAGTGGATGGTGGGCAGGTGG + Intergenic
1141898264 16:86972514-86972536 ATGCAGGGATGGAGGGAGGGAGG + Intergenic
1142027879 16:87824177-87824199 CTGCAGAGATGGTGAGATGGTGG - Intergenic
1142197066 16:88743884-88743906 CAGCAGGGAGAGTGGGAAGGAGG + Intronic
1142529084 17:566561-566583 GGGAATGGAGGGTGGGAAGGTGG + Intronic
1143091293 17:4450384-4450406 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1143173359 17:4942954-4942976 CTGAAGGAAGAATGGGAAGGAGG - Intronic
1143254059 17:5542816-5542838 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1143515544 17:7417698-7417720 CCGAAGGGATGAAGGGAGGGGGG - Exonic
1143626620 17:8114073-8114095 GGGAAGGGAGGGTGGCAAGGGGG + Intronic
1143669839 17:8389059-8389081 CAGAAGGGAGGGAGGGAGGGAGG - Intergenic
1144288797 17:13805771-13805793 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1144606901 17:16674593-16674615 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1144622005 17:16823865-16823887 CTGATGGGAGGGTGGGGTGGGGG - Intergenic
1144884419 17:18448849-18448871 CTGACGGGAGGGTGGGGTGGGGG + Intergenic
1145147810 17:20495528-20495550 CTGAGGGGAGGGTGGGGTGGGGG - Intergenic
1145279614 17:21457942-21457964 GTGCAGGGATGGTGGGCAGCAGG + Intergenic
1145974676 17:28977338-28977360 CTGAAGTCATGGAGGGGAGGCGG - Intronic
1146574810 17:33981633-33981655 AGGAAGGGAGGGTGGAAAGGGGG + Intronic
1146763256 17:35496506-35496528 CCGGAGGGACGGTGGGGAGGGGG - Intronic
1146822555 17:35996057-35996079 CAGGAGGGAGGGAGGGAAGGGGG + Intronic
1146937915 17:36824058-36824080 GTGCAGGGATGGAGGGCAGGTGG + Intergenic
1147153742 17:38532914-38532936 GTGAGGGGAAGGCGGGAAGGGGG + Exonic
1147457222 17:40545401-40545423 CTGAAGTGATGGTGGCCATGAGG + Intergenic
1147573976 17:41588199-41588221 CTGATGGGAGGGTGGGGTGGGGG - Intergenic
1147907824 17:43834046-43834068 CTGCTGGGATTGAGGGAAGGGGG - Intergenic
1147967998 17:44204362-44204384 CTCAAAGGATGGTGGTAAGTGGG + Intergenic
1148004795 17:44418180-44418202 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1148061971 17:44842911-44842933 GGGAAGGGATGGGGGGAAGGGGG - Intergenic
1148222915 17:45876860-45876882 GGGAAGGGCAGGTGGGAAGGAGG + Intergenic
1148353643 17:46959138-46959160 CTGATGAGATGGTGGGAAGTAGG + Intronic
1148370411 17:47095426-47095448 GTGAAGGGAGGGAGGGAGGGAGG + Intergenic
1148382504 17:47210062-47210084 GTGAGGGCAGGGTGGGAAGGAGG + Intronic
1148704064 17:49612499-49612521 CTGAAGCCATAGTGGGAAGTTGG - Intronic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1149292517 17:55231086-55231108 CTGAAGGTATGGTGGGACTCTGG + Intergenic
1149610718 17:57955953-57955975 CACAGGAGATGGTGGGAAGGGGG + Intergenic
1149666607 17:58369313-58369335 CTCCAGAGATGGTGGGAAGCAGG - Intronic
1149730819 17:58944483-58944505 CTGGAGGGGTGGTGGGAATGAGG - Intronic
1149734647 17:58981279-58981301 CATGAAGGATGGTGGGAAGGGGG - Exonic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1150045538 17:61909551-61909573 ATGTTGGGAGGGTGGGAAGGGGG - Intronic
1150056173 17:62019003-62019025 CTTAAGGGTTGGTTGGAATGTGG - Intronic
1150293199 17:63993361-63993383 GGGAAGGGAAGGTGGGAGGGAGG + Intergenic
1150293215 17:63993399-63993421 GGGAAGGGAAGGTGGGAGGGAGG + Intergenic
1150424769 17:65068576-65068598 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1150466868 17:65400984-65401006 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1150703271 17:67466180-67466202 CTGTAGAGATGGTGGGGTGGGGG + Intronic
1151044933 17:70908890-70908912 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1151408808 17:73907205-73907227 ATGAAAGGATGGTGGGTAGTGGG + Intergenic
1151489672 17:74425271-74425293 GTGAAGGGATTGTTGGAAGAAGG + Intronic
1151500718 17:74486687-74486709 GTGCAGGAATGGTGGGAATGGGG - Intergenic
1151785149 17:76271777-76271799 CTGCAGGGCTGCGGGGAAGGGGG - Intergenic
1152006553 17:77685830-77685852 ATGAAGGGATGGAGGGAGAGAGG - Intergenic
1152013169 17:77733245-77733267 GGGAAAAGATGGTGGGAAGGTGG - Intergenic
1152471980 17:80494582-80494604 ATGACTAGATGGTGGGAAGGGGG + Intergenic
1152473584 17:80503587-80503609 ATGGAGGGATGGTGGATAGGTGG + Intergenic
1152473721 17:80504114-80504136 ATGGAGGGATGGTGGATAGGTGG + Intergenic
1152688086 17:81704425-81704447 CTGAAGGTATCGTGAGAGGGTGG + Exonic
1153560001 18:6362190-6362212 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1153647204 18:7205931-7205953 AGGAAGGGAGGGAGGGAAGGTGG - Intergenic
1154280086 18:12994962-12994984 ATGAAGGGAAGGTGAGAAGGTGG + Intronic
1154338187 18:13482384-13482406 CTGTGGGGAAGGTGGGACGGTGG - Intronic
1154354241 18:13612637-13612659 CTGAAGGGATGCTTTGAACGTGG + Intronic
1154982014 18:21510357-21510379 CTGAGGGGAGGGAGGGAATGGGG - Intronic
1155518088 18:26642873-26642895 CTGCGGGGAGGGTGGGAGGGCGG + Intronic
1155521447 18:26672952-26672974 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1155554356 18:27001685-27001707 CAGAATGCATGGTGGGAGGGTGG + Intronic
1155630595 18:27887702-27887724 AAGAAGGGATGGAAGGAAGGAGG - Intergenic
1155829202 18:30491884-30491906 GGGAAGGGATGGAGGGAGGGAGG + Intergenic
1155966054 18:32036595-32036617 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1156265315 18:35482740-35482762 CGGAAGGGAGGGTGGGAGGAAGG - Intronic
1156419727 18:36937761-36937783 GTGAAGGGGTAGTGGGGAGGTGG - Intronic
1156447600 18:37248948-37248970 CTGCAGGGAGGGAGGGAGGGAGG + Intronic
1156620941 18:38850838-38850860 CTGAAGTGATGTGGAGAAGGAGG - Intergenic
1156908687 18:42385083-42385105 ATGAAGGGAGGGAGGGATGGAGG - Intergenic
1157208845 18:45723719-45723741 CTGAGGGGCTGTTGGGAGGGTGG - Intergenic
1157367710 18:47081079-47081101 ATAAAGTGATGGAGGGAAGGAGG - Intronic
1157515308 18:48306987-48307009 GTGGAGGGAAGGTGGTAAGGAGG - Intronic
1157544676 18:48539445-48539467 GAGCAGGGATGGGGGGAAGGGGG - Intronic
1157576678 18:48748355-48748377 ATGAAGGGAGGGAGGGAAGGAGG + Intronic
1157792704 18:50546692-50546714 GTGAGGGGAGGGTTGGAAGGTGG + Intergenic
1158611125 18:58941975-58941997 AGGAAGGGAAGGAGGGAAGGAGG - Intronic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1158835511 18:61327511-61327533 CTGAAGGGATGGGGTGCAGGTGG - Intergenic
1158931574 18:62328683-62328705 CGGATGGGATGGGGGGCAGGAGG - Intronic
1159439430 18:68458247-68458269 CTGTAAGGATGGTGTGATGGTGG + Intergenic
1159442048 18:68493827-68493849 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1159487458 18:69082523-69082545 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1159532038 18:69667003-69667025 CTAAAGGGAGGTTGGGATGGCGG - Intronic
1160128772 18:76205260-76205282 CGGAAGGGAGGGAGGGAGGGAGG + Intergenic
1160142865 18:76340857-76340879 CTGTAGGGAGGTTTGGAAGGTGG - Intergenic
1160142957 18:76341740-76341762 CTGAAAGGGTGGTGGAAAGAAGG - Intergenic
1160269531 18:77371910-77371932 CTGATGGGCTGGTCGGATGGTGG + Intergenic
1160356096 18:78229550-78229572 AGGAAGGGAGGGAGGGAAGGGGG - Intergenic
1160502579 18:79409618-79409640 GTGAAGGGATGATGGGTAGATGG - Intronic
1160893730 19:1393181-1393203 GTGGAGGGAGGGTGGGCAGGCGG + Intronic
1160997191 19:1888256-1888278 CTGCAGGGAAGATGGGAGGGGGG - Intergenic
1161273648 19:3404030-3404052 GGGAAGGGATGGGGGGAAAGGGG - Intronic
1161328999 19:3677705-3677727 ATGGAGGGATGGTGGGATGGAGG + Intronic
1161329007 19:3677729-3677751 ATGGAAGGATGGTGGGATGGAGG + Intronic
1161329039 19:3677815-3677837 ATGGAGGGATGGAGGGAGGGAGG + Intronic
1161329150 19:3678197-3678219 ATGAAGGGATGGAGAGATGGAGG + Intronic
1161329178 19:3678282-3678304 GTGGAGGGATGGAGGGATGGAGG + Intronic
1161329181 19:3678290-3678312 ATGGAGGGATGGAGGGACGGAGG + Intronic
1161329239 19:3678500-3678522 ATGGAAGGATGGTGGGATGGAGG + Intronic
1161329268 19:3678584-3678606 ATAAAGGGATGGAGGGATGGAGG + Intronic
1161329302 19:3678704-3678726 CGGGAGGGATGGAGGGATGGCGG + Intronic
1161329369 19:3678906-3678928 AGGAAGGGATGGAGGGATGGAGG + Intronic
1161329396 19:3678992-3679014 ATGGAGGGATGGTGGGATGGAGG + Intronic
1161347758 19:3776650-3776672 ATGAGTGGATGGTGGGTAGGTGG + Intergenic
1161438362 19:4277467-4277489 CTGAAAGGGTGGGGGGAAGCGGG + Intergenic
1161636110 19:5390238-5390260 CGTAAGGGCTGGTGGGGAGGGGG + Intergenic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1161854628 19:6756839-6756861 ACGAAGGGAGGGAGGGAAGGAGG - Intronic
1161914689 19:7219601-7219623 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1162107422 19:8378467-8378489 AGGAAGGGATGGTGGCATGGAGG - Intronic
1162161305 19:8720051-8720073 GTGAAGGGATGGAGGGGTGGAGG - Intergenic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162232561 19:9279857-9279879 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1162337872 19:10072840-10072862 CTGAAGGGAGGGAGGGTGGGGGG + Intergenic
1162540808 19:11294894-11294916 CTGCATGGATTGGGGGAAGGCGG - Intergenic
1162858902 19:13490830-13490852 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1162879689 19:13648912-13648934 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1162904564 19:13816057-13816079 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1162969165 19:14169803-14169825 GGGAAGGGATAATGGGAAGGAGG + Intronic
1163251969 19:16131464-16131486 ATGAATGGTTGGTTGGAAGGAGG + Intronic
1163471504 19:17500072-17500094 CTGAATGCAGGCTGGGAAGGTGG + Intronic
1163623367 19:18373872-18373894 CGAAAGAGAGGGTGGGAAGGTGG - Intergenic
1164091599 19:21957980-21958002 GTTATGGGGTGGTGGGAAGGGGG - Intronic
1164654322 19:29909940-29909962 GGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1164654478 19:29910478-29910500 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1164654562 19:29910766-29910788 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1164655447 19:29917811-29917833 AAGAAGGGATGGAGGGAGGGAGG + Intergenic
1164669225 19:30063380-30063402 GTGCAGGGATGGTGTGATGGGGG - Intergenic
1164744108 19:30598968-30598990 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1165741189 19:38206257-38206279 CTGAGGGGAAGGAGCGAAGGCGG - Exonic
1165743235 19:38216056-38216078 CTGGAGGGAGGGAGGCAAGGCGG - Intronic
1165764656 19:38343235-38343257 TGGGAGGGATGCTGGGAAGGTGG - Intronic
1165929127 19:39344671-39344693 CTGAAGGGATAATGGGAAAAGGG - Intronic
1166062441 19:40335019-40335041 AGGAAGGGAAGGAGGGAAGGAGG + Intronic
1166160507 19:40949231-40949253 CTGAAGGGGCTGAGGGAAGGGGG + Intergenic
1166169386 19:41016824-41016846 CTGAAGGGGCTGAGGGAAGGGGG + Exonic
1166283293 19:41809198-41809220 CTGGAGGGAGGGAGAGAAGGAGG + Intronic
1166350279 19:42194842-42194864 AGGAAGGGAGGGAGGGAAGGTGG + Intronic
1166626919 19:44366367-44366389 AAGGAGGGAGGGTGGGAAGGAGG - Intronic
1166706403 19:44910379-44910401 GTGCAGGGTGGGTGGGAAGGAGG - Intergenic
1166706923 19:44913164-44913186 ATGTAGTGATGGTGGGAAGCAGG + Intergenic
1166707243 19:44914796-44914818 ATGAGGGGATCGTGGGAGGGAGG + Intronic
1166709347 19:44926888-44926910 ATGAGGGGATCGTGGGAGGGAGG + Intergenic
1166754950 19:45184935-45184957 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1167071326 19:47223656-47223678 CTGAAGGGAAGGAGGTTAGGTGG - Intronic
1167101897 19:47408825-47408847 CTGGGTGGATGGTGGGCAGGTGG + Intronic
1167304212 19:48697496-48697518 TTGTAGGGATGGTGGGGAGGGGG - Intronic
1167468146 19:49660983-49661005 CTGATGGGAGGGAGGGAGGGAGG - Intronic
1167634867 19:50648727-50648749 GGGAGGGGATGGTGGGCAGGGGG - Intronic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
1168277495 19:55285605-55285627 CAGGATGGAGGGTGGGAAGGTGG + Intronic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168421440 19:56206671-56206693 CTGATGGAATGTAGGGAAGGAGG + Intronic
1168424021 19:56224272-56224294 CTGATGGAATGTAGGGAAGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168426695 19:56244800-56244822 CTGATGGAATGTAGGGAAGGAGG + Intronic
925203531 2:1988151-1988173 CTGGCGGGAGGGTGGGAATGTGG - Intronic
925225865 2:2183744-2183766 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
925357357 2:3251300-3251322 CTAAAGGGAGGGTGGGAAGAGGG + Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925466459 2:4110870-4110892 AAGGAGGGAAGGTGGGAAGGAGG - Intergenic
925466462 2:4110878-4110900 GAGAAGGGAAGGAGGGAAGGTGG - Intergenic
925799446 2:7583458-7583480 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
925835487 2:7941596-7941618 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
926291977 2:11538828-11538850 AGGAAGGGATGGAGGGAGGGAGG - Intronic
926705869 2:15837054-15837076 CTGGAGGGAGGGAGGGAATGGGG + Intergenic
926792053 2:16584076-16584098 AGGAAGAGATGGTGGGAAGGAGG - Intronic
926809590 2:16744690-16744712 CTGAAGGGATCCTGGAAAGCTGG - Intergenic
926828801 2:16937236-16937258 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
926940586 2:18132031-18132053 CTGAGGGGGAGGTGGGAATGGGG + Intronic
927072835 2:19548270-19548292 CTGCAGGGATGGGGGCAGGGAGG - Intergenic
927282967 2:21326857-21326879 CTGAGGGGATGGTGTGTAGATGG - Intergenic
927594556 2:24385291-24385313 CTGGAGGGTTGGTGGGCAGAGGG - Intergenic
927769368 2:25845708-25845730 GTGAAGGGATGTGGGGATGGAGG - Intronic
927782228 2:25948739-25948761 ATGAAGGGAGGGAGGGAGGGAGG + Intronic
927912964 2:26914600-26914622 CTGAAGGGAGGAGGGGAAGCAGG + Intronic
928105681 2:28469223-28469245 CTGGAAGGCTGCTGGGAAGGAGG + Intronic
928336113 2:30399915-30399937 CTGAAGGGATGTTAGGTGGGGGG + Intergenic
928507129 2:31965290-31965312 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
928535219 2:32233216-32233238 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
928773727 2:34733300-34733322 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
928796777 2:35033077-35033099 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
928919488 2:36511842-36511864 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
929336694 2:40756639-40756661 ATGAAGGGAGGGAGGGAGGGAGG - Intergenic
929476635 2:42257134-42257156 GTTAGGGGATGGTGGGCAGGAGG + Intronic
929628647 2:43435467-43435489 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
930511850 2:52355866-52355888 CAGAATGGAAGGTGGGATGGGGG + Intergenic
930523687 2:52498927-52498949 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
931248081 2:60507372-60507394 GGGAAGGGAGGGAGGGAAGGAGG + Intronic
931343531 2:61425736-61425758 CAGTAGAGGTGGTGGGAAGGGGG + Intronic
931464066 2:62471644-62471666 CTGAAGGAGTGCTGGGGAGGGGG + Intergenic
931624560 2:64245181-64245203 CTGAAGGGAAGTTGGGGAAGCGG - Intergenic
931634413 2:64328633-64328655 CTGAAGGGTGGGTAGGAGGGAGG + Intergenic
932071615 2:68626369-68626391 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
932071631 2:68626426-68626448 CAGAAGGGAGGGAGGGAGGGAGG - Intronic
932458083 2:71862394-71862416 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
932890581 2:75593045-75593067 GAGAAGGAAGGGTGGGAAGGTGG - Intergenic
934169317 2:89326240-89326262 GTGAAGACATGGTGAGAAGGTGG - Intergenic
934197977 2:89856344-89856366 GTGAAGACATGGTGAGAAGGTGG + Intergenic
934679328 2:96271294-96271316 CTGCAGTGATGATGGGGAGGTGG + Exonic
934884764 2:98014618-98014640 CTGGTGGGTTGGTGGGATGGTGG - Intergenic
934884775 2:98014649-98014671 CTGGTGGGTTGGTGGGATGGTGG - Intergenic
935116378 2:100140336-100140358 CTGAAGGCATGGTGAGGAGCTGG - Intronic
935204192 2:100883386-100883408 CTGACTGGAGGGTGGGAATGAGG + Intronic
935287479 2:101578453-101578475 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
935315971 2:101834197-101834219 ATGGAGGGATGGAGGGATGGAGG - Intronic
935315974 2:101834205-101834227 ATGGAGGGATGGAGGGATGGAGG - Intronic
935570153 2:104651231-104651253 GCGAAGGGAGGGAGGGAAGGAGG + Intergenic
935782293 2:106518909-106518931 GTGGAGGGATGGAGGGATGGAGG - Intergenic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
935924106 2:108048479-108048501 CTGAAGGGAAAGAGTGAAGGTGG - Intergenic
936778337 2:116001277-116001299 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
937234093 2:120419918-120419940 CTGAATGGATGGATGTAAGGAGG - Intergenic
937305454 2:120867803-120867825 CTGGAGGGAAGGAGGGAGGGAGG + Intronic
937389781 2:121474892-121474914 CTATAGGGATAGTGAGAAGGAGG + Intronic
937669665 2:124524912-124524934 CTCTAGGGATGTGGGGAAGGAGG - Intronic
937815950 2:126251132-126251154 CTGTAGGGAGGATGGGAAGGTGG + Intergenic
937981877 2:127620479-127620501 ATGAAGGGAGGGCGGGCAGGGGG + Intronic
938138456 2:128777590-128777612 CAGAAGGGACGGAGGGAGGGAGG - Intergenic
938179813 2:129170304-129170326 GTGAAGGGGAGGTGGGAAGATGG - Intergenic
938421653 2:131151761-131151783 GTGAATGGCTGGAGGGAAGGGGG + Intronic
938546587 2:132338173-132338195 AAGGAGGGAGGGTGGGAAGGAGG + Intergenic
938661064 2:133487743-133487765 CTGAGAGGATGGTGAGAAAGTGG + Intronic
939058554 2:137393305-137393327 GTGGTGGGGTGGTGGGAAGGGGG - Intronic
939095859 2:137832413-137832435 CTGGACTGATGGTGGGAGGGGGG - Intergenic
939141526 2:138359721-138359743 GTGAAGGGCTGTGGGGAAGGGGG + Intergenic
939280469 2:140057906-140057928 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
939350626 2:141033203-141033225 TGGAAGGGAGGGAGGGAAGGTGG + Intronic
939430590 2:142100915-142100937 ATGAAGGGAGAGAGGGAAGGAGG + Intronic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
939480621 2:142743078-142743100 CTGATGGGATTGTGGGAGGGGGG - Intergenic
939833039 2:147095475-147095497 ATCAAGGGAATGTGGGAAGGAGG + Intergenic
940291673 2:152083363-152083385 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
940692822 2:156940850-156940872 CTGCAGGGATGTTGAGAAAGAGG - Intergenic
940910306 2:159204406-159204428 CTGAAGGCATGGTGGGCTGCTGG + Intronic
941490460 2:166137158-166137180 GTGAAGGGCTGGTGGGAACTGGG + Intergenic
942289427 2:174454655-174454677 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
942325464 2:174772637-174772659 ATGAAGGAAGGGTGGGAAGCAGG - Intergenic
942424217 2:175842105-175842127 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
942943716 2:181650076-181650098 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
943016454 2:182516666-182516688 AAGAAGGGAAGGAGGGAAGGAGG + Intronic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
944171422 2:196783257-196783279 AGGAAGGGAAGGAGGGAAGGAGG + Intronic
944329788 2:198452095-198452117 GGGAAGAGATGGTGGGAATGAGG - Intronic
944348080 2:198692695-198692717 CCCCAGGGATGGTGGGGAGGTGG + Intergenic
945270055 2:207929053-207929075 CTGAATGGATAGATGGAAGGAGG - Intronic
945341137 2:208656304-208656326 ATGGAGGGATGGAGGGATGGAGG - Intronic
945512858 2:210724163-210724185 CTGCAGGGAAGGTGGGGAGAAGG + Intergenic
945811892 2:214559016-214559038 CTGATGGGGTGGGGGGAGGGGGG - Intronic
945892843 2:215448601-215448623 CTGAAGGGAGGGCAGGAAAGTGG + Intergenic
946164081 2:217853261-217853283 CTTAAGGGAGGCTGGGGAGGTGG + Intronic
946178271 2:217935163-217935185 CTGAAGGCAGGGTGAGGAGGGGG + Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946227054 2:218269732-218269754 CCAAGGGGATGATGGGAAGGGGG + Intronic
946281651 2:218670369-218670391 TGGATGGGATGGTGGTAAGGTGG + Intronic
946715884 2:222554979-222555001 CCGAAGGGATGGGAGGAGGGAGG - Intronic
946829773 2:223716872-223716894 CTTAAGGGAGGGGGGTAAGGGGG - Intergenic
947955071 2:234182632-234182654 CGGAAGTGAAGGTGGGATGGGGG - Intergenic
948269851 2:236665937-236665959 CCGAGGGCGTGGTGGGAAGGGGG - Intergenic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
948729123 2:239952284-239952306 CTGAAGGCAGAGTGGGGAGGGGG + Intronic
948764011 2:240210376-240210398 ATGAAGGGGTGGTTGGATGGGGG - Intergenic
1168736645 20:145778-145800 ATGGAGGGAAAGTGGGAAGGGGG - Intergenic
1168876105 20:1173358-1173380 TTGAAGGGATGGTGGTATTGGGG - Intronic
1169141844 20:3230969-3230991 CGAAAGCGATGGTGGGCAGGAGG + Exonic
1169306436 20:4494957-4494979 CTGCAGGGGAGGTGGGGAGGTGG - Intergenic
1169541618 20:6606084-6606106 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1169614818 20:7429059-7429081 GAGAAGGGATGGTAGGAAAGTGG - Intergenic
1169880071 20:10337496-10337518 CTGAGAGGAAGGTGGAAAGGAGG - Intergenic
1170392633 20:15891925-15891947 CTGAAGGGACAATGGGAAGGAGG + Intronic
1170438067 20:16350534-16350556 CGGGAGGGAAGGTGGGGAGGAGG + Intronic
1170561652 20:17563629-17563651 CTGGTGGGGTGGTGGGGAGGAGG - Intronic
1170665785 20:18384878-18384900 CGGAAGCCATGGTGGGATGGTGG + Intronic
1171464810 20:25320000-25320022 CTGAAGGGGTTGAGGGAAGGCGG - Intronic
1171847580 20:30286383-30286405 GTGAATGGAGGGTGGGTAGGTGG - Intergenic
1171875450 20:30570907-30570929 AAGGAGGGAGGGTGGGAAGGAGG + Intergenic
1171905068 20:30893761-30893783 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1172074673 20:32285550-32285572 CTGAAAGGATGGTGGGAACTGGG + Intronic
1172619031 20:36307416-36307438 ATGGAGGGATGGAGGGATGGAGG - Intronic
1172619034 20:36307424-36307446 CCGGAGGGATGGAGGGATGGAGG - Intronic
1172641999 20:36446137-36446159 CAGAATGGATGTTGGGAAAGGGG - Intronic
1172965052 20:38828604-38828626 CTGCAGGGATGGTGGCAACAAGG + Intronic
1173087703 20:39940081-39940103 ATGGAGGGATGGAGGGATGGAGG + Intergenic
1173096071 20:40029656-40029678 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1173131274 20:40396024-40396046 TTGAAAGGATGGTGGAAAAGGGG + Intergenic
1174701185 20:52611036-52611058 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1174746989 20:53073093-53073115 ATGGAGGGATGGATGGAAGGAGG - Intronic
1174747054 20:53073365-53073387 ATGAATGGATGGAGGGAGGGAGG - Intronic
1174804185 20:53592722-53592744 CGGACGGGATGGTGGAGAGGCGG - Intronic
1174829966 20:53803583-53803605 ATGAAGGGAGGGAGGGAGGGAGG - Intergenic
1174959537 20:55139541-55139563 CAGAAGGGAGGGAGGGAGGGAGG - Intergenic
1175062811 20:56259192-56259214 GTGGAGGGGTGGTGGGAAGATGG - Intergenic
1175123650 20:56735874-56735896 ATGAAGGGATGGTGGGGGTGGGG - Intergenic
1175828755 20:61950937-61950959 TGGGAGGGAGGGTGGGAAGGAGG - Intergenic
1175984159 20:62755729-62755751 CTGGAGGGAGGGAGGGAGGGAGG - Intronic
1175984180 20:62755787-62755809 CTGAAGGGAGGGATGGAGGGAGG - Intronic
1176286855 21:5022974-5022996 CTGGAAGGAGGGAGGGAAGGCGG + Intronic
1176292169 21:5052254-5052276 ATGAAGGGAAGGAGGGAGGGAGG - Intergenic
1176892294 21:14332497-14332519 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1176913262 21:14594417-14594439 TAGAAGGGTTGGTGGAAAGGGGG + Intronic
1177073176 21:16537302-16537324 CTGAGTGGATCGTGGGAATGAGG - Intergenic
1177176315 21:17704125-17704147 TTCAAGGCATGATGGGAAGGAGG + Intergenic
1177635841 21:23785314-23785336 ATGAAGGGAGGGAGGGAGGGAGG + Intergenic
1177761729 21:25409189-25409211 ATGAAGGGATGGTGTGGATGCGG + Intergenic
1177800718 21:25826077-25826099 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1177820833 21:26029282-26029304 ATGAATGGATGCTGGGAAGCTGG + Intronic
1178163938 21:29950257-29950279 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1178275634 21:31234321-31234343 GGGAAGGGAGGGAGGGAAGGAGG + Intronic
1179315945 21:40244589-40244611 CTGAAGGGATGGGGCGCACGAGG + Intronic
1179403763 21:41108676-41108698 CTGGAGGGAAGCTGGGAGGGGGG + Intergenic
1179819895 21:43930642-43930664 CTGTCGGGATGAGGGGAAGGCGG + Intronic
1179864905 21:44210824-44210846 ATGGAGGGATGGAGGGATGGAGG + Intergenic
1179865090 21:44211400-44211422 ATGAAGGGAAGGAGGGAGGGAGG + Intergenic
1179870326 21:44240501-44240523 CTGGAAGGAGGGAGGGAAGGCGG - Intronic
1180172063 21:46064784-46064806 AGGAAGGGATGGAGGGATGGAGG + Intergenic
1180172067 21:46064792-46064814 ATGGAGGGATGGAGGGAGGGAGG + Intergenic
1180188016 21:46150060-46150082 GTGCAGGGAGGGTGGGGAGGCGG - Intronic
1180316817 22:11283537-11283559 TGGAAGGGATGGAGGGAGGGAGG + Intergenic
1180316829 22:11283573-11283595 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1180338494 22:11599941-11599963 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1180870523 22:19144201-19144223 CTGGAAGGATGGTGGCAAAGAGG - Intronic
1180962346 22:19767575-19767597 GAGACGGGACGGTGGGAAGGTGG - Intronic
1181528523 22:23502970-23502992 ATGGAGGGATGGAGGGATGGAGG - Intergenic
1181528531 22:23502993-23503015 ATGAATGGATGGAGGGATGGGGG - Intergenic
1181748480 22:24972645-24972667 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1182033209 22:27176273-27176295 AAGAAGGGAAGGTGGGCAGGAGG + Intergenic
1182050688 22:27310574-27310596 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1182093963 22:27614045-27614067 ATGGAGGGGTGGGGGGAAGGCGG + Intergenic
1182148161 22:28010295-28010317 CTGTAGGGGTGCTAGGAAGGGGG - Intronic
1182150490 22:28024031-28024053 CAGAAGGGAGGGAGGGAGGGAGG - Intronic
1182164725 22:28161795-28161817 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1182405748 22:30128255-30128277 TTGATAGGATGGTGGGACGGCGG - Intronic
1182566894 22:31206769-31206791 GCCGAGGGATGGTGGGAAGGGGG - Exonic
1182654637 22:31880266-31880288 CTGCAGGAATGGTGGAAAGGAGG - Intronic
1182757339 22:32690669-32690691 GTGGAGGGATGCAGGGAAGGTGG - Intronic
1182782488 22:32879444-32879466 CTGATGTGATGCTGGGGAGGTGG + Intronic
1182899578 22:33886684-33886706 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1183037351 22:35150293-35150315 CTGATTCGATGGTGGGAAGGTGG + Intergenic
1183334168 22:37237218-37237240 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1183349152 22:37325036-37325058 CGGCAGGGAGGGTGGGAAGGGGG - Intergenic
1183513296 22:38248498-38248520 CTAAAGGAAGGGTGGGAGGGAGG - Intronic
1183599834 22:38833411-38833433 CTCAGGGGATGGTTGGATGGGGG - Intronic
1183698797 22:39438162-39438184 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1183729962 22:39612845-39612867 GTGGAGGGATGGAGGGAAGGAGG - Intronic
1183796301 22:40121222-40121244 CGGAAGGGAGGGAGGGAGGGAGG - Intronic
1184120104 22:42444530-42444552 CTGAGGGATTGGTGGGGAGGGGG + Intergenic
1184127713 22:42500161-42500183 CGGATGGGGTAGTGGGAAGGCGG + Intergenic
1184642413 22:45879550-45879572 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1184648009 22:45906571-45906593 CTGATGGGCTGGTGGGCTGGTGG + Intergenic
1184786172 22:46673015-46673037 CTGCGGGGATGGGGGGATGGGGG + Intronic
1185076759 22:48687312-48687334 ATGAATGGATGGTGGACAGGTGG + Intronic
1185151604 22:49167110-49167132 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1185196799 22:49476805-49476827 ATGAAAGGATGGTTGGATGGAGG + Intronic
1185200650 22:49502220-49502242 CTGATGTGATGGTTGGAAGTTGG + Intronic
1185206432 22:49541630-49541652 CAGAAAAGATGGTGGGAAGGGGG - Intronic
949535014 3:4988848-4988870 CTGGAGGGAGGGAGAGAAGGAGG + Intergenic
950374101 3:12556410-12556432 TAGAAGGGACGGTGGAAAGGGGG + Intronic
950484394 3:13264535-13264557 CTGGAGGGAGGGAGGGGAGGAGG - Intergenic
951357007 3:21679690-21679712 AGGAAGGGATGGAAGGAAGGAGG + Intronic
951598164 3:24341145-24341167 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
953256604 3:41296826-41296848 CTGAAGGGAGGTTGAGAGGGAGG + Intronic
953312381 3:41891340-41891362 CTGGAGGGAGGGAGGGAGGGAGG + Intronic
953384691 3:42499880-42499902 CTGAAGCACTGGGGGGAAGGGGG - Intronic
953611308 3:44449695-44449717 CTGAAGTCCTGGTGGGAAGGTGG + Intronic
953900685 3:46840334-46840356 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
954330166 3:49885589-49885611 CTGAAGGGATGGAGGCTATGGGG + Intergenic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954581132 3:51703513-51703535 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
954805596 3:53218180-53218202 TGGATGGTATGGTGGGAAGGGGG - Intergenic
955443062 3:58977893-58977915 CTGAAAGAAGTGTGGGAAGGAGG + Intronic
956201507 3:66710921-66710943 AGGAAGGGATGGAAGGAAGGAGG - Intergenic
956219312 3:66884752-66884774 CAGAAGGGAGGGAGGGAGGGAGG + Intergenic
956266898 3:67406504-67406526 CTGAAGGGCAGTTGGGAAGAGGG + Intronic
956741649 3:72280360-72280382 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
957442783 3:80272132-80272154 CTGAAGGAAGGGAGGGAGGGAGG + Intergenic
957751440 3:84421983-84422005 GTGGTGGGATGGTGGGAGGGGGG + Intergenic
959314736 3:104788854-104788876 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
959368614 3:105494626-105494648 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
959374418 3:105570943-105570965 AGGAAGGGAGGGAGGGAAGGTGG + Intronic
959416647 3:106083999-106084021 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
959456109 3:106563710-106563732 AGGAAGGGAGGGAGGGAAGGGGG + Intergenic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960602563 3:119472100-119472122 CTGAAGGCAGGGTGGTAAGCAGG + Intronic
960847002 3:122013364-122013386 TGGAAGGGATGGTAGGCAGGAGG + Intronic
961173280 3:124814285-124814307 CTGAAGGGAGGGGTGGAAGAAGG + Intronic
961380208 3:126492091-126492113 GTGAGGGGGTGGTGGGAAGGAGG - Intronic
961666305 3:128495245-128495267 TTGAACTGATGGTGGGGAGGAGG + Intergenic
961810598 3:129519545-129519567 CTGCAGGGTGGGCGGGAAGGAGG - Intronic
962234917 3:133699569-133699591 CTGAAGTGTGGGTGGCAAGGAGG + Intergenic
962557135 3:136565039-136565061 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
962724605 3:138210903-138210925 TGGAAGGGAAGGTGGGAAGCTGG + Intronic
963715708 3:148801378-148801400 ATGAAGGGATAGAGGGAAAGAGG - Intronic
963982971 3:151560709-151560731 CTTAAGAGATTGTGGGACGGAGG - Intergenic
964825158 3:160817794-160817816 TTGAAGGGATGGTTTGAAGGAGG + Intronic
964835135 3:160929863-160929885 CTGAAGGAGAGGTGGGAAGGTGG - Intronic
965083887 3:164069463-164069485 CAGGAGGGAAGGAGGGAAGGTGG + Intergenic
965083890 3:164069471-164069493 AAGGAGGGAAGGTGGGAAGGAGG + Intergenic
965404278 3:168250126-168250148 GGGAAGGGATGGGGGGCAGGAGG + Intergenic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965631096 3:170733846-170733868 CTGAATGGATGCTGGGCAGAGGG - Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966337185 3:178881623-178881645 CTGAAGGCATCTTGAGAAGGAGG - Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967013784 3:185463671-185463693 ATGAAGGGAGGTGGGGAAGGAGG - Intronic
967044304 3:185722543-185722565 ATGGTGGGAAGGTGGGAAGGTGG + Intronic
967118244 3:186361151-186361173 CTGCAGTGATGGTGGGGATGGGG + Intronic
967283503 3:187845975-187845997 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
968648002 4:1749451-1749473 GTGAGGGGCTGGTGGGGAGGGGG - Intergenic
968747408 4:2367430-2367452 CTGAAAGGGTGGTGGGGATGGGG + Intronic
968947830 4:3674925-3674947 AGGGAGGGATGATGGGAAGGAGG - Intergenic
969172000 4:5371587-5371609 CTGAAGGGGAGGTGGGAGGCTGG + Intronic
969424953 4:7118687-7118709 ATGGATGGATGGAGGGAAGGAGG + Intergenic
969599987 4:8170602-8170624 CTGCAGAGATGGTGGGCAGCTGG + Intergenic
969882642 4:10187790-10187812 CTGAGGGGACAGTTGGAAGGTGG + Intergenic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
970365064 4:15350128-15350150 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
970383702 4:15535278-15535300 CAGCAGGGATGATGGGAGGGAGG - Intronic
971059881 4:22955597-22955619 CTGATGGGAGGGTGGGAAAGTGG + Intergenic
971103625 4:23497540-23497562 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
971230275 4:24795791-24795813 CTGAGGGGTTAGTGGGGAGGTGG + Intronic
971394321 4:26214510-26214532 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
972164546 4:36266569-36266591 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
972378600 4:38497829-38497851 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
972935901 4:44135053-44135075 CTGAAGTGAAGGTGAGAAGGAGG - Intergenic
973016289 4:45142852-45142874 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
973173522 4:47175040-47175062 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
973204794 4:47548426-47548448 ATGAAGGGACGGAGGGACGGAGG - Intronic
973595340 4:52482772-52482794 CTGTAGGGGTGAGGGGAAGGAGG - Intergenic
973627660 4:52789341-52789363 CTGAAGGGGTTGCAGGAAGGTGG - Intergenic
974095499 4:57359475-57359497 ATGGAGGGAAGTTGGGAAGGAGG + Intergenic
974333545 4:60510375-60510397 AGGAAGGGAGGGTGGGAGGGAGG + Intergenic
975016197 4:69424082-69424104 CAGATGGGAGGGTGGGAGGGGGG - Intergenic
975481686 4:74887942-74887964 TTGCAGAGATGGGGGGAAGGTGG - Intergenic
975884073 4:78943479-78943501 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
976979226 4:91205661-91205683 ATGAAGGGAGGGTAGGAGGGAGG - Intronic
977200755 4:94112804-94112826 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
977290566 4:95160610-95160632 GGGAAGGGAGGGAGGGAAGGAGG - Intergenic
978064124 4:104375088-104375110 CAGAAGGGAAACTGGGAAGGTGG + Intergenic
978199394 4:106007652-106007674 CAGAGGGAATGGTGGGAGGGAGG - Intergenic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979290191 4:118971404-118971426 CTAAAAGGATGGTGGGATGTAGG - Intronic
979506459 4:121502749-121502771 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
979506469 4:121502773-121502795 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
979558267 4:122075635-122075657 GCCGAGGGATGGTGGGAAGGGGG + Intergenic
979563756 4:122130696-122130718 TAGATGGGATGGTAGGAAGGGGG + Intergenic
980091492 4:128447608-128447630 CTGAGGGGGTGGTGTGGAGGTGG + Intergenic
980280584 4:130714306-130714328 ATGAAGGGAGGGAGGGATGGAGG - Intergenic
980285477 4:130773504-130773526 ATGTAGGGATGGTGGTAATGGGG + Intergenic
980401393 4:132290599-132290621 CTGGAGAAATGGTGGGATGGGGG + Intergenic
981012936 4:139944324-139944346 GTGGTGGGATGGGGGGAAGGGGG - Intronic
981092164 4:140743010-140743032 AGGAAGGGATGGAGGGAGGGAGG + Intronic
981191462 4:141869875-141869897 CGGAAGGTATGTAGGGAAGGAGG - Intergenic
981248698 4:142572421-142572443 CTGAAGAGTTGGTGGGAAGTTGG + Intronic
981409300 4:144409973-144409995 AGGAAGGGATGATGGGAAGAAGG + Intergenic
981724179 4:147830364-147830386 ATGAAAGGATGATGAGAAGGGGG - Intronic
981801912 4:148667649-148667671 CCGAGGGGATGGTGGGTAGAAGG - Intergenic
982108088 4:152028768-152028790 CTGGAAGGCTGGTGGGAAGAAGG + Intergenic
982223121 4:153141620-153141642 ATGAAGGGAGGGAGGGAGGGAGG - Intergenic
982406714 4:155028776-155028798 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983497498 4:168459818-168459840 GGGAAGGGAGGGAGGGAAGGAGG + Intronic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
983962410 4:173770824-173770846 AGGAAGGGAGGGTGGGAGGGAGG - Intergenic
984123901 4:175781298-175781320 CTGAAGAAATGAAGGGAAGGGGG + Intronic
984183799 4:176517373-176517395 CTGAAGGGCTGACTGGAAGGAGG - Intergenic
984224965 4:177023602-177023624 AAGAAGGGATGGAGGGAGGGAGG + Intergenic
984255962 4:177390405-177390427 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
984863627 4:184261621-184261643 TTGGGTGGATGGTGGGAAGGGGG + Intergenic
985073723 4:186192080-186192102 CTGATCGGAGGGTGGGAACGGGG - Intronic
985178461 4:187228935-187228957 CTGAAGTTATGGTCTGAAGGAGG + Intergenic
985816318 5:2130693-2130715 CAAAATGGACGGTGGGAAGGAGG + Intergenic
985929820 5:3048203-3048225 TTGAAAGGATGGTGGGATGGAGG + Intergenic
985958042 5:3278986-3279008 ATGGAGGGATGGTGGGAGGGAGG - Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986736589 5:10672961-10672983 CTGCAGGGATGGCAGGAAGCTGG - Intergenic
987061347 5:14246885-14246907 CTGAAGGGGAGTTGTGAAGGTGG - Intronic
987954884 5:24726404-24726426 CTGAAGGGAAGGGTGGAAGGAGG + Intergenic
988209473 5:28184673-28184695 GTGGTGGGATGGGGGGAAGGGGG - Intergenic
988346074 5:30039471-30039493 AAGAAGGGATGGAGGGAGGGAGG + Intergenic
988816844 5:34842573-34842595 CAAAAGAGATGGTGAGAAGGGGG + Intronic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
988992597 5:36686042-36686064 CTGCAGGCAGGGTGGGGAGGAGG - Intronic
989774091 5:45181989-45182011 CCGAAGTCCTGGTGGGAAGGTGG - Intergenic
990087582 5:51997608-51997630 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
990356851 5:54976133-54976155 CTGAAGGGATGGTTGGTGGAAGG - Intergenic
990507494 5:56458963-56458985 AGGAAGGGAAGGAGGGAAGGAGG - Intronic
990623751 5:57588691-57588713 GTCATGGGATGGGGGGAAGGGGG + Intergenic
990762315 5:59143165-59143187 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
990816752 5:59794477-59794499 CAGGAGGGAGGGAGGGAAGGAGG - Intronic
990853660 5:60237976-60237998 GTGAAGGGAGGTAGGGAAGGAGG - Intronic
990886668 5:60602144-60602166 AAGCAGGGAAGGTGGGAAGGAGG + Intronic
990986467 5:61645040-61645062 CTGAAGAGGTGGTAGAAAGGAGG + Intronic
991957348 5:72008244-72008266 GGGAAGGGATGGAGGGTAGGAGG - Intergenic
992205128 5:74423505-74423527 GGGAAGGGATGGGGGAAAGGAGG + Intergenic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
993607186 5:90006208-90006230 AGGAAGGAGTGGTGGGAAGGTGG + Intergenic
994122479 5:96132175-96132197 CAGAAGGGAGGGAGGGAAAGAGG + Intergenic
994730985 5:103490482-103490504 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
995404070 5:111774238-111774260 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
995759626 5:115549550-115549572 CTGAAAGGCTGATGGGGAGGAGG + Intergenic
996319152 5:122194264-122194286 CCGGAGGGATGCTGGGAGGGAGG + Intergenic
996697566 5:126415513-126415535 AGGAAGGAAGGGTGGGAAGGAGG + Intronic
996853354 5:127977627-127977649 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
997419500 5:133754967-133754989 TTGAAGGAAGGGTGGGAAGTGGG - Intergenic
997552391 5:134764814-134764836 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
997599943 5:135132291-135132313 CTGCATGGGTGGTGGGAAGTGGG - Intronic
997812771 5:136988405-136988427 CTGGAGGTAAGGTGGGATGGAGG - Exonic
997820717 5:137063290-137063312 CTGAAGAGATGGTGGAAGGTGGG - Intronic
998371077 5:141661896-141661918 CTCAGGGGGAGGTGGGAAGGGGG - Intronic
998576570 5:143323770-143323792 CCGGAGGGATGGGGGGCAGGGGG + Intronic
998638907 5:143987449-143987471 AGGAAGGAAAGGTGGGAAGGTGG - Intergenic
999267569 5:150276798-150276820 AGGAAGGGATGGTTGGACGGGGG + Intronic
999632584 5:153585933-153585955 CTGATGGGGTGGTGGTGAGGAGG + Intronic
1000038358 5:157466072-157466094 AGGAAAGGATGGTGGGAGGGAGG + Intronic
1000127557 5:158261376-158261398 CTGAAAGGAAGGGGAGAAGGGGG + Intergenic
1000520999 5:162294170-162294192 AGGAAGGGATGGAGGGAAGGAGG + Intergenic
1000696172 5:164387175-164387197 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1000976815 5:167774179-167774201 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1001066456 5:168538594-168538616 TTGAAGGGATGGTGAAAAGATGG - Intergenic
1001089024 5:168723333-168723355 GTGGATGGATGGTGGGAGGGAGG - Intronic
1001168193 5:169390974-169390996 ATGATGTGATGGTGAGAAGGAGG + Intergenic
1001545989 5:172570821-172570843 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1001572778 5:172741414-172741436 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1001686397 5:173597716-173597738 ATGGAGGGATGGAGGGAGGGAGG - Intergenic
1001722224 5:173866402-173866424 CTGTAGAAATGGTTGGAAGGCGG + Intergenic
1002297647 5:178240323-178240345 CCAAAGGGAAGGTGGGGAGGGGG + Intronic
1002563155 5:180096223-180096245 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1002643011 5:180639520-180639542 ATGAATGGATGGTGGAAAGGTGG + Intronic
1003860741 6:10319629-10319651 CCGTAGGGATGGTGGGACGTGGG + Intergenic
1004751408 6:18565917-18565939 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1004842854 6:19606637-19606659 ATGAAGGGAGGGAGGGAGGGAGG + Intergenic
1005714074 6:28530485-28530507 CTGAAGGGAGGGGAAGAAGGTGG - Intronic
1006093035 6:31639423-31639445 CTGAAGGGATCCAGGGAAGAGGG + Intronic
1006338278 6:33432119-33432141 CAGAAGGGAAGTTGGGGAGGGGG - Intronic
1006420036 6:33927331-33927353 GTGAAGGGCTCGTGGGGAGGGGG - Intergenic
1007304243 6:40891966-40891988 GTGAAGGGAAGCTGGGAAAGCGG + Intergenic
1007400129 6:41598659-41598681 CTGATGGGATCCTGGGGAGGGGG + Intronic
1007482446 6:42158918-42158940 CTGAAGGGTTAGTGGGGAGCAGG + Intronic
1007705571 6:43788722-43788744 AAGAAGGGATGGTGAAAAGGAGG - Intergenic
1008038469 6:46772486-46772508 CTGGAGGGAGTGTGGGACGGTGG - Intergenic
1008288412 6:49682815-49682837 AGGAAGGGATGGAGGGAAGGAGG - Intergenic
1008418609 6:51271709-51271731 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1008481413 6:51989846-51989868 ATGAAGGGATAGGGGGAGGGAGG + Intronic
1010168131 6:72941399-72941421 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
1010168140 6:72941427-72941449 ATGAAGAGAGGGAGGGAAGGAGG - Intronic
1010168151 6:72941471-72941493 AAGAAGGGAGGGAGGGAAGGAGG - Intronic
1010168180 6:72941570-72941592 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1010177849 6:73050325-73050347 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1010390852 6:75335505-75335527 ATGAAGGGAAGGAGGGAGGGAGG - Intronic
1010660253 6:78562220-78562242 CAGAAGGGAGGGTGGGGAGTTGG + Intergenic
1011017783 6:82777703-82777725 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1011399255 6:86941884-86941906 AGGAAGGGAAGGAGGGAAGGAGG + Intronic
1011653001 6:89524297-89524319 CTCAGGGGAAGGTGGGAGGGGGG - Intronic
1012359404 6:98358662-98358684 CAGCAAGGATGGTGGGAAGGAGG + Intergenic
1013059676 6:106620962-106620984 CAGAAGGGAGGGCAGGAAGGGGG - Intronic
1013123275 6:107159310-107159332 CGGAAGGGAGGGAGGGAAGGAGG + Intronic
1013800768 6:113939293-113939315 CGGGAGGCATGGTGGGAGGGGGG + Exonic
1014180162 6:118375323-118375345 GGGAAGGGATGGAGGGAGGGAGG + Intergenic
1014835058 6:126151715-126151737 TGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1014964531 6:127730509-127730531 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1015383942 6:132600886-132600908 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1015384012 6:132601106-132601128 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1015505603 6:133983539-133983561 CTGAACGGCTGGTGGGGAGTGGG + Intronic
1015514159 6:134068353-134068375 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
1015715694 6:136189730-136189752 CTGGAGGGATGGTGGGGTGACGG - Intronic
1015767756 6:136737235-136737257 GAGACGGGAGGGTGGGAAGGGGG + Intronic
1015890496 6:137965346-137965368 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1016317657 6:142808313-142808335 GTGAATGGATGGAAGGAAGGAGG + Intronic
1016456868 6:144240061-144240083 GTGAAGGGATGGGGGGAAAATGG - Intergenic
1016586248 6:145689966-145689988 CTGATGGTCGGGTGGGAAGGAGG - Intronic
1016762495 6:147753689-147753711 GTGAGGGGCTGGGGGGAAGGTGG - Intergenic
1016842039 6:148534304-148534326 CTGGAGTGATGGTGGGAGAGAGG - Intronic
1017279125 6:152604765-152604787 TTGTAGGGACAGTGGGAAGGGGG - Intronic
1017681191 6:156865792-156865814 GTGGAGGGAAGGAGGGAAGGAGG - Intronic
1017790279 6:157792095-157792117 AGGAAGGGATGGAGGGAAGGAGG - Intronic
1018953535 6:168393538-168393560 CAGAAGGGATGGGTGGAAGTGGG + Intergenic
1019059041 6:169242672-169242694 AAGATGGGAAGGTGGGAAGGTGG - Intronic
1019059067 6:169242746-169242768 AAGATGGGAAGGTGGGAAGGTGG - Intronic
1019059083 6:169242795-169242817 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059106 6:169242861-169242883 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059165 6:169243042-169243064 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059182 6:169243092-169243114 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019173758 6:170149381-170149403 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019173847 6:170149846-170149868 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019539893 7:1546797-1546819 CTGGAGGGAGGATGGGAAGTGGG + Exonic
1020355475 7:7271081-7271103 CCCAAAGGATGGTGGGAAGAAGG + Intergenic
1020454603 7:8357493-8357515 TGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1020855810 7:13421283-13421305 CTGCAGTGATGGTGATAAGGTGG + Intergenic
1021128609 7:16883350-16883372 ATGGAGGGATGGAGGGATGGAGG - Intergenic
1021329940 7:19324012-19324034 TAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1021602064 7:22374054-22374076 GTGAGGAGATGGTGAGAAGGTGG - Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1021971057 7:25966583-25966605 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1022075623 7:26966878-26966900 CTGTAAGGATGGTGGGAGTGGGG + Intronic
1022941781 7:35248912-35248934 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1023592369 7:41793613-41793635 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1023840914 7:44097028-44097050 CTGGAGGGAGGAGGGGAAGGTGG + Intergenic
1024144955 7:46504717-46504739 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
1024254724 7:47532067-47532089 CAGCAGGGATGGTGGGCGGGGGG - Intronic
1024604396 7:51012427-51012449 CAGAAGGGAAGAAGGGAAGGTGG + Intergenic
1024713955 7:52053290-52053312 CTGGAGGGAGGGAGGGAGGGAGG - Intergenic
1026300170 7:69090817-69090839 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1026571910 7:71538785-71538807 TTGAAGGGAGGAAGGGAAGGAGG + Intronic
1026917779 7:74132528-74132550 AGGAAGGGAGGGCGGGAAGGAGG - Intergenic
1026981346 7:74528667-74528689 CTGAAAGGAGGGAGGGAGGGAGG + Intronic
1027164084 7:75822442-75822464 CTGAAGGGATGCTGGTCTGGTGG - Intronic
1027416882 7:77983408-77983430 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1027416908 7:77983480-77983502 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1027733572 7:81905206-81905228 AGGAAGGGAAGGAGGGAAGGGGG - Intergenic
1027902626 7:84136931-84136953 AGGAAGGGAGGGAGGGAAGGAGG + Intronic
1027969912 7:85066303-85066325 GAGAAGGGATGGTGAGAAGGAGG + Intronic
1028371791 7:90100327-90100349 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
1028493491 7:91439975-91439997 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1029575832 7:101402671-101402693 GTGAAAGGAGGGAGGGAAGGAGG - Intronic
1029607789 7:101609488-101609510 GGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1029673103 7:102047493-102047515 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1029941400 7:104484357-104484379 GTGAAGGGAAGGAGGGAAAGGGG - Intronic
1030031473 7:105373814-105373836 CTGATGGGCAGGTGGGAAGCTGG - Intronic
1030102204 7:105956356-105956378 CTGACTGGATGGATGGAAGGAGG + Intronic
1030660593 7:112214692-112214714 GTGAAGGGAGGTTGGGAAAGAGG + Intronic
1031214595 7:118873943-118873965 CTAGAGGGAAGGTGGGAAGGGGG - Intergenic
1031464408 7:122090934-122090956 GTGAAGGGGTTGGGGGAAGGAGG - Intronic
1031595941 7:123649403-123649425 ACGAAGGGAGGGAGGGAAGGAGG - Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1031920249 7:127595125-127595147 ATGAGGGGATAGTGGGAAAGTGG + Intronic
1032275745 7:130453749-130453771 CTAAAAGGAAGGAGGGAAGGAGG - Intergenic
1032508675 7:132454946-132454968 CTGAAGGAGCTGTGGGAAGGTGG - Intronic
1032967564 7:137118605-137118627 GTGATGGGGTGGGGGGAAGGGGG - Intergenic
1033263538 7:139865233-139865255 CTGAAGGGTTGGTGGGGAAATGG - Intronic
1034131084 7:148718377-148718399 TTGTGGGGATGGTGGGAATGGGG - Intronic
1034277210 7:149829206-149829228 CTGAGGGGACTGTGGGAAGAGGG - Intergenic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034462527 7:151205663-151205685 CTGAAGGGACTGTGGGTGGGTGG + Intergenic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034819394 7:154202771-154202793 CTCAAGGCATGGAAGGAAGGAGG - Intronic
1035112414 7:156494230-156494252 CTGATGGGATGCTGGGAGAGAGG - Intergenic
1035450521 7:158974288-158974310 CTGAAAGGAGGGCGGGGAGGCGG - Intergenic
1035636065 8:1145269-1145291 CTGGAGGGATGGTGGGTGGGTGG - Intergenic
1035816993 8:2551806-2551828 CAGTAGTGATGGTGGGTAGGGGG + Intergenic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1035853851 8:2951267-2951289 CTGAAGGAACTGTGGGAAGGGGG + Exonic
1036154147 8:6326126-6326148 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1036614906 8:10380720-10380742 CTGGAGAGATGGATGGAAGGAGG + Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1036799240 8:11777530-11777552 CTGCAGGGAGGGAGGAAAGGGGG - Intronic
1037018621 8:13940454-13940476 TTAAAGGCATGGAGGGAAGGGGG + Intergenic
1037098358 8:15013523-15013545 CTGAAGGAATAAAGGGAAGGAGG - Intronic
1037540381 8:19865255-19865277 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
1037709223 8:21342346-21342368 CTGGAGGGATGGAGGGGTGGAGG + Intergenic
1037774381 8:21823303-21823325 GAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1037841095 8:22245563-22245585 TGGAACGGATGGAGGGAAGGCGG - Exonic
1037909921 8:22738248-22738270 TTCAAGGGATGGAGGGAAAGAGG - Intronic
1038048356 8:23786394-23786416 CTGGAGGGAAGGTGGGAATGAGG + Intergenic
1038476926 8:27875178-27875200 GTGAAGGGAGGGAGGGAGGGAGG - Intronic
1038594401 8:28873831-28873853 AGGAAGAGATAGTGGGAAGGGGG - Intronic
1039644189 8:39262616-39262638 AGGGAGGGATGGAGGGAAGGAGG - Intronic
1039762206 8:40589956-40589978 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1039910972 8:41826531-41826553 CTGAGGTGCTGGTGGGACGGTGG - Intronic
1040839799 8:51772683-51772705 CTGTGTGGAAGGTGGGAAGGAGG + Intronic
1041282862 8:56229048-56229070 ATAAAGGGATGCTGGGGAGGAGG + Intergenic
1041449153 8:57989047-57989069 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1041607287 8:59797216-59797238 CTAAAGGGTTAGTGGGAAAGTGG + Intergenic
1041679751 8:60576815-60576837 CTTAAGGGATGGTGGGGGAGAGG - Intronic
1042148782 8:65759411-65759433 CTGAAGCCAGGGTGGGAAGTGGG - Intronic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1042547190 8:69961303-69961325 CTGAGAGGAGGGTGGGAATGGGG - Intergenic
1042745111 8:72098787-72098809 CTGAAAGAATGGAGGGAAGCTGG - Intronic
1044555406 8:93557285-93557307 GTGCAGGGATGCTGGGATGGAGG - Intergenic
1044562155 8:93623088-93623110 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1044644495 8:94424052-94424074 CTGGTGGGATGGTGGCAGGGAGG - Intronic
1044953164 8:97452956-97452978 AGGAAGGGATAGAGGGAAGGAGG + Intergenic
1045411984 8:101929262-101929284 AGGAAGGGATGGAGGGAGGGAGG + Intronic
1045523272 8:102921569-102921591 AAGAAGGGAAGGAGGGAAGGAGG - Intronic
1045529880 8:102974384-102974406 CGGGAGGAAGGGTGGGAAGGAGG - Intronic
1045789379 8:105964116-105964138 AAGAAGGGAAGGAGGGAAGGAGG + Intergenic
1045896233 8:107221212-107221234 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1046714933 8:117557157-117557179 CTGAAGACATGATGGGAAAGGGG - Intergenic
1046859114 8:119070513-119070535 ATGGAGGGAGGGAGGGAAGGAGG - Intronic
1046922574 8:119748141-119748163 AGGAAGGGAGGGAGGGAAGGGGG + Intronic
1046958266 8:120083666-120083688 CTGAAGGGACTGTGGGAAGAAGG - Intronic
1047018570 8:120750147-120750169 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1047517507 8:125568080-125568102 ATGCATGGATGGTTGGAAGGTGG + Intergenic
1048013478 8:130477397-130477419 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1048044035 8:130756571-130756593 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1048258805 8:132927275-132927297 TTGAATGGATGGAGGGAGGGAGG - Intronic
1048304080 8:133271400-133271422 ATGAAAAGATGGTGGGGAGGGGG - Intronic
1048361624 8:133701989-133702011 CTGAGGTGATGGTGGGGAGGGGG + Intergenic
1048578536 8:135711743-135711765 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1048690292 8:136955665-136955687 AAGAAGGGAGGGTGGGAGGGAGG - Intergenic
1048989290 8:139751931-139751953 CTGGATGGATGGTGGGTAGATGG - Intronic
1049023054 8:139970858-139970880 CTGAAGGGATGGGGGCCACGTGG + Intronic
1049378534 8:142300938-142300960 CAGAGGGGAGGGTGGGCAGGAGG + Intronic
1049385527 8:142341245-142341267 GTGCAGGGAGGCTGGGAAGGGGG - Intronic
1049469797 8:142770203-142770225 AGGAAGGTCTGGTGGGAAGGAGG + Intronic
1049582286 8:143418227-143418249 CTGAAGGGTGGGTGGGAGGATGG - Intergenic
1049708600 8:144053848-144053870 CTGCAGGGAAGGGGGGATGGAGG - Intronic
1050806026 9:9679243-9679265 GTGAAGGGAGTGGGGGAAGGAGG - Intronic
1051355360 9:16235294-16235316 CAGCGGAGATGGTGGGAAGGGGG - Intronic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1051440251 9:17075485-17075507 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1051858760 9:21600240-21600262 AAGAAGGGAGGGAGGGAAGGAGG + Intergenic
1051897798 9:22006419-22006441 CTGAAGGTGGGGTGGGAAAGTGG - Intronic
1051952861 9:22658426-22658448 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1052274388 9:26661068-26661090 ATGAAGGGATGGAGGAAAGGAGG + Intergenic
1052342917 9:27380766-27380788 ATGAGGGGGTGGTGGGCAGGTGG - Intronic
1052503001 9:29316909-29316931 CTTAAGGGAGGGAGGGAAGGGGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1055797418 9:79989865-79989887 CTGAAGGGTTCGTGGCAGGGGGG - Intergenic
1055822067 9:80277880-80277902 TAGAAGGGAAGGAGGGAAGGAGG - Intergenic
1056292734 9:85160339-85160361 CTGCAGGGAGGGTGGGAGGCAGG - Intergenic
1056292874 9:85161310-85161332 CTGCAGGGAGGGTGGGAGGCAGG - Intergenic
1056325965 9:85479314-85479336 AGGAAGGGAAGGAGGGAAGGAGG - Intergenic
1056704394 9:88939754-88939776 CTGGAGGGAAGGTGGGAGAGGGG - Intergenic
1057220696 9:93256330-93256352 CTGGAGGGACGGAGGGCAGGCGG - Exonic
1057292779 9:93818098-93818120 GTGAAGGGAAGGAGGGAAAGAGG + Intergenic
1057292934 9:93818675-93818697 AGGAAGGGATGGAGGGAGGGAGG + Intergenic
1057316890 9:93975304-93975326 CTGAAGGGAGGATGGGATAGAGG + Intergenic
1057414244 9:94847213-94847235 CTGCAGGCATGGTGGGAGGGTGG - Intronic
1057532002 9:95857179-95857201 CAGAAGTGATGGGGGGGAGGAGG + Intergenic
1057817165 9:98304225-98304247 CTGGAGGGATGGTGGGGGGAAGG + Intronic
1058603854 9:106699940-106699962 CTGAAGGGAGCATGGGAAGAGGG - Intergenic
1058737231 9:107904891-107904913 CTGAAAGAATGCTTGGAAGGAGG + Intergenic
1058960477 9:109988621-109988643 TCGAAGGGAGGGAGGGAAGGAGG + Intronic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059542545 9:115144437-115144459 GTGAAGGGAAAGGGGGAAGGGGG - Intronic
1060467937 9:123924251-123924273 CTGAAGGGTTTGGGGGAATGAGG + Intronic
1060779991 9:126404481-126404503 TGGAAGGGCTGGTGGGTAGGTGG + Intronic
1060927802 9:127467439-127467461 CTTAAGGGAGGGAGGGAAGGGGG + Intronic
1061036759 9:128118559-128118581 ATGGAGGGATGCTGGGATGGAGG + Intergenic
1061036822 9:128118811-128118833 GTGCAGGGATGGAGGGATGGAGG + Intergenic
1061141198 9:128768047-128768069 ATGAAAGGATGGCAGGAAGGTGG + Intronic
1061228848 9:129300434-129300456 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1061255643 9:129453319-129453341 ATGGAGGGATGGAGGGATGGGGG + Intergenic
1061380011 9:130250081-130250103 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1061462332 9:130750380-130750402 AGGAAGGGAAGGAGGGAAGGAGG - Intronic
1061632463 9:131881767-131881789 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1061664111 9:132150330-132150352 AGGAAGGGCAGGTGGGAAGGAGG + Intergenic
1061876384 9:133546227-133546249 CTGCAGGGGTGGTGGGGAGTGGG + Intronic
1061963040 9:133998057-133998079 ATGGAGGGATGGATGGAAGGAGG - Intergenic
1062010837 9:134265821-134265843 ATGAAGGTAGGGAGGGAAGGAGG - Intergenic
1062022950 9:134327638-134327660 CTGCAGGGAGGGTGGGCAGGAGG - Intronic
1062153276 9:135032373-135032395 CTGAATGGATGGTGGGCATGAGG - Intergenic
1062166576 9:135110760-135110782 CTGAATGGGTGGTGGGAAAGAGG - Intronic
1062227201 9:135459416-135459438 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1062264062 9:135678799-135678821 CTGGAGGGATGGGGGCAGGGTGG - Intergenic
1062475809 9:136726614-136726636 CTGAAGGGATAGTGGGAAGGTGG - Intergenic
1062513268 9:136919678-136919700 ATGAAGGGATGAAGGGAAGAAGG - Intronic
1062720012 9:138035591-138035613 ATCAAGGGAAGGAGGGAAGGAGG - Intronic
1203365123 Un_KI270442v1:249472-249494 TGGAAGGGATGGAGGGAGGGAGG + Intergenic
1185479706 X:437334-437356 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1185700653 X:2228075-2228097 GGGAAGGGAGGGAGGGAAGGAGG + Intronic
1186079293 X:5912897-5912919 CAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186396882 X:9218381-9218403 CTCAAGGTTTGGTGGGGAGGTGG + Intergenic
1186927468 X:14350905-14350927 CGGAGGGGCTGGTGGGAAGGTGG + Intergenic
1187354474 X:18554210-18554232 GTCATGGGATGGGGGGAAGGGGG - Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187767397 X:22657984-22658006 TAGAAGGGTGGGTGGGAAGGTGG + Intergenic
1188784233 X:34324470-34324492 CAGGAGGGAAGGTTGGAAGGAGG + Intergenic
1189291338 X:39887987-39888009 CTGTAGGGATGGTGGGTGGCTGG + Intergenic
1190245384 X:48687338-48687360 GAGAAGGGCTGGTGGGTAGGTGG + Intronic
1190327044 X:49212905-49212927 CTGGAGGGATGGAGGGACAGAGG + Intronic
1190787828 X:53669798-53669820 CTGAAGTAATGGTGTGAAGTAGG - Intronic
1191188131 X:57635251-57635273 GTTATGGGGTGGTGGGAAGGGGG + Intergenic
1192099488 X:68248955-68248977 GTGGAGGGATGATGGGGAGGTGG + Intronic
1192141780 X:68652410-68652432 AGCCAGGGATGGTGGGAAGGTGG + Intronic
1192196617 X:69033017-69033039 CTGGAGGGATGGTGGGGGTGGGG - Intergenic
1192539800 X:71958237-71958259 ATCAAGGCATGGTGGGATGGAGG - Intergenic
1192544118 X:71998583-71998605 GTGAAGGGCTGGAGAGAAGGGGG + Intergenic
1192683575 X:73280359-73280381 CTGGGGGGAAGGTGGGGAGGGGG + Intergenic
1192725099 X:73741673-73741695 CTGAAGTCATAGTGGGAAGAAGG - Intergenic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1194679724 X:96837376-96837398 AGGAAGGGAGGGAGGGAAGGAGG - Intronic
1194816252 X:98445609-98445631 CTGAGGGGTAGGTTGGAAGGGGG + Intergenic
1194831268 X:98625232-98625254 AAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1195009611 X:100722623-100722645 TTTAAAGGCTGGTGGGAAGGAGG - Intronic
1195036453 X:100974384-100974406 GGGAAGGGAGGGAGGGAAGGGGG - Intronic
1195352099 X:104005556-104005578 GTGAATGGGTGGTGGGCAGGAGG - Intergenic
1195538202 X:106033053-106033075 CTAATGGGACAGTGGGAAGGGGG + Exonic
1195892717 X:109712989-109713011 AAGAAGGGAGGGAGGGAAGGAGG + Intronic
1196830091 X:119768971-119768993 ATGAAGGGAAGGAGGGAAGATGG - Intergenic
1197850100 X:130849363-130849385 TTGAAGGGATGGTGGGGTGGAGG + Intronic
1197904127 X:131405780-131405802 CTGAAGGTGTGGTGGGGTGGGGG - Intergenic
1197942462 X:131803692-131803714 CTGAAGGGCCGGGGGGATGGAGG - Intergenic
1198077104 X:133204379-133204401 CAGAAGGGATGGAAGGAACGTGG + Intergenic
1198421418 X:136473248-136473270 AGGAAGGGTAGGTGGGAAGGAGG + Intergenic
1198855219 X:141008328-141008350 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1198876797 X:141236817-141236839 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1198907474 X:141579045-141579067 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1198972098 X:142293356-142293378 ATCAAGTGATGGCGGGAAGGAGG + Intergenic
1199046578 X:143181247-143181269 AGGAAGGGAAGGAGGGAAGGAGG + Intergenic
1199399680 X:147383244-147383266 CTGAAGGAATGGTGGCAGGGTGG + Intergenic
1199766509 X:150945490-150945512 ATGAAGGCAGGGTGGGAAGTAGG - Intergenic
1200310752 X:155074503-155074525 CACAAAGGATTGTGGGAAGGGGG - Intronic
1200738859 Y:6831520-6831542 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1201073606 Y:10170918-10170940 AGGAAGGGAGGGAGGGAAGGAGG - Intergenic
1201146293 Y:11067111-11067133 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1201146395 Y:11067425-11067447 AGGAAGGGAGGGAGGGAAGGAGG + Intergenic
1201515208 Y:14812970-14812992 GGGAAGGGAAGGAGGGAAGGAGG - Intronic
1201652282 Y:16302743-16302765 ATGAAGGGAAGGAGGGAAGGAGG + Intergenic
1201688940 Y:16741047-16741069 CAGAAGGGATCGGGGGAGGGAGG - Intergenic