ID: 1149737967

View in Genome Browser
Species Human (GRCh38)
Location 17:59014536-59014558
Sequence AATTCCAACTATAAGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149737964_1149737967 23 Left 1149737964 17:59014490-59014512 CCTAGGGGAGAGATAAACGTGTT 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1149737967 17:59014536-59014558 AATTCCAACTATAAGTTTTGAGG 0: 1
1: 0
2: 0
3: 23
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149737967 Original CRISPR AATTCCAACTATAAGTTTTG AGG Intronic
900702303 1:4055866-4055888 ATTTCAACCTATGAGTTTTGCGG - Intergenic
907131891 1:52104541-52104563 AATACCAACTATAAGGATAGTGG - Intergenic
907770363 1:57455817-57455839 TCTTCCAACTCTAAGTTCTGTGG - Intronic
908563748 1:65333180-65333202 AATTCCCACTATTAATTTGGGGG - Intronic
908696353 1:66846484-66846506 AATTCCAACTAAAAGTACTAAGG + Intronic
909773712 1:79458195-79458217 AATTTAAACTATAAATTTTGGGG - Intergenic
909848677 1:80433147-80433169 AATTCAAAATAGCAGTTTTGAGG - Intergenic
910133777 1:83941673-83941695 AATTCCAAAAATAGGTTTAGAGG + Intronic
910546789 1:88426918-88426940 AATTCAAAATATATGTTTTGAGG + Intergenic
911020772 1:93385651-93385673 AGTTTCAACAATAAATTTTGGGG - Intergenic
911341292 1:96642037-96642059 AATTTCAAATATAAATTTTAAGG - Intergenic
911944240 1:104085912-104085934 CATTTAAACTATAGGTTTTGAGG - Intergenic
913042663 1:115042134-115042156 AATTCAAAATAGATGTTTTGAGG + Intergenic
915258535 1:154656055-154656077 AATTATAACTTTATGTTTTGGGG - Intergenic
915616519 1:157043672-157043694 AATTCAAACTCTAAGCTTGGAGG + Intronic
917657571 1:177141810-177141832 AACTCCAACAATAAGTATTTTGG + Intronic
918510563 1:185309187-185309209 AATTATAATTATAAGTATTGTGG + Intronic
918732526 1:188015870-188015892 ATTTCAAAATATAAATTTTGAGG + Intergenic
918872427 1:189992884-189992906 AATTAAAACTATAAATTTTGGGG + Intergenic
919098452 1:193064286-193064308 AAGACCAACTATATGTTTAGAGG - Intronic
920321043 1:205122737-205122759 AATTCCTACTATAAATGCTGTGG + Intergenic
921236626 1:213138289-213138311 AAAACCAAATAGAAGTTTTGTGG + Intronic
921696564 1:218217454-218217476 AATTCCAGCTTTTAGTTTTCTGG - Intergenic
921775179 1:219089376-219089398 AATTCAAAATAGAAATTTTGAGG + Intergenic
921823337 1:219641959-219641981 AATTCAAACTAGTTGTTTTGAGG + Intergenic
921895590 1:220396561-220396583 ATTTCCTACTGTAAGATTTGAGG - Intergenic
923215883 1:231847375-231847397 GATTCAACATATAAGTTTTGGGG + Intronic
923270484 1:232351183-232351205 AATTCTAAGTTTAACTTTTGAGG - Intergenic
924256439 1:242187882-242187904 ATTTCTAACTGTAACTTTTGTGG - Intronic
1062763071 10:41999-42021 AATTCCCACTTTCAGTTTTTTGG - Intergenic
1063019181 10:2109172-2109194 ACTTCAAACAATAACTTTTGTGG - Intergenic
1063254607 10:4312788-4312810 ATTTCCAACTACATGTCTTGGGG + Intergenic
1064140996 10:12790265-12790287 AATTCCTTCTCTAAGGTTTGGGG - Intronic
1065213649 10:23428758-23428780 AAGTCAAACAATTAGTTTTGAGG + Intergenic
1065426776 10:25614568-25614590 AATTCAAAATATCTGTTTTGTGG - Intergenic
1065496516 10:26334970-26334992 AATCCAAACTAGCAGTTTTGAGG - Intergenic
1066166616 10:32795500-32795522 AATTCAAAATAGAAGTTTTAAGG - Intronic
1066216391 10:33292495-33292517 AATTCCAAATATAAGTAGAGAGG + Intronic
1068633865 10:59326871-59326893 TATTGCAATTTTAAGTTTTGTGG + Intronic
1068766631 10:60771697-60771719 AATTTCAACTATGAATTTTGAGG - Intergenic
1071537189 10:86443554-86443576 AATTTTAACTAAAAGTTTTATGG - Intronic
1073234462 10:102002058-102002080 TATTCCAGTTATAAGTTCTGTGG - Exonic
1074203716 10:111262107-111262129 AATTCTAAAAATAATTTTTGGGG - Intergenic
1075652943 10:124141527-124141549 ATTTCAAAATACAAGTTTTGAGG + Intergenic
1076143436 10:128097607-128097629 CATTCCTACTGAAAGTTTTGAGG + Exonic
1078709827 11:13780212-13780234 AATTCCAGGTTTAATTTTTGAGG - Intergenic
1079653536 11:22960755-22960777 TCTTCGAACTAAAAGTTTTGAGG + Intergenic
1080134818 11:28842324-28842346 AATTCTAACTATTTATTTTGTGG - Intergenic
1081040336 11:38201942-38201964 AATTCCAAATAAAAGTTTTAGGG + Intergenic
1081473750 11:43403513-43403535 AATTACAAAGAAAAGTTTTGAGG - Intronic
1085840396 11:80005003-80005025 GATTCCATCTATTAATTTTGGGG + Intergenic
1086160803 11:83719731-83719753 AATTACAACGAGAAGTTTGGCGG + Intronic
1086524501 11:87710029-87710051 AATTCAAACTAGTTGTTTTGAGG - Intergenic
1087350809 11:97029911-97029933 ATTTCCAACTTTAAGTTTATGGG + Intergenic
1088611893 11:111585360-111585382 ATTTCCAAAGATAAGATTTGGGG + Intergenic
1089099421 11:115949279-115949301 AATTCCAACTGAGAGTTTTAGGG + Intergenic
1090470106 11:126973078-126973100 ACTGCCAACTCTAAGTTTTGAGG + Intronic
1090673017 11:128963715-128963737 ATTTCCAACCACAAATTTTGTGG - Intergenic
1091346954 11:134861473-134861495 AATTCCATGTATAAATTATGTGG - Intergenic
1093130833 12:15390186-15390208 AATTCCAACCTTAAGTAATGGGG - Intronic
1093184408 12:16003386-16003408 ACTTCCACCTATGAATTTTGGGG + Intronic
1093650339 12:21636000-21636022 AATTCAAAACATAAGTATTGGGG - Intronic
1095244728 12:39906217-39906239 AATTCCAACTATCATTTATTAGG + Intronic
1095872161 12:47040765-47040787 AACTCCAACTATAACTTTGTAGG + Intergenic
1098618886 12:72566359-72566381 AGTTATAACTATAAGGTTTGGGG - Intronic
1098705749 12:73686184-73686206 AATTCAAACTAGCTGTTTTGAGG + Intergenic
1099024651 12:77449417-77449439 AATTCAAAATATCTGTTTTGAGG + Intergenic
1100153186 12:91766634-91766656 AAATTCAACTATAAATTTTTTGG - Intergenic
1100909016 12:99337429-99337451 AATTCCAAATAGCTGTTTTGAGG - Intronic
1103501547 12:121406921-121406943 AATTTCAACTTTTAGATTTGGGG + Intronic
1105952919 13:25247935-25247957 AATTCCAAGTGATAGTTTTGGGG + Exonic
1106323803 13:28668536-28668558 AATTCCATCTGTAATTTTAGCGG - Exonic
1107042307 13:35962168-35962190 ACTTTGACCTATAAGTTTTGGGG - Intronic
1107919629 13:45190716-45190738 CATTTGAAGTATAAGTTTTGTGG + Intronic
1108216482 13:48190036-48190058 ACTTCAACATATAAGTTTTGGGG - Intergenic
1111274095 13:85925051-85925073 AATTTAATCTATAAATTTTGTGG - Intergenic
1111464668 13:88593265-88593287 AATTCAAACTATGAATTGTGGGG + Intergenic
1111800061 13:92970152-92970174 AACTCAAACTCTAAGTTTTCAGG - Intergenic
1112404394 13:99105651-99105673 AATTTCAACTACATTTTTTGTGG + Intergenic
1113206990 13:107928402-107928424 AATTCCAATTATTATTTTTCTGG - Intergenic
1114841664 14:26270026-26270048 AATTCCTAGTGTAATTTTTGTGG - Intergenic
1116261964 14:42641416-42641438 GATTCGAACTGGAAGTTTTGTGG - Intergenic
1116489668 14:45491466-45491488 AATTCCAAATAGCTGTTTTGAGG - Intergenic
1117906573 14:60595250-60595272 AATTCTAAATATAATTTTTGAGG - Intergenic
1118789646 14:69078399-69078421 AATTCTATCTTTAATTTTTGGGG - Intronic
1120340533 14:83216129-83216151 AATTCAAACTAATTGTTTTGAGG - Intergenic
1120387714 14:83866735-83866757 ACTTCCAAATATAAATTTTGGGG + Intergenic
1120651469 14:87138917-87138939 AATTCCAACTTTTAGTTATTTGG + Intergenic
1120974509 14:90236899-90236921 AATTTCATATACAAGTTTTGGGG + Intergenic
1125311927 15:38389052-38389074 AATTCCATGTATAAGTATTGTGG + Intergenic
1125752663 15:42039898-42039920 ATTTCCAACCAGAAGTTTTGGGG + Intronic
1125983090 15:44021741-44021763 AATTCCATGTTTAATTTTTGAGG - Intronic
1126481173 15:49121738-49121760 AACTCAAAAAATAAGTTTTGTGG - Intronic
1126579452 15:50229833-50229855 AATCCCAAATATGAGTTGTGGGG - Intronic
1127354648 15:58186543-58186565 AATTCAAAATTTGAGTTTTGAGG + Intronic
1127621518 15:60739092-60739114 ATTTCAAAATATAAGTTTTGAGG + Intronic
1127662004 15:61108661-61108683 AATTACTACTCTAAGGTTTGAGG + Intronic
1129716623 15:77855828-77855850 CATTTCAACTCTAAGTTCTGGGG - Intergenic
1132006428 15:98232025-98232047 AATTCCCATTATAAAATTTGGGG + Intergenic
1132433428 15:101778437-101778459 GATTCCGACTTTGAGTTTTGTGG - Intergenic
1134842812 16:17415140-17415162 AATTCCAGCTTTGTGTTTTGGGG - Intronic
1135149809 16:19995546-19995568 AATTTCAACTTTTAGATTTGGGG + Intergenic
1135913520 16:26582556-26582578 TCTTCCAACCATAAGATTTGGGG + Intergenic
1138640818 16:58385118-58385140 GCTTCAAACTATAAGTATTGAGG - Intronic
1139004764 16:62557610-62557632 AATTCAAAATATCTGTTTTGAGG - Intergenic
1139143381 16:64295513-64295535 AATTCTATGTATAATTTTTGAGG + Intergenic
1142330961 16:89453392-89453414 AATTCCTATTAGAAATTTTGAGG - Intronic
1144352730 17:14413930-14413952 AATAAAAACTATAAGTTATGAGG - Intergenic
1146416138 17:32634965-32634987 AATTCCTACTATTCATTTTGGGG - Intronic
1146481067 17:33205334-33205356 AATTCCAAAAATATGTTCTGGGG + Intronic
1147615979 17:41828107-41828129 AATTCCAACCATCAGTTTTATGG + Intronic
1149069451 17:52521839-52521861 ATTTCAACATATAAGTTTTGGGG + Intergenic
1149737967 17:59014536-59014558 AATTCCAACTATAAGTTTTGAGG + Intronic
1152955980 18:42330-42352 AATTCCCACTTTCAGTTTTTTGG - Intergenic
1155438614 18:25838229-25838251 AATTCCTACTATAAGAGGTGTGG - Intergenic
1155993798 18:32308549-32308571 AATTCTAAATATAAGTTTTAGGG + Intronic
1157034583 18:43955596-43955618 AATTCAACATATAAATTTTGGGG + Intergenic
1158723709 18:59949077-59949099 AATTAAAATTATGAGTTTTGAGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1164028290 19:21374385-21374407 AATTCAGACTATACTTTTTGGGG + Intronic
1167306244 19:48711522-48711544 TTTTACAACTCTAAGTTTTGGGG + Intergenic
925089913 2:1146511-1146533 AATTCTAGCAAAAAGTTTTGTGG + Intronic
925511650 2:4633265-4633287 AATGCAAACTATAGGCTTTGAGG + Intergenic
925954255 2:8946524-8946546 TTTTCCAACTAGAAGGTTTGTGG + Intronic
927290189 2:21397517-21397539 AATTCCAACAAGTAGTTTTCTGG - Intergenic
929100098 2:38303031-38303053 AATTCAAAATAGCAGTTTTGAGG + Intronic
929159335 2:38816011-38816033 AATTCCAACTCCAAGTGCTGCGG + Intronic
929378979 2:41326875-41326897 AATTTCAACATGAAGTTTTGGGG - Intergenic
930475598 2:51876946-51876968 AATTCAAAATAGCAGTTTTGAGG + Intergenic
930542691 2:52726994-52727016 AATTACAACTAGGATTTTTGTGG + Intergenic
930553276 2:52862938-52862960 AATTTAAAATGTAAGTTTTGAGG - Intergenic
933226690 2:79757738-79757760 AATTCCAACTGTAGTTTTTATGG + Intronic
935106780 2:100052304-100052326 ACTTCCCAATGTAAGTTTTGTGG - Intronic
935819699 2:106882571-106882593 ACTTACAATTATCAGTTTTGTGG + Intronic
936664461 2:114578012-114578034 ACTTCAAAATATAAATTTTGGGG + Intronic
936880132 2:117240420-117240442 AATTTCAACTTTTAGATTTGAGG - Intergenic
937575421 2:123414976-123414998 AATTCCGACAATAATTTTTGTGG + Intergenic
938217142 2:129527579-129527601 AATACAAAATATCAGTTTTGAGG + Intergenic
938613710 2:132975799-132975821 AATTTCAACCTTAAGTTATGAGG - Intronic
940747576 2:157585864-157585886 TATGCCAAGTATAACTTTTGAGG + Intronic
943425529 2:187728376-187728398 GATTCCAAATCAAAGTTTTGGGG + Intergenic
943474520 2:188337943-188337965 AATTCCAACTCTAAATTCTTGGG + Intronic
943502910 2:188714143-188714165 AATTACAGTTGTAAGTTTTGAGG + Intergenic
944854911 2:203758616-203758638 AATTCAAAATATGTGTTTTGGGG - Intergenic
944945164 2:204676099-204676121 AATTCCAAGTATTTTTTTTGGGG + Intronic
945470003 2:210217345-210217367 AATTAGAACAATAAATTTTGGGG - Intronic
1169323419 20:4654732-4654754 GATGCCAACTATAAGTTTGAGGG - Intergenic
1169612566 20:7398738-7398760 AATTCTTATTATAACTTTTGAGG - Intergenic
1169628468 20:7598761-7598783 AATTCAAAATATCTGTTTTGAGG + Intergenic
1171355420 20:24541786-24541808 AATTCCCTTTATAACTTTTGTGG - Intronic
1173099069 20:40066564-40066586 AATTCCAAATAGCTGTTTTGAGG + Intergenic
1174986129 20:55454453-55454475 AATTCTAGCTAGAAATTTTGAGG - Intergenic
1176700402 21:10041104-10041126 AATTTCAACTTTTAGATTTGAGG + Intergenic
1177002415 21:15630692-15630714 AATTCCATGTTTAATTTTTGAGG - Intergenic
1177218246 21:18157016-18157038 AGTTCCAAGTTTAAGTGTTGCGG + Intronic
1177300688 21:19241957-19241979 AATTACTACTATAAGTTTCAAGG + Intergenic
1177460891 21:21408662-21408684 CATTCCCACAATAAGTTTTAGGG - Intronic
1179573050 21:42289352-42289374 ACTTCCAACTGGAAGTTTTAAGG - Intronic
1183316560 22:37140168-37140190 AATTCCAACGATCAGGTTTAAGG - Intronic
1184374271 22:44101769-44101791 AATTCCAAATGTCAGTTTTAGGG + Intronic
1185363806 22:50425554-50425576 AATTCCATGATTAAGTTTTGAGG + Intronic
949862274 3:8516564-8516586 AGTGCCAACTCTAAGTTTTCAGG - Intronic
950817585 3:15722580-15722602 ATGACCAACTATAAGTTTAGAGG - Intronic
951265022 3:20554676-20554698 AATTCCAAAAATAAATTATGTGG - Intergenic
951747909 3:25999575-25999597 AATTTTAATTTTAAGTTTTGAGG + Intergenic
951975914 3:28508261-28508283 AATTTCAACAAGAAGTTTGGAGG + Intronic
952739895 3:36724936-36724958 AATTCCAACTCCAAGACTTGAGG + Intronic
955729273 3:61966937-61966959 AAGCCCAACTTTAAGTTTTATGG - Intronic
956397496 3:68841366-68841388 AATGCAAATTAAAAGTTTTGTGG - Intronic
956903470 3:73741226-73741248 GATTCAACCTATAAATTTTGGGG + Intergenic
957015692 3:75062102-75062124 AATTGGCACTATAAATTTTGAGG + Intergenic
957233719 3:77556209-77556231 AATTCAAACTAAAAGTTTCATGG - Intronic
957283699 3:78187635-78187657 AATTCTAATTATAATTTTTGTGG - Intergenic
957425481 3:80033923-80033945 ACTTCAACATATAAGTTTTGAGG - Intergenic
957682330 3:83452735-83452757 ATTTCCACATATAAATTTTGAGG + Intergenic
959547275 3:107612151-107612173 AATTCAAAATATCTGTTTTGAGG - Intronic
960324282 3:116276273-116276295 AATTCCAAATGTAGTTTTTGAGG - Intronic
960367636 3:116792504-116792526 AATTCTAATAATAAGGTTTGGGG + Intronic
960541024 3:118863302-118863324 AATTCAAAATATATGTGTTGAGG - Intergenic
962425366 3:135264834-135264856 AATTTCAACTACAATTTTTATGG + Intergenic
962935599 3:140077704-140077726 TTTTCAAACTATAAGGTTTGAGG - Intronic
963026794 3:140927668-140927690 AATTCTGACTATAAGTTGTGGGG + Intergenic
963156027 3:142098283-142098305 AATTTGAAATATAATTTTTGAGG - Intronic
964332472 3:155619123-155619145 GTTACCAACTATAAGTTCTGGGG - Intronic
965959583 3:174412933-174412955 AATAACATCTAAAAGTTTTGGGG - Intergenic
966189131 3:177255858-177255880 AATTCCAGCTTTTGGTTTTGTGG + Intergenic
966257991 3:177941001-177941023 AATTTCATATATAATTTTTGTGG - Intergenic
966855430 3:184190479-184190501 AATTCCAAATTAATGTTTTGAGG + Intronic
968358363 3:198125906-198125928 AATTCCCACTTTCAGTTTTTTGG + Intergenic
969229977 4:5823478-5823500 AATTTCAACACGAAGTTTTGGGG - Intronic
971493410 4:27238124-27238146 AATTTCAACAATGAGTCTTGTGG + Intergenic
971592335 4:28484136-28484158 ATTTCAAAGTATGAGTTTTGAGG - Intergenic
971641819 4:29143852-29143874 AATTCCAATTATAATTTTCAGGG + Intergenic
972915538 4:43873770-43873792 AATTCAAACTAGCTGTTTTGAGG - Intergenic
974132473 4:57773778-57773800 AATTCAAACTGTTAGTTTTGAGG + Intergenic
974352762 4:60771954-60771976 AATTCAAACTAGCTGTTTTGAGG - Intergenic
975629919 4:76389170-76389192 AATTCAAAATATCTGTTTTGAGG + Intronic
975885120 4:78956199-78956221 AATTCGAACTTTGAGGTTTGTGG - Intergenic
976105293 4:81610741-81610763 AATTTCAACTTTTAGTTTTAGGG - Intronic
976870099 4:89781391-89781413 AAATGCAACTGGAAGTTTTGTGG + Intronic
976934150 4:90607742-90607764 ACTTCAAAATATAAATTTTGGGG + Intronic
977032072 4:91895985-91896007 AATTCATCCTAAAAGTTTTGAGG - Intergenic
977098545 4:92777569-92777591 ACTTCAAAATATAAATTTTGGGG - Intronic
978051927 4:104211447-104211469 CATACCAACCACAAGTTTTGTGG - Intergenic
978805835 4:112799364-112799386 AATTCCATTTTTAATTTTTGAGG + Intergenic
980372817 4:131899876-131899898 AATTTCAACTTTTAGATTTGAGG + Intergenic
980373123 4:131905629-131905651 ATTTCCACCTATAAGTTTCAGGG - Intergenic
982292784 4:153795361-153795383 AATTCCATCTTTAAGGTTTCAGG - Intergenic
982937593 4:161502699-161502721 AATTCTAAATAAAACTTTTGAGG - Intronic
986697131 5:10367574-10367596 AAATAAAACTCTAAGTTTTGGGG - Intronic
987054136 5:14175171-14175193 AATTCCAACCAGCAATTTTGGGG - Intronic
987609512 5:20183910-20183932 AATTGAAATTATAAATTTTGAGG - Intronic
987786323 5:22504271-22504293 AATTTCAGCTATCAGATTTGAGG - Intronic
989703380 5:44297865-44297887 ATTCCTAACTATAAGTTCTGTGG + Intergenic
990345485 5:54866676-54866698 AATTCCAAGTAAATATTTTGAGG - Intergenic
990751982 5:59026621-59026643 AATTACAAATAAAAGTTCTGTGG + Intronic
993085801 5:83362376-83362398 AATTCCAATTTTATCTTTTGGGG - Intergenic
993147825 5:84118669-84118691 AATTCCAACTCTAAACTTTCTGG - Intronic
993278715 5:85897610-85897632 AATTCAAAATAGAAGTTTTGAGG - Intergenic
993417339 5:87651578-87651600 AGTTCAACCTATATGTTTTGGGG + Intergenic
993580570 5:89654809-89654831 AATTCTAAATAGCAGTTTTGAGG + Intergenic
993660488 5:90627821-90627843 TATTCCAGATTTAAGTTTTGTGG + Intronic
994027801 5:95105199-95105221 ACTTGCAAATATAAGTTTTCTGG - Intronic
996264269 5:121516264-121516286 AATTGCAACCATAATTTTTCAGG + Intergenic
996623779 5:125543675-125543697 AATTAAAACTAAAACTTTTGGGG - Intergenic
996797482 5:127364931-127364953 AATACCAACTATGAATATTGGGG + Intronic
996982198 5:129512283-129512305 TACTCCAACCATAAGTATTGTGG + Intronic
997983265 5:138483567-138483589 AATTCTAAATATCAATTTTGTGG + Intergenic
998243730 5:140476068-140476090 AAATAAAACTAAAAGTTTTGGGG + Intronic
998720596 5:144943346-144943368 AATTCCAGCTATATTTTTTCAGG - Intergenic
999107342 5:149085478-149085500 AAAACCAAATATAAGTTGTGAGG - Intergenic
1000693950 5:164357133-164357155 AATTACAAATAGAAGTTATGTGG - Intergenic
1000780440 5:165473749-165473771 CATTCCAAAGATAAGTTCTGAGG - Intergenic
1003052574 6:2793195-2793217 GTTTCCAACTATAAGTTCTCAGG + Intergenic
1004751778 6:18569120-18569142 ATTTCAAAATATAAATTTTGGGG - Intergenic
1006566386 6:34961411-34961433 AAGCCCATCTAGAAGTTTTGGGG - Intronic
1007939359 6:45763698-45763720 AATAGCAACAATATGTTTTGTGG + Intergenic
1008802864 6:55391418-55391440 ATTTTGAACCATAAGTTTTGTGG + Intronic
1008831775 6:55772882-55772904 AATTCCACCTAGTAGTTTTATGG + Intronic
1010687693 6:78871575-78871597 GGTTTCAACTATAAATTTTGGGG - Intronic
1011828297 6:91336908-91336930 ACTTCAACATATAAGTTTTGGGG + Intergenic
1012568508 6:100692557-100692579 AATTCCAACTAGAAAATCTGAGG - Intronic
1012641040 6:101614293-101614315 AATTCAAAATAAAAGTTTGGGGG - Intronic
1013594080 6:111645431-111645453 GATTCCAACTATGAATTTGGGGG - Intergenic
1013963127 6:115925607-115925629 AGTTCAAACCCTAAGTTTTGGGG - Intergenic
1014733376 6:125061278-125061300 AATTCCACCTAGAAAGTTTGAGG + Intronic
1014926265 6:127274758-127274780 AATTCTAACTTGAAGTTTTTTGG - Intronic
1015473016 6:133627921-133627943 AATTCCAACATGAATTTTTGAGG + Intergenic
1016363837 6:143294863-143294885 AATTCCAACACTGAGGTTTGGGG - Intronic
1016508917 6:144817916-144817938 AATAACTACTATAACTTTTGGGG + Intronic
1016538372 6:145135139-145135161 AATTCAAAATAGATGTTTTGAGG - Intergenic
1016663228 6:146605095-146605117 AATTCAAACTATATGTAGTGGGG + Intronic
1017318760 6:153063290-153063312 AATTCAAAATATCAGTTTTGAGG + Intronic
1017655567 6:156625647-156625669 AAGTTCAATTATTAGTTTTGGGG + Intergenic
1017864847 6:158434226-158434248 AATTCAACATATGAGTTTTGGGG + Intronic
1017990336 6:159482393-159482415 AAGCCCAACTATCAGTCTTGGGG + Intergenic
1018691577 6:166348926-166348948 AATTGCAATTATAAATTTTTTGG + Intergenic
1019326471 7:440874-440896 GCTTCCACCTATAAGTTTGGAGG + Intergenic
1021298035 7:18933514-18933536 ATTTCCATATATAAATTTTGGGG + Intronic
1021644603 7:22776697-22776719 AATACCAACTATAAGTATTTTGG + Intergenic
1022155131 7:27653147-27653169 AATTCAACATATAAATTTTGTGG + Intronic
1027880380 7:83828076-83828098 AATACCACATATAGGTTTTGGGG - Intergenic
1028315226 7:89393377-89393399 AATTCTAATTATTAGTGTTGAGG + Intergenic
1028323106 7:89486525-89486547 AATTCAAAATAACAGTTTTGAGG + Intergenic
1028331399 7:89598282-89598304 AATTCCAACAAACATTTTTGTGG - Intergenic
1028955551 7:96685201-96685223 TATTCCCACTAAAAGTTTAGAGG - Intronic
1028972766 7:96876689-96876711 AATTCAAACTAGATGCTTTGAGG + Intergenic
1029178034 7:98678915-98678937 CATTCCCAGTCTAAGTTTTGAGG - Intergenic
1030416498 7:109250777-109250799 GATTCCAAGGATAAGATTTGGGG - Intergenic
1030874390 7:114795197-114795219 AACTCCAACTACAACTCTTGTGG + Intergenic
1031331545 7:120472078-120472100 TATTCCAACTATATAGTTTGGGG + Intronic
1031503191 7:122547266-122547288 AATTTCAATTTAAAGTTTTGGGG + Intronic
1031842151 7:126756677-126756699 AATTCCAACTATAAGACATCTGG + Intronic
1033864056 7:145666280-145666302 ATTTCCAACTCTAATTGTTGAGG + Intergenic
1036526512 8:9539795-9539817 ATTTCCACATATAAATTTTGAGG + Intergenic
1037143642 8:15547617-15547639 ATTTCAACCTATAAATTTTGTGG - Intronic
1038468726 8:27791817-27791839 AAATCCAACTAAAAGTAATGTGG - Intronic
1040865007 8:52039940-52039962 TAATCCAACTGTAAGTTCTGAGG - Intergenic
1041574351 8:59376988-59377010 AATTCAAATGACAAGTTTTGAGG + Intergenic
1041616197 8:59908726-59908748 AATTCAAAATAGATGTTTTGAGG + Intergenic
1042093418 8:65184694-65184716 AATTCCCACTTTAAAATTTGGGG - Intergenic
1043712387 8:83438579-83438601 AATTCCAACTAAAATTTTGTTGG + Intergenic
1043980128 8:86628379-86628401 AAATCCACATATAACTTTTGAGG - Intronic
1044078242 8:87850741-87850763 AATTCCAGCAATTTGTTTTGTGG + Intergenic
1046304686 8:112349879-112349901 ACTTCAAAATATAAATTTTGGGG - Intronic
1046580031 8:116080797-116080819 AATTCCATTTATAATTTTTCTGG - Intergenic
1047463001 8:125086596-125086618 AATTCAACATATAAATTTTGGGG + Intronic
1047612866 8:126538220-126538242 ATTTCCATGTATAAATTTTGGGG - Intergenic
1051119887 9:13741231-13741253 AATTCAAAATATATTTTTTGAGG - Intergenic
1051465284 9:17369479-17369501 AATTCCAAATAACTGTTTTGAGG + Intronic
1051713653 9:19958879-19958901 AAATCCAACCATCATTTTTGAGG + Intergenic
1051981316 9:23022741-23022763 AATTACACATATAACTTTTGTGG + Intergenic
1052479266 9:29001865-29001887 AATTCCACCTGTAAGTGGTGGGG - Intergenic
1052537429 9:29764876-29764898 AATTAGAACAATAAATTTTGGGG + Intergenic
1053402826 9:37842446-37842468 TATTGCAACTAAAAATTTTGGGG + Intronic
1053637605 9:40027916-40027938 AATTTCAACTTTTAGATTTGAGG + Intergenic
1053768476 9:41437306-41437328 AATTTCAACTTTTAGATTTGAGG - Intergenic
1054318397 9:63624507-63624529 AATTTCAACTTTTAGATTTGAGG + Intergenic
1054547144 9:66348804-66348826 AATTTCAACTTTTAGATTTGAGG - Intergenic
1056338992 9:85604689-85604711 AATTCAAACTAGATGTTTTGAGG + Intronic
1058872843 9:109217490-109217512 AATGCAAACTAGAAGTCTTGGGG + Intronic
1059576475 9:115494221-115494243 AATTCACCCTATAATTTTTGTGG - Intergenic
1059703490 9:116798323-116798345 TTTTCCAGCTATAAATTTTGTGG + Intronic
1061447381 9:130648000-130648022 AAATCCAACTAATAGTGTTGAGG + Intergenic
1061657917 9:132106978-132107000 AATTCCAACAACATGGTTTGGGG + Intergenic
1062742235 9:138182448-138182470 AATTCCCACTTTCAGTTTTTTGG + Intergenic
1202785413 9_KI270719v1_random:11172-11194 AATTTCAACTTTTAGATTTGAGG + Intergenic
1185915194 X:4027202-4027224 AATTTCAACTTTTAGATTTGGGG - Intergenic
1186584993 X:10863790-10863812 AATTCCAACTAGAAGCTTCAAGG + Intergenic
1186994663 X:15107257-15107279 AATTCAAACTAGAAGTTCTAAGG - Intergenic
1189168052 X:38881042-38881064 AATTACAATTATTTGTTTTGTGG - Intergenic
1189918470 X:45880187-45880209 AAATCCAAATAGGAGTTTTGAGG + Intergenic
1189964223 X:46355109-46355131 AATTCAACTTATGAGTTTTGGGG + Intergenic
1193691246 X:84646414-84646436 ATTTTCAACTGTAACTTTTGTGG - Intergenic
1193795516 X:85868277-85868299 ACTTTCAGCTATAAGTTCTGGGG + Intronic
1194192534 X:90855351-90855373 AAATCCAACTCTAAATATTGTGG - Intergenic
1194324163 X:92490893-92490915 AATGACAACTGTGAGTTTTGGGG + Intronic
1194466403 X:94239542-94239564 AATTCAAAGTAAATGTTTTGAGG - Intergenic
1194472629 X:94316213-94316235 AATTCAACATATAAATTTTGGGG + Intergenic
1194703313 X:97142764-97142786 AATTTCAAGTATAAGATTTATGG - Intronic
1195073509 X:101304206-101304228 AATTCAAAATAACAGTTTTGAGG - Intergenic
1195267251 X:103194506-103194528 AATTCTAACTTTACGTTTTAGGG - Intergenic
1195427071 X:104746416-104746438 AATTCATGCTTTAAGTTTTGTGG - Intronic
1196369446 X:114959989-114960011 ATTTCCAACTATAAAATTAGTGG + Intergenic
1196593568 X:117517378-117517400 GATTCCAACTAATATTTTTGAGG + Intergenic
1196848940 X:119919151-119919173 AATTCCAAGTATAATTTTGGAGG + Intronic
1197238897 X:124101550-124101572 AATTCCAACTTAAAATTATGAGG + Intronic
1197437397 X:126448455-126448477 AATTCAAAATAACAGTTTTGAGG - Intergenic
1197439719 X:126474028-126474050 AATTCAAAATAACAGTTTTGAGG + Intergenic
1198499148 X:137225461-137225483 GATTCAAAATATAAATTTTGGGG - Intergenic
1198612132 X:138412784-138412806 AATTCAAACTAACTGTTTTGAGG + Intergenic
1199311483 X:146326118-146326140 AATTTCAACTATTAGATTCGGGG + Intergenic
1199406389 X:147466560-147466582 AGTTCCAACATTAAGTTTGGAGG - Intergenic
1199561456 X:149168009-149168031 AGTTCCATCTATAACTTTTTAGG + Intergenic
1200295699 X:154917856-154917878 AATTCAAAATAAAAGTTCTGAGG - Intronic
1200539166 Y:4437797-4437819 AAATCCAACTATAAATATTGTGG - Intergenic
1201634729 Y:16110057-16110079 ATTTAAAATTATAAGTTTTGTGG + Intergenic
1201758106 Y:17511855-17511877 AATTCCCACTTTCAGTTTTCTGG - Intergenic
1201843449 Y:18394135-18394157 AATTCCCACTTTCAGTTTTCTGG + Intergenic
1202343854 Y:23900359-23900381 AATTCAAAATATCAGTTTTCAGG - Intergenic
1202526914 Y:25769725-25769747 AATTCAAAATATCAGTTTTCAGG + Intergenic