ID: 1149739689

View in Genome Browser
Species Human (GRCh38)
Location 17:59033542-59033564
Sequence CCACTACGGGAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287657
Summary {0: 1, 1: 40, 2: 2401, 3: 76121, 4: 209094}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149739689_1149739700 23 Left 1149739689 17:59033542-59033564 CCTGCCTCAGCCTCCCGTAGTGG 0: 1
1: 40
2: 2401
3: 76121
4: 209094
Right 1149739700 17:59033588-59033610 ACCTGTATTTTCAGTAGATACGG 0: 1
1: 1
2: 27
3: 571
4: 15223
1149739689_1149739703 25 Left 1149739689 17:59033542-59033564 CCTGCCTCAGCCTCCCGTAGTGG 0: 1
1: 40
2: 2401
3: 76121
4: 209094
Right 1149739703 17:59033590-59033612 CTGTATTTTCAGTAGATACGGGG 0: 3
1: 90
2: 5909
3: 117625
4: 228993
1149739689_1149739702 24 Left 1149739689 17:59033542-59033564 CCTGCCTCAGCCTCCCGTAGTGG 0: 1
1: 40
2: 2401
3: 76121
4: 209094
Right 1149739702 17:59033589-59033611 CCTGTATTTTCAGTAGATACGGG 0: 1
1: 10
2: 291
3: 11705
4: 190340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149739689 Original CRISPR CCACTACGGGAGGCTGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr