ID: 1149740699

View in Genome Browser
Species Human (GRCh38)
Location 17:59043197-59043219
Sequence TACCCAAGACTGTCATTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149740699_1149740701 21 Left 1149740699 17:59043197-59043219 CCAGTCAATGACAGTCTTGGGTA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1149740701 17:59043241-59043263 GCACCCAGCTTGACAATGTAAGG 0: 1
1: 0
2: 1
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149740699 Original CRISPR TACCCAAGACTGTCATTGAC TGG (reversed) Intronic
901667552 1:10835321-10835343 TAGCCCAGACTGTCATTACCCGG + Intergenic
904039806 1:27577245-27577267 TGCCCACGTCTGTCATTCACTGG - Intronic
907378671 1:54066508-54066530 TACAAAAAACTGTCATAGACAGG + Intronic
1066117760 10:32255415-32255437 TACACAAGAATTTCAGTGACAGG + Intergenic
1071301673 10:84260906-84260928 TACCAGAGGCTGTCTTTGACTGG - Intergenic
1072676015 10:97466785-97466807 CACCCAAGACTGTCAGTGTACGG + Exonic
1073443681 10:103568246-103568268 TACCCAACACTGGGATTGGCAGG + Intronic
1076177297 10:128377827-128377849 TGCCCAAGCCTGTCATGGAAAGG - Intergenic
1077941057 11:6844021-6844043 TTCCCTAGCCTGTCTTTGACAGG + Intergenic
1078967755 11:16366451-16366473 TACCCATACCTGTCATAGACTGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1085757705 11:79215443-79215465 TACCCAAGAATGACCTTGATTGG + Intronic
1086703235 11:89923804-89923826 TAACCAAGAATGTCAGTCACAGG + Intergenic
1090591259 11:128272404-128272426 TACCCAATACAGTCACTGACAGG + Intergenic
1094719217 12:33045814-33045836 TACCTAAGAATTTCATTGAAAGG - Intergenic
1098671904 12:73241334-73241356 AACTTTAGACTGTCATTGACAGG + Intergenic
1099217149 12:79867076-79867098 TAACCCAGTCTGTCATTGATGGG - Intronic
1100965051 12:100004043-100004065 TACGCAAGAATGTAATTCACTGG - Intergenic
1103583379 12:121933293-121933315 TCCCCCAGACTGTCTTTGGCTGG - Intronic
1109130801 13:58582895-58582917 TACCCAGGAGTGTCAGTGATGGG - Intergenic
1110487658 13:76065958-76065980 TCCCCAACACTGTCATTGCTGGG + Intergenic
1113095834 13:106663005-106663027 AACCCAGGACTGCTATTGACGGG - Intergenic
1116028518 14:39542104-39542126 TATCCAATTCTGTCATTGATGGG - Intergenic
1124363109 15:29053379-29053401 TACCCAAGATAGTCTTTGAGGGG + Intronic
1131451044 15:92540290-92540312 TAACAAAGGCTATCATTGACTGG - Intergenic
1132129611 15:99263732-99263754 CACCGAAGACTGACTTTGACAGG + Intronic
1135363304 16:21832887-21832909 TACCCAAGACGGGCATTTTCAGG + Intergenic
1136307102 16:29379614-29379636 TACCCAAGACGGGCATTTTCAGG + Intergenic
1136320626 16:29481857-29481879 TACCCAAGACGGGCATTTTCAGG + Intergenic
1136435199 16:30221197-30221219 TACCCAAGACGGGCATTTTCAGG + Intergenic
1136487768 16:30584281-30584303 TACCAAAGAAGGTCATTGAATGG - Intronic
1137068683 16:35878400-35878422 CACCCAAGACTGGGAATGACTGG + Intergenic
1138220637 16:55247452-55247474 TGCCCAAGACTGAGATTGGCTGG + Intergenic
1139855232 16:69974607-69974629 TACCCAAGACGGGCATTTTCAGG + Intergenic
1139884948 16:70201732-70201754 TACCCAAGACGGGCATTTTCAGG + Intergenic
1140367567 16:74393785-74393807 TACCCAAGACGGGCATTTTCAGG - Intergenic
1140546774 16:75817347-75817369 TACCCAACACTTTCTTGGACTGG + Intergenic
1140765442 16:78152657-78152679 TAACCAGGACTGTCACTGGCAGG + Intronic
1142653849 17:1376658-1376680 TTCCCAAGACTGTCCTTGCCAGG + Intronic
1145272807 17:21413663-21413685 TGCCCTAGCCTGTCACTGACAGG + Intronic
1145311015 17:21701126-21701148 TGCCCTAGCCTGTCACTGACAGG + Intronic
1148790090 17:50168047-50168069 TCCCCAAGACTGGCATTGGTGGG - Intronic
1149329443 17:55566251-55566273 CACTCATGACTGTCATTGAAGGG - Intergenic
1149740699 17:59043197-59043219 TACCCAAGACTGTCATTGACTGG - Intronic
1150860799 17:68798091-68798113 TACCCAAAATTGTCATTGTCAGG - Intergenic
1156026496 18:32660949-32660971 TATCCAAGTCTATCATTGATGGG - Intergenic
1165991740 19:39819163-39819185 TATACAAGACTGGCATTGAAGGG - Intergenic
1167355816 19:49003364-49003386 TACCCAAGACCTTCATGGAGAGG - Intronic
1168238790 19:55079049-55079071 GACCCCAGACTCACATTGACTGG - Exonic
925037383 2:699920-699942 TAACCAAGACTATCACTGACAGG + Intergenic
926854072 2:17233161-17233183 TACCCAAGAATGGAATTGATGGG - Intergenic
929499544 2:42478529-42478551 TACCTAAGAATGTCTTTGACAGG - Intronic
1175988007 20:62773787-62773809 TGCCCAAGGCTGTCATGGAGAGG + Intergenic
1181759165 22:25045952-25045974 TAACCTAGACTCTCATTGATGGG + Intronic
1182481992 22:30615115-30615137 TGCCCAAGACTTTCCTTGTCTGG - Intronic
1182721992 22:32410654-32410676 TAACACAGACTGTCATTGTCTGG - Intronic
1184689004 22:46109004-46109026 GACCCAAGCCTGTCCTTGAGTGG - Intronic
952160977 3:30692711-30692733 TACACAATACTATCATTGTCAGG + Exonic
954795162 3:53157653-53157675 CCACCAAGACTGTCATCGACAGG - Intronic
955527229 3:59833694-59833716 TACTCATGAAGGTCATTGACAGG + Intronic
956607407 3:71086608-71086630 TCCCCAAGTCTGTCAATGAGAGG + Intronic
957423890 3:80010058-80010080 CTTCCAAGACTATCATTGACTGG + Intergenic
957724113 3:84042491-84042513 TAGCCAAGGCTGTCTGTGACTGG + Intergenic
958073782 3:88650200-88650222 GACCCAACAATCTCATTGACTGG + Intergenic
960231939 3:115238579-115238601 TACCCAGTACTGTCATTGTCTGG + Intergenic
962380861 3:134897309-134897331 GACCCAAGAATGACATTGCCAGG - Intronic
962585419 3:136838194-136838216 TACCAAGTTCTGTCATTGACAGG - Intronic
963546909 3:146671570-146671592 TACCCATGAGTGTCATTTACAGG - Intergenic
963628506 3:147704265-147704287 TAACCAAGTCTATCATTGATGGG - Intergenic
965206296 3:165721460-165721482 TATCCAAAAGTGTAATTGACTGG - Intergenic
966068556 3:175846288-175846310 TACCCAAGACTGTGATCTGCTGG - Intergenic
972631371 4:40844638-40844660 TACCCAAGCCTGGCTTTGATAGG - Intronic
973702252 4:53548780-53548802 TTACCCAGACTGTCATTGATGGG - Intronic
978264696 4:106809947-106809969 TAACCAAAACTGTCATAGGCCGG - Intergenic
982188798 4:152832133-152832155 TACCCAAGAGTGAAATTGCCAGG + Intronic
986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG + Intergenic
990826602 5:59906985-59907007 TTACCAAATCTGTCATTGACAGG - Intronic
996718149 5:126604077-126604099 TTCCCTAGCCTGTCTTTGACAGG - Exonic
997065018 5:130549505-130549527 AACCCAAGACTGTTATTTAGAGG - Intergenic
998203830 5:140145581-140145603 CTCCCAAGGCTGTCATTGTCAGG + Intergenic
998453771 5:142254550-142254572 TACCCAAGGCTGACATTTTCTGG - Intergenic
1004632615 6:17436518-17436540 TACCCAGGACTGCCAATCACAGG + Intronic
1004927400 6:20428897-20428919 AACTCAAGACTGTCATTGCCAGG + Intronic
1005198972 6:23321753-23321775 TACCCAAGACTGGCAGTCAATGG + Intergenic
1006295749 6:33169323-33169345 TTCCCAGGTCTGTCATTCACAGG + Intronic
1014120013 6:117713793-117713815 TCCTCATAACTGTCATTGACTGG + Intergenic
1014267646 6:119299511-119299533 AACCCAAAACTATCATTAACAGG + Intronic
1022385524 7:29895308-29895330 TACCCAAGAGTGGAATTGATGGG - Intronic
1030310182 7:108060983-108061005 TGACCAAGACTGACATTAACAGG + Intronic
1030566962 7:111169552-111169574 CACCAAAGATTGTCATTGTCAGG - Intronic
1031554223 7:123151702-123151724 AACCCAAGTCTGTCATTTTCAGG - Intronic
1031642467 7:124181234-124181256 TAACCAAGACTGACACGGACGGG - Intergenic
1039005289 8:33029779-33029801 TAGCCAAAATTGTTATTGACAGG - Intergenic
1042271491 8:66961296-66961318 TACCCAAGACGGTGACTGGCAGG + Intronic
1042754015 8:72189928-72189950 TATCCAAGTCTATCATTGATGGG - Intergenic
1043817469 8:84819392-84819414 TACAGAAAAGTGTCATTGACAGG - Intronic
1052355892 9:27504488-27504510 TTTCAAAGACTGTCAGTGACTGG + Intronic
1059060331 9:111029481-111029503 TCCCCAAGCCTGTCACTCACTGG + Intronic
1060036346 9:120259335-120259357 TACCTCAGACTGTCACTTACTGG - Intergenic
1060486864 9:124053260-124053282 TACCCAGGACTGTCTGTGGCTGG - Intergenic
1187794386 X:22986226-22986248 TACCCAAGAGTGGCATTGCTGGG + Intergenic
1188092320 X:25978269-25978291 AGACCAAAACTGTCATTGACTGG + Intergenic
1191111314 X:56804872-56804894 TACCCATGCCTCTCAGTGACTGG + Intergenic
1193193877 X:78606666-78606688 TTCCCAACACTGTTATTTACTGG + Intergenic
1195459820 X:105111707-105111729 TCCCAAAGACTGTCATCGCCAGG - Intronic
1197978015 X:132185822-132185844 TACCTAGGACTGGCATTGCCAGG - Intergenic
1199217262 X:145274435-145274457 TACTCAAGAGTGTAATTGATGGG + Intergenic